Starting /dee2/code/volunteer_pipeline.sh SRR9321772 current disk space = 3051239755776 free memory = 1488157572 SRR9321772 SRAfilesize acdafe9582070685f6ae9cb1944655d5 SRR9321772.sra SRR9321772.sra file validated SRR9321772 is paired end SRR9321772 is conventional basespace SRR9321772 read1 length is 59-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9321772_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 59-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6025 32.0 32.0 32.0 32.0 32.0 2 31.6055 32.0 32.0 32.0 32.0 32.0 3 31.63525 32.0 32.0 32.0 32.0 32.0 4 31.66 32.0 32.0 32.0 32.0 32.0 5 31.68575 32.0 32.0 32.0 32.0 32.0 6 35.01525 36.0 36.0 36.0 36.0 36.0 7 35.371 36.0 36.0 36.0 36.0 36.0 8 35.3615 36.0 36.0 36.0 36.0 36.0 9 35.4225 36.0 36.0 36.0 36.0 36.0 10-11 35.343999999999994 36.0 36.0 36.0 36.0 36.0 12-13 35.439375 36.0 36.0 36.0 36.0 36.0 14-15 35.375625 36.0 36.0 36.0 36.0 36.0 16-17 35.380250000000004 36.0 36.0 36.0 36.0 36.0 18-19 35.379999999999995 36.0 36.0 36.0 36.0 36.0 20-21 35.354375000000005 36.0 36.0 36.0 36.0 36.0 22-23 35.343625 36.0 36.0 36.0 36.0 36.0 24-25 35.268125 36.0 36.0 36.0 36.0 36.0 26-27 35.209875 36.0 36.0 36.0 36.0 36.0 28-29 35.302625 36.0 36.0 36.0 36.0 36.0 30-31 35.233625 36.0 36.0 36.0 36.0 36.0 32-33 35.240375 36.0 36.0 36.0 36.0 36.0 34-35 35.134874999999994 36.0 36.0 36.0 36.0 36.0 36-37 35.10425 36.0 36.0 36.0 36.0 36.0 38-39 35.127625 36.0 36.0 36.0 36.0 36.0 40-41 35.103 36.0 36.0 36.0 36.0 36.0 42-43 35.192125 36.0 36.0 36.0 36.0 36.0 44-45 35.15875 36.0 36.0 36.0 36.0 36.0 46-47 35.126625000000004 36.0 36.0 36.0 36.0 36.0 48-49 34.961875 36.0 36.0 36.0 36.0 36.0 50-51 35.144375 36.0 36.0 36.0 36.0 36.0 52-53 35.113875 36.0 36.0 36.0 36.0 36.0 54-55 35.000249999999994 36.0 36.0 36.0 36.0 36.0 56-57 35.055 36.0 36.0 36.0 36.0 36.0 58-59 34.966 36.0 36.0 36.0 34.0 36.0 60-61 34.96761690422606 36.0 36.0 36.0 36.0 36.0 62-63 34.970867716929234 36.0 36.0 36.0 36.0 36.0 64-65 34.908852213053265 36.0 36.0 36.0 36.0 36.0 66-67 34.91897126983096 36.0 36.0 36.0 36.0 36.0 68-69 34.858788476049384 36.0 36.0 36.0 36.0 36.0 70-71 34.738019198763 36.0 36.0 36.0 32.0 36.0 72-73 34.74739268802574 36.0 36.0 36.0 32.0 36.0 74-75 34.627460557042774 36.0 36.0 36.0 32.0 36.0 76 34.26266924564797 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 2.0 25 3.0 26 8.0 27 23.0 28 37.0 29 42.0 30 69.0 31 80.0 32 119.0 33 194.0 34 440.0 35 2981.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.925 12.3 10.825 41.949999999999996 2 21.25 17.125 40.475 21.15 3 20.125 21.05 24.725 34.1 4 24.6 29.2 21.9 24.3 5 22.75 34.475 23.7 19.075 6 18.31021437578815 35.73770491803279 25.044136191677175 20.907944514501892 7 15.275 22.925 42.125 19.675 8 18.45 22.95 31.374999999999996 27.224999999999998 9 18.0 23.974999999999998 33.85 24.175 10-11 22.2125 31.4 23.1 23.2875 12-13 21.712500000000002 24.625 27.3625 26.3 14-15 20.674999999999997 27.975 27.9125 23.4375 16-17 21.1875 26.737499999999997 27.5875 24.4875 18-19 21.3625 27.6375 26.450000000000003 24.55 20-21 20.349999999999998 27.8125 26.724999999999998 25.112499999999997 22-23 21.0375 27.275 27.3875 24.3 24-25 20.7375 26.875 26.7625 25.624999999999996 26-27 21.349999999999998 26.9125 27.525 24.212500000000002 28-29 20.9125 27.875 27.0875 24.125 30-31 20.837500000000002 27.4125 26.825 24.925 32-33 20.325 27.0125 27.8375 