Starting /dee2/code/volunteer_pipeline.sh SRR926847 current disk space = 3058792230912 free memory = 1173718548 SRR926847 SRAfilesize 28b8b403cdbefb2115832e93c585b827 SRR926847.sra SRR926847.sra file validated SRR926847 is single end SRR926847 is conventional basespace SRR926847 read1 length is 49 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR926847_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 49 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.62975 38.0 37.0 39.0 35.0 39.0 2 37.32275 38.0 37.0 39.0 35.0 39.0 3 37.39525 38.0 37.0 39.0 35.0 39.0 4 37.37125 38.0 37.0 39.0 35.0 39.0 5 36.70175 38.0 37.0 39.0 34.0 39.0 6 37.23125 38.0 37.0 39.0 35.0 39.0 7 37.035 38.0 37.0 39.0 34.0 39.0 8 36.9205 38.0 36.0 39.0 33.0 39.0 9 37.0635 38.0 36.0 39.0 34.0 39.0 10 36.92825 38.0 36.0 39.0 33.0 39.0 11 36.7645 38.0 36.0 39.0 33.0 39.0 12 36.86625 38.0 36.0 39.0 33.0 39.0 13 36.816 38.0 36.0 39.0 33.0 39.0 14 36.6685 38.0 36.0 39.0 33.0 39.0 15 36.409 38.0 36.0 39.0 32.0 39.0 16 35.63325 37.0 35.0 39.0 30.0 39.0 17 36.17325 38.0 35.0 39.0 31.0 39.0 18 36.296 38.0 36.0 39.0 32.0 39.0 19 35.8175 37.0 35.0 39.0 31.0 39.0 20 35.86825 37.0 35.0 39.0 31.0 39.0 21 35.458 37.0 35.0 38.0 30.0 39.0 22 35.531 37.0 35.0 39.0 30.0 39.0 23 34.74225 37.0 34.0 38.0 28.0 39.0 24 35.00275 37.0 34.0 38.0 29.0 39.0 25 34.971 37.0 34.0 38.0 29.0 39.0 26 34.6075 37.0 34.0 38.0 28.0 39.0 27 32.97025 35.0 31.0 37.0 25.0 39.0 28 34.0555 36.0 33.0 38.0 28.0 39.0 29 34.0735 36.0 33.0 38.0 27.0 39.0 30 33.52825 36.0 33.0 38.0 26.0 39.0 31 33.9295 36.0 34.0 38.0 27.0 39.0 32 33.64425 36.0 33.0 38.0 26.0 39.0 33 33.618 36.0 33.0 38.0 26.0 39.0 34 32.1705 35.0 31.0 37.0 23.0 38.0 35 32.45875 35.0 31.0 37.0 23.0 38.0 36 33.292 36.0 33.0 37.0 25.0 39.0 37 32.8135 36.0 32.0 37.0 23.0 38.0 38 32.2675 36.0 31.0 37.0 21.0 38.0 39 31.1965 35.0 30.0 37.0 19.0 38.0 40 30.69275 34.0 29.0 37.0 16.0 38.0 41 30.37175 34.0 28.0 37.0 13.0 38.0 42 30.91375 34.0 29.0 37.0 19.0 38.0 43 30.531 34.0 28.0 37.0 14.0 38.0 44 29.86525 33.0 28.0 36.0 13.0 37.0 45 28.62525 32.0 26.0 35.0 12.0 37.0 46 30.32075 34.0 29.0 37.0 13.0 38.0 47 31.54125 35.0 32.0 37.0 13.0 38.0 48 31.1915 35.0 31.0 37.0 11.0 38.0 49 30.72875 35.0 30.0 37.0 4.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 2.0 13 0.0 14 3.0 15 4.0 16 6.0 17 13.0 18 14.0 19 22.0 20 13.0 21 15.0 22 35.0 23 22.0 24 31.0 25 39.0 26 55.0 27 51.0 28 68.0 29 104.0 30 120.0 31 150.0 32 228.0 33 294.0 34 401.0 35 520.0 36 716.0 37 856.0 38 217.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 12.275 30.2 46.675 10.85 2 20.974999999999998 48.75 17.125 13.15 3 22.62262262262262 22.27227227227227 15.94094094094094 39.16416416416417 4 24.137068534267133 21.510755377688845 13.881940970485243 40.47023511755878 5 18.417705418468582 24.192317476469093 46.1714576443653 11.218519460697024 6 46.075 20.45 19.400000000000002 14.075 7 48.825 20.175 17.825 13.175 8 20.45 20.025000000000002 48.199999999999996 11.325000000000001 9 20.7 21.45 46.925 10.925 10 53.2 19.825 15.575 11.4 11 20.225 47.199999999999996 17.675 14.899999999999999 12 20.525 17.8 49.3 12.375 13 22.575 