24.825 34-35 20.925 27.1375 27.6125 24.325 36-37 19.787499999999998 27.5125 27.200000000000003 25.5 38-39 21.349999999999998 26.875 26.55 25.224999999999998 40-41 20.925 28.237499999999997 26.2125 24.625 42-43 21.275 27.8375 26.424999999999997 24.462500000000002 44-45 21.462500000000002 26.4625 27.2625 24.8125 46-47 22.5 27.737499999999997 26.325 23.4375 48-49 20.974999999999998 27.8375 25.974999999999998 25.2125 50-51 21.349999999999998 26.75 26.2875 25.6125 52-53 21.05 28.3375 26.75 23.8625 54-55 21.337500000000002 28.1125 25.7625 24.7875 56-57 20.8 27.3 26.75 25.15 58-59 20.6125 28.425 26.8 24.1625 60-61 21.6929232308077 27.056764191047762 26.819204801200303 24.431107776944234 62-63 21.555388847211805 27.04426106526632 27.431857964491122 23.968492123030757 64-65 21.092773193298324 27.85696424106027 26.944236059014752 24.10602650662666 66-67 21.182943603851445 27.260222583468803 27.01012879829936 24.546705014380393 68-69 21.50093808630394 28.005003126954346 26.52908067542214 23.964978111319574 70-71 21.21667292527225 27.16234822881462 27.312554762798847 24.308424083114282 72-73 21.171737490570784 27.96077445310536 25.86120191098818 25.006286145335682 74-75 20.493333333333332 24.253333333333334 28.746666666666666 26.506666666666668 76 21.779497098646033 0.0 38.76208897485493 39.458413926499034 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 3.0 24 4.0 25 4.5 26 6.5 27 9.0 28 9.5 29 12.0 30 28.5 31 42.5 32 54.0 33 65.0 34 79.5 35 88.5 36 92.0 37 116.5 38 144.0 39 167.0 40 191.0 41 240.0 42 271.0 43 278.5 44 295.0 45 286.5 46 278.0 47 292.5 48 288.0 49 262.5 50 244.0 51 227.5 52 206.5 53 166.0 54 141.0 55 141.0 56 127.5 57 101.0 58 83.5 59 62.5 60 44.5 61 38.0 62 27.0 63 20.5 64 13.0 65 7.5 66 7.5 67 7.0 68 4.5 69 3.5 70 2.0 71 1.0 72 1.5 73 2.5 74 2.5 75 2.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.8750000000000001 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 59 1.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 0.0 68 1.0 69 1.0 70 3.0 71 4.0 72 24.0 73 85.0 74 260.0 75 1035.0 76 2585.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.05 #Duplication Level Percentage of deduplicated Percentage of total 1 98.36817950025497 96.45 2 1.3513513513513513 2.65 3 0.22947475777664456 0.675 4 0.025497195308516064 0.1 5 0.025497195308516064 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9321772 read2 length is 40-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9321772_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 40-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.35825 32.0 32.0 32.0 32.0 32.0 2 31.2045 32.0 32.0 32.0 32.0 32.0 3 31.2065 32.0 32.0 32.0 32.0 32.0 4 31.166 32.0 32.0 32.0 32.0 32.0 5 31.13275 32.0 32.0 32.0 32.0 32.0 6 34.65025 36.0 36.0 36.0 32.0 36.0 7 34.70975 36.0 36.0 36.0 32.0 36.0 8 34.69775 36.0 36.0 36.0 32.0 36.0 9 34.74475 36.0 36.0 36.0 32.0 36.0 10-11 34.703500000000005 36.0 36.0 36.0 32.0 36.0 12-13 34.720875 36.0 36.0 36.0 34.0 36.0 14-15 34.726625 36.0 36.0 36.0 32.0 36.0 16-17 34.622875 36.0 36.0 36.0 32.0 36.0 18-19 34.62175 36.0 36.0 36.0 32.0 36.0 20-21 34.48175 36.0 36.0 36.0 32.0 36.0 22-23 34.535 36.0 36.0 36.0 32.0 36.0 24-25 34.488749999999996 36.0 36.0 36.0 32.0 36.0 26-27 34.50725 36.0 36.0 36.0 32.0 36.0 28-29 34.496375 36.0 36.0 36.0 32.0 36.0 30-31 34.512125 36.0 36.0 36.0 32.0 36.0 32-33 34.491625 36.0 36.0 36.0 32.0 36.0 34-35 34.399 36.0 36.0 36.0 32.0 36.0 36-37 34.492125 36.0 36.0 36.0 32.0 36.0 38-39 34.301249999999996 36.0 36.0 36.0 32.0 36.0 40-41 34.34191638534634 36.0 36.0 36.0 32.0 36.0 42-43 34.285946486621654 36.0 36.0 36.0 32.0 36.0 44-45 34.1124031007752 36.0 36.0 36.0 32.0 36.0 46-47 34.16104026006502 36.0 36.0 36.0 32.0 36.0 48-49 34.25343835958989 36.0 36.0 36.0 32.0 36.0 50-51 34.01962990747687 36.0 36.0 36.0 32.0 36.0 52-53 33.996999249812454 36.0 36.0 36.0 32.0 36.0 54-55 33.95123655851431 36.0 36.0 36.0 32.0 36.0 56-57 33.925337668834416 36.0 36.0 36.0 32.0 36.0 58-59 33.96073036518259 36.0 36.0 36.0 32.0 36.0 60-61 33.913059794846134 36.0 36.0 36.0 29.5 36.0 62-63 33.88754065549162 36.0 36.0 36.0 32.0 36.0 64-65 33.83683683683684 36.0 36.0 36.0 29.5 36.0 66-67 33.715023736806415 36.0 36.0 36.0 27.0 36.0 68-69 33.69161910283407 36.0 36.0 36.0 27.0 36.0 70-71 33.77055368066755 36.0 36.0 36.0 27.0 36.0 72-73 33.70046204311093 36.0 36.0 36.0 27.0 36.0 74-75 33.62414691939676 36.0 36.0 36.0 27.0 36.0 76 32.711470240441464 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 4.0 16 6.0 17 8.0 18 6.0 19 9.0 20 3.0 21 8.0 22 11.0 23 13.0 24 12.0 25 19.0 26 42.0 27 54.0 28 64.0 29 97.0 30 103.0 31 108.0 32 165.0 33 281.0 34 655.0 35 2329.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.30072554415812 18.839129347010257 13.785339004253188 33.074806104578435 2 28.775000000000002 25.324999999999996 31.125000000000004 14.774999999999999 3 22.15 26.625 28.375 22.85 4 25.15 33.475 21.875 19.5 5 27.175 35.975 20.8 16.05 6 22.375 36.625 21.025 19.975 7 20.5 18.125 40.325 21.05 8 23.13078269567392 22.83070767691923 27.85696424106027 26.18154538634659 9 23.55588897224306 24.681170292573142 27.956989247311824 23.80595148787197 10-11 25.381345336334082 30.97024256064016 21.955488872218055 21.6929232308077 12-13 24.640400250156347 24.677923702313947 26.91682301438399 23.764853033145716 14-15 23.695733767046164 27.323908419867383 26.485674965594896 22.494682847491553 16-17 24.9906191369606 27.17948717948718 25.728580362726706 22.101313320825515 18-19 24.56535334584115 26.691682301438398 26.6541588492808 22.088805503439648 20-21 24.90306441525954 27.67979987492183 25.816135084427767 21.60100062539087 22-23 24.97185036907294 26.936069060427876 26.147879394470163 21.944201176029026 24-25 23.949474737368686 27.351175587793897 26.025512756378188 22.67383691845923 26-27 24.280710532899676 27.032774580935705 26.7575681761321 21.928946710032523 28-29 24.652908067542214 26.666666666666668 26.14133833646029 22.539086929330832 30-31 24.168126094570926 27.545659244433324 26.407305479109333 21.878909181886414 32-33 25.431573680260193 27.708281210908183 25.444083062296723 21.4160620465349 34-35 24.274637318659327 27.60130065032516 26.775887943971988 21.34817408704352 36-37 24.377736085053158 27.354596622889304 26.454033771106943 21.813633520950596 38-39 24.768576432324245 27.370527895921942 26.670002501876404 21.19089316987741 40-41 25.663163163163162 27.18968968968969 25.963463463463466 21.183683683683686 42-43 24.7935951963973 27.207905929447087 25.91943957968476 22.079059294470856 44-45 24.468351263447584 27.420565424068048 26.182136602451838 21.928946710032523 46-47 24.86865148861646 28.15861896422317 25.093820365273956 21.878909181886414 48-49 24.843632724543408 27.495621716287218 26.032024018013512 