18.725 16.150000000000002 42.55 14 18.75 23.35 15.875 42.025 15 20.674999999999997 23.925 43.55 11.85 16 48.625 21.45 17.825 12.1 17 19.625 19.025 19.900000000000002 41.449999999999996 18 22.05 19.1 15.675 43.175000000000004 19 23.075000000000003 46.7 15.049999999999999 15.174999999999999 20 50.025 17.599999999999998 18.35 14.025000000000002 21 18.875 18.975 46.775 15.375 22 18.975 45.074999999999996 23.7 12.25 23 47.3 14.149999999999999 20.95 17.599999999999998 24 20.599999999999998 11.899999999999999 49.15 18.35 25 14.299999999999999 4.45 45.5 35.75 26 36.199999999999996 11.15 16.425 36.225 27 37.45 11.700000000000001 45.1 5.75 28 13.525 34.025 45.35 7.1 29 12.7 33.525 37.95 15.825 30 38.4 2.775 36.425000000000004 22.400000000000002 31 44.35 1.4749999999999999 7.725 46.45 32 13.700000000000001 1.625 13.775 70.89999999999999 33 35.425000000000004 1.55 16.225 46.800000000000004 34 35.375 1.15 47.925000000000004 15.55 35 4.8500000000000005 0.8250000000000001 54.425000000000004 39.900000000000006 36 3.175 0.675 49.95 46.2 37 4.9750000000000005 0.7250000000000001 78.85 15.45 38 11.725 0.8500000000000001 48.675000000000004 38.75 39 12.075 0.95 41.925000000000004 45.050000000000004 40 35.025 1.4500000000000002 48.475 15.049999999999999 41 35.675000000000004 2.15 25.825 36.35 42 12.475 4.825 47.3 35.4 43 11.600000000000001 14.524999999999999 69.45 4.425 44 34.575 24.425 38.3 2.7 45 33.975 57.074999999999996 6.0249999999999995 2.9250000000000003 46 3.4750000000000005 89.875 4.275 2.375 47 1.6500000000000001 92.75 3.775 1.825 48 1.775 93.675 3.1 1.4500000000000002 49 1.875 94.77499999999999 2.15 1.2 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.5 29 1.0 30 2.0 31 3.0 32 10.0 33 17.0 34 36.5 35 56.0 36 94.5 37 133.0 38 185.5 39 238.0 40 298.5 41 359.0 42 408.5 43 458.0 44 488.0 45 518.0 46 993.5 47 1469.0 48 891.0 49 313.0 50 240.5 51 168.0 52 145.0 53 122.0 54 90.5 55 59.0 56 45.5 57 32.0 58 23.5 59 15.0 60 17.5 61 20.0 62 14.5 63 9.0 64 5.0 65 1.0 66 3.0 67 5.0 68 3.5 69 2.0 70 2.0 71 2.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.1 4 0.05 5 1.725 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 49 4000.0 >>END_MODULE >>Sequence Duplication Levels warn #Total Deduplicated Percentage 66.325 #Duplication Level Percentage of deduplicated Percentage of total 1 95.77836411609498 63.525 2 2.6762156049754995 3.55 3 0.6784771956275913 1.35 4 0.3015454202789295 0.8 5 0.18846588767433095 0.625 6 0.07538635506973237 0.3 7 0.03769317753486619 0.17500000000000002 8 0.07538635506973237 0.4 9 0.0 0.0 >10 0.11307953260459858 1.25 >50 0.03769317753486619 1.35 >100 0.0 0.0 >500 0.0 0.0 >1k 0.03769317753486619 26.674999999999997 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source TACCTGGTTGATCCTGCCAGTAGTCGTATGCCGTCTTCTGCTTGAAAAA 1067 26.674999999999997 Illumina Single End Adapter 1 (95% over 22bp) TCGGACCAGGCTTCATTCCCCTCGTATGCCGTCTTCTGCTTGAAAAAAA 54 1.35 TruSeq Adapter, Index 16 (96% over 25bp) TACCNGGTTGATCCTGCCAGTAGTCGTATGCCGTCTTCTGCTTGAAAAA 22 0.5499999999999999 Illumina Single End Adapter 1 (95% over 22bp) GGGGATGTAGCTCAGATGGTTCGTATGCCGTCTTCTGCTTGAAAAAAAA 17 