21.62872154115587 50-51 24.796697109971223 27.73676967346428 25.59739772300763 21.86913549355686 52-53 25.275275275275277 27.7027027027027 26.3013013013013 20.72072072072072 54-55 24.81541734451258 27.055437367037914 25.916656238268054 22.212489050181457 56-57 24.780976220275345 27.50938673341677 26.47058823529412 21.239048811013767 58-59 24.93116395494368 26.47058823529412 26.633291614518146 21.964956195244056 60-61 25.51326990485729 26.802704056084124 25.97646469704557 21.707561342013022 62-63 25.187781672508763 28.254882323485226 25.938908362543817 20.61842764146219 64-65 25.507137490608567 26.22088655146506 26.045579764588027 22.226396193338342 66-67 25.71392785571142 27.59268537074148 25.58867735470942 21.104709418837675 68-69 24.79639142964541 27.878711940859542 25.535647162009774 21.789249467485277 70-71 24.77432296890672 27.068706118355063 25.940320962888663 22.216649949849547 72-73 23.850900390379046 26.860596902153382 26.79763253998237 22.490870167485202 74-75 25.40817703413844 23.384158683038724 27.70206449871812 23.505599784104707 76 26.953433307024465 0.0 39.423835832675614 33.622730860299924 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.5 18 1.5 19 1.5 20 1.0 21 0.5 22 1.5 23 1.5 24 2.0 25 3.0 26 3.0 27 6.0 28 9.0 29 11.0 30 19.0 31 31.0 32 37.5 33 39.0 34 46.0 35 68.5 36 101.0 37 124.5 38 129.5 39 160.5 40 208.0 41 235.0 42 252.5 43 273.5 44 296.5 45 313.5 46 321.0 47 308.0 48 291.5 49 269.0 50 230.5 51 208.0 52 204.0 53 171.5 54 141.0 55 131.5 56 121.0 57 97.5 58 75.5 59 57.5 60 48.5 61 44.5 62 32.0 63 27.0 64 18.0 65 11.0 66 8.0 67 7.5 68 8.5 69 7.0 70 3.0 71 1.5 72 3.0 73 3.5 74 2.0 75 1.0 76 1.0 77 2.0 78 1.5 79 0.0 80 1.0 81 1.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.5 96 1.0 97 0.5 98 0.0 99 10.5 100 21.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.025 9 0.025 10-11 0.025 12-13 0.0625 14-15 0.08750000000000001 16-17 0.0625 18-19 0.0625 20-21 0.0625 22-23 0.08750000000000001 24-25 0.05 26-27 0.075 28-29 0.0625 30-31 0.075 32-33 0.075 34-35 0.05 36-37 0.0625 38-39 0.075 40-41 0.08751093886735842 42-43 0.05001250312578145 44-45 0.05001250312578145 46-47 0.05001250312578145 48-49 0.05001250312578145 50-51 0.06251562890722681 52-53 0.07501875468867217 54-55 0.07502813555083156 56-57 0.0750375187593797 58-59 0.0750375187593797 60-61 0.07505629221916438 62-63 0.07505629221916438 64-65 0.07507507507507508 66-67 0.0750938673341677 68-69 0.075122073369225 70-71 0.1002004008016032 72-73 0.07550018875047187 74-75 0.08089524066334097 76 0.11824990145841545 >>END_MODULE >>Sequence Length Distribution warn #Length Count 40 1.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 1.0 55 0.0 56 0.0 57 0.0 58 0.0 59 1.0 60 0.0 61 0.0 62 0.0 63 1.0 64 0.0 65 0.0 66 2.0 67 0.0 68 1.0 69 0.0 70 2.0 71 6.0 72 23.0 73 97.0 74 313.0 75 1015.0 76 2537.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.82772680937818 96.95 2 0.9429153924566768 1.8499999999999999 3 0.1529051987767584 0.44999999999999996 4 0.025484199796126403 0.1 5 0.025484199796126403 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025484199796126403 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 21 0.525 No Hit GTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTAATCCAACCTAGTACGAGAGGAACCGTTGATTCGCACA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1193485 spots for SRR9321772.sra Written 1193485 