0.42500000000000004 Illumina Single End Adapter 2 (95% over 23bp) GGGATTGTAGTTCAATTGGTCAGAGCACCGCCCTCGTATGCCGTCTTCT 11 0.27499999999999997 No Hit GGGATTGTAGTTCAATTGGTCAGAGCACCGCCTCGTATGCCGTCTTCTG 8 0.2 TruSeq Adapter, Index 14 (95% over 22bp) TCGCTTGGTGCAGGTCGGGAATCGTATGCCGTCTTCTGCTTGAAAAAAA 8 0.2 Illumina Single End Adapter 1 (95% over 22bp) TACCTGGTTGATCCTGCCAGTAGTCGTATGCCGCCTTCTGCTTGAAAAA 7 0.17500000000000002 Illumina DpnII expression Adapter 2 (95% over 21bp) TACCTGGTTGATCCTGCCAGTAGTCGTATGCCGTCTTCTGCTTGCAAAA 6 0.15 Illumina Single End Adapter 1 (95% over 22bp) GGGGATGTAGCTCAGATGGTAGATCGTATGCCGTCTTCTGCTTGAAAAA 6 0.15 Illumina Single End Adapter 2 (95% over 24bp) GGTGAAGTGTTCGGATCGCGGCGTCGTATGCCGTCTTCTGCTTGAAAAA 5 0.125 Illumina Single End Adapter 1 (95% over 22bp) TTGCCAATTCCACCCATTCCAATCGTATGCCGTCTTCTGCTTGAAAAAA 5 0.125 Illumina Single End Adapter 2 (95% over 22bp) GGGGATGTAGCTCAGATGGTAGTCGTATGCCGTCTTCTGCTTGAAAAAA 5 0.125 Illumina Single End Adapter 2 (95% over 22bp) ATAACGACTCTCGGCAACGGATATTCGTATGCCGTCTTCTGCTTGAAAA 5 0.125 Illumina Single End Adapter 1 (95% over 22bp) GGCGGATGTAGCCAAGTGGATCGTATGCCGTCTTCTGCTTGAAAAAAAA 5 0.125 Illumina Single End Adapter 2 (95% over 23bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGATC 120 0.0 41.208332 7 GGTTGAT 120 0.0 41.208332 6 AGTAGTC 120 0.0 41.208332 19 CCAGTAG 120 0.0 41.208332 17 CAGTAGT 120 0.0 41.208332 18 TGATCCT 120 0.0 41.208332 9 TAGTCGT 120 0.0 41.208332 21 ACCTGGT 120 0.0 41.208332 2 TTGATCC 120 0.0 41.208332 8 TACCTGG 120 0.0 41.208332 1 CCTGGTT 120 0.0 41.208332 3 GTAGTCG 120 0.0 41.208332 20 ATCCTGC 115 0.0 41.130432 11 CCTGCCA 115 0.0 41.130432 13 GCCAGTA 115 0.0 41.130432 16 GATCCTG 115 0.0 41.130432 10 TGCCAGT 115 0.0 41.130432 15 CTGCCAG 115 0.0 41.130432 14 TCCTGCC 115 0.0 41.130432 12 TGGTTGA 125 0.0 39.559998 5 >>END_MODULE Read 966133 spots for SRR926847.sra Written 966133 spots for SRR926847.sra Read 966133 spots for SRR926847.sra Written 966133 spots for SRR926847.sra Read 966133 spots for SRR926847.sra Written 966133 spots for SRR926847.sra Read 966133 spots for SRR926847.sra Written 966133 spots for SRR926847.sra Read 966133 spots for SRR926847.sra Written 966133 spots for SRR926847.sra Read 966133 spots for SRR926847.sra Written 966133 spots for SRR926847.sra Read 966133 spots for SRR926847.sra Written 966133 spots for SRR926847.sra Read 966133 spots for SRR926847.sra Written 966133 spots for SRR926847.sra Read 966133 spots for SRR926847.sra Written 966133 spots for SRR926847.sra Read 966133 spots for SRR926847.sra Written 966133 spots for SRR926847.sra Read 966133 spots for SRR926847.sra Written 966133 spots for SRR926847.sra Read 966151 spots for SRR926847.sra Written 966151 spots for SRR926847.sra Read 966133 spots for SRR926847.sra Written 966133 spots for SRR926847.sra Read 966133 spots for SRR926847.sra Written 966133 spots for SRR926847.sra Read 966133 spots for SRR926847.sra Written 966133 spots for SRR926847.sra Read 966133 spots for SRR926847.sra Written 966133 spots for SRR926847.sra Read 966133 spots for SRR926847.sra Written 966133 spots for SRR926847.sra Read 966133 spots for SRR926847.sra Written 966133 spots for SRR926847.sra Read 966133 spots for SRR926847.sra Written 966133 spots for SRR926847.sra Read 966133 spots for SRR926847.sra Written 966133 spots for SRR926847.sra SRR ids: ['SRR926847.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l0qxvkfc SRR926847.sra spots: 19322678 blocks: [[1, 966133], [966134, 1932266], [1932267, 2898399], [2898400, 3864532], [3864533, 4830665], [4830666, 5796798], [5796799, 6762931], [6762932, 7729064], [7729065, 8695197], [8695198, 9661330], [9661331, 10627463], [10627464, 11593596], [11593597, 12559729], [12559730, 13525862], [13525863, 14491995], [14491996, 15458128], [15458129, 16424261], [16424262, 17390394], [17390395, 18356527], [18356528, 19322678]] SRR926847 file size 3065781 SRR926847 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR926847 SRR926847_1.fastq Input file: SRR926847_1.fastq trimmed: SRR926847-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 12:10:44 2025 >> started Mon Feb 10 12:10:53 2025 >> done (8.428s) 19322678 reads processed; of these: 24452 ( 0.13%) short reads filtered out after trimming by size control 2590 ( 0.01%) empty reads filtered out after trimming by size control 19295636 (99.86%) reads available; of these: 1294288 ( 6.71%) trimmed reads available after processing 18001348 (93.29%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7237 0.04% 19 15407 0.08% 20 24112 0.12% 21 10685 0.06% 22 14229 0.07% 23 26539 0.14% 24 58144 0.30% 25 81940 0.42% 26 43419 0.23% 27 24707 0.13% 28 20698 0.11% 29 29022 0.15% 30 44597 0.23% 31 7518 0.04% 32 14371 0.07% 33 21176 0.11% 34 21063 0.11% 35 26954 0.14% 36 11889 0.06% 37 19362 0.10% 38 48290 0.25% 39 41065 0.21% 40 87668 0.45% 41 26452 0.14% 42 36610 0.19% 43 71824 0.37% 44 136039 0.71% 45 157964 0.82% 46 40846 0.21% 47 52203 0.27% 48 72258 0.37% 49 18001348 93.29% 19295636 reads passed initial QC criterion=sequence-density sequence-density=94.72 sequence-density-rank=1 fanout-score=11.38 fanout-score-rank=6 prefix-density=96.16 prefix-fanout=11.2 sequence=TCGTATGCCGTCTTCTGCTTGAAAAACA criterion=fanout-score sequence-density=5.62 sequence-density-rank=2 fanout-score=43.10 fanout-score-rank=1 prefix-density=5.66 prefix-fanout=42.8 sequence=GGTCGTATGCCG Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TCGTATGCCGTCTTCTGCTTGAAAAACA -o SRR926847 - Input file: STDIN trimmed: SRR926847-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): TCGTATGCCGTCTTCTGCTTGAAAAACA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Mon Feb 10 12:11:19 2025 >> started Mon Feb 10 12:11:33 2025 >> done (14.282s) 18889412 reads processed; of these: 122235 ( 0.65%) short reads filtered out after trimming by size control 2142 ( 0.01%) empty reads filtered out after trimming by size control 18765035 (99.34%) reads available; of these: 18389803 (98.00%) trimmed reads available after processing 375232 ( 2.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 89589 0.48% 19 224277 1.20% 20 492783 2.63% 21 2119169 11.29% 22 1901727 10.13% 23 5429685 28.94% 24 6655499 35.47% 25 492235 2.62% 26 269876 1.44% 27 220094 1.17% 28 177760 0.95% 29 159319 0.85% 30 128906 0.69% 31 102814 0.55% 32 119266 0.64% 33 105350 0.56% 34 30780 0.16% 35 10884 0.06% 36 3799 0.02% 37 1632 0.01% 38 998 0.01% 39 579 0.00% 40 915 0.00% 41 259 0.00% 42 183 0.00% 43 276 0.00% 44 394 0.00% 45 329 0.00% 46 97 0.00% 47 140 0.00% 48 214 0.00% 49 25207 0.13% criterion=sequence-density sequence-density=1.77 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=14 prefix-density=0.00 prefix-fanout=1.0 sequence=GGGGATGTAGCTCAGATGGTAGAGC criterion=fanout-score sequence-density=0.24 sequence-density-rank=6 fanout-score=9.47 fanout-score-rank=1 prefix-density=1.93 prefix-fanout=1.2 sequence=TGTAGCTCAAACGGTAGAGC Started job on | Feb 10 12:11:52 Started mapping on | Feb 10 12:11:52 Finished on | Feb 10 12:13:14 Mapping speed, Million of reads per hour | 841.67 Number of input reads | 19171259 Average input read length | 23 UNIQUE READS: Uniquely mapped reads number | 3314236 Uniquely mapped reads % | 17.29% Average mapped length | 21.00 Number of splices: Total | 971472 Number of splices: Annotated (sjdb) | 34182 Number of splices: GT/AG | 947990 Number of splices: GC/AG | 22966 Number of splices: AT/AC | 25 Number of splices: Non-canonical | 491 Mismatch rate per base, % | 3.38% Deletion rate per base | 0.00% Deletion average length | 1.32 Insertion rate per base | 0.00% Insertion average length | 1.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 5308825 % of reads mapped to multiple loci | 27.69% Number of reads mapped to too many loci | 7271682 % of reads mapped to too many loci | 37.93% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 17.00% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 10548198 10548198 10548198 N_multimapping 5308825 5308825 5308825 N_noFeature 2310234 2742045 2842528 N_ambiguous 80453 25778 15524 UnstrandedReadsAssigned:923549 PositiveStrandReadsAssigned:546413 NegativeStrandReadsAssigned:456184 Dataset is classified unstranded MeadianReadLen=23 20thPercentileLength=22 echo kmer=19 SRR926847 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=19 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 19 [index] number of targets: 52,400 [index] number of k-mers: 59,590,899 [index] number of equivalence classes: 293,668 [quant] running in single-end mode [quant] will process file 1: SRR926847-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,171,259 reads, 6,763,654 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 857 rounds 52401 SRR926847.ke.tsv 34699 SRR926847.se.tsv 87100 total ==> SRR926847.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 0 0 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 1 0.235288 Potri.007G009000.2.v4.1 1416 1317 13 2.002 Potri.003G141000.2.v4.1 2943 2844 0 0 Potri.016G087400.1.v4.1 270 171 0 0 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 0 0 ==> SRR926847.se.tsv <== Potri.001G166300.v4.1 29 Potri.001G448400.v4.1 26 Potri.001G233950.v4.1 160 Potri.001G122700.v4.1 2 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 44 Potri.001G256600.v4.1 6 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 30 Potri.001G452600.v4.1 16 SRR926847 completed mapping pipeline successfully