spots for SRR9321772.sra Read 1193485 spots for SRR9321772.sra Written 1193485 spots for SRR9321772.sra Read 1193485 spots for SRR9321772.sra Written 1193485 spots for SRR9321772.sra Read 1193485 spots for SRR9321772.sra Written 1193485 spots for SRR9321772.sra Read 1193485 spots for SRR9321772.sra Written 1193485 spots for SRR9321772.sra Read 1193485 spots for SRR9321772.sra Written 1193485 spots for SRR9321772.sra Read 1193485 spots for SRR9321772.sra Written 1193485 spots for SRR9321772.sra Read 1193485 spots for SRR9321772.sra Written 1193485 spots for SRR9321772.sra Read 1193485 spots for SRR9321772.sra Written 1193485 spots for SRR9321772.sra Read 1193485 spots for SRR9321772.sra Written 1193485 spots for SRR9321772.sra Read 1193485 spots for SRR9321772.sra Written 1193485 spots for SRR9321772.sra Read 1193485 spots for SRR9321772.sra Written 1193485 spots for SRR9321772.sra Read 1193485 spots for SRR9321772.sra Written 1193485 spots for SRR9321772.sra Read 1193485 spots for SRR9321772.sra Written 1193485 spots for SRR9321772.sra Read 1193485 spots for SRR9321772.sra Written 1193485 spots for SRR9321772.sra Read 1193495 spots for SRR9321772.sra Written 1193495 spots for SRR9321772.sra Read 1193485 spots for SRR9321772.sra Written 1193485 spots for SRR9321772.sra Read 1193485 spots for SRR9321772.sra Written 1193485 spots for SRR9321772.sra Read 1193485 spots for SRR9321772.sra Written 1193485 spots for SRR9321772.sra Read 1193485 spots for SRR9321772.sra Written 1193485 spots for SRR9321772.sra SRR ids: ['SRR9321772.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1h8_un_p SRR9321772.sra spots: 23869710 blocks: [[1, 1193485], [1193486, 2386970], [2386971, 3580455], [3580456, 4773940], [4773941, 5967425], [5967426, 7160910], [7160911, 8354395], [8354396, 9547880], [9547881, 10741365], [10741366, 11934850], [11934851, 13128335], [13128336, 14321820], [14321821, 15515305], [15515306, 16708790], [16708791, 17902275], [17902276, 19095760], [19095761, 20289245], [20289246, 21482730], [21482731, 22676215], [22676216, 23869710]] SRR9321772 file size 4523845 SRR9321772 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9321772 SRR9321772_1.fastq SRR9321772_2.fastq Input file: SRR9321772_1.fastq Paired file: SRR9321772_2.fastq trimmed: SRR9321772-trimmed-pair1.fastq, SRR9321772-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 12:33:12 2025 >> started Wed Feb 12 12:33:33 2025 >> done (21.343s) 23869710 read pairs processed; of these: 3488 ( 0.01%) short read pairs filtered out after trimming by size control 9300 ( 0.04%) empty read pairs filtered out after trimming by size control 23856922 (99.95%) read pairs available; of these: 12666 ( 0.05%) trimmed read pairs available after processing 23844256 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 5 0.00% 24 7 0.00% 25 8 0.00% 26 6 0.00% 27 10 0.00% 28 22 0.00% 29 7 0.00% 30 17 0.00% 31 16 0.00% 32 8 0.00% 33 24 0.00% 34 16 0.00% 35 188 0.00% 36 167 0.00% 37 192 0.00% 38 249 0.00% 39 246 0.00% 40 250 0.00% 41 271 0.00% 42 296 0.00% 43 363 0.00% 44 354 0.00% 45 423 0.00% 46 362 0.00% 47 485 0.00% 48 538 0.00% 49 577 0.00% 50 697 0.00% 51 815 0.00% 52 800 0.00% 53 941 0.00% 54 951 0.00% 55 1253 0.01% 56 1292 0.01% 57 1390 0.01% 58 1637 0.01% 59 2052 0.01% 60 2448 0.01% 61 2453 0.01% 62 2585 0.01% 63 2770 0.01% 64 3053 0.01% 65 3422 0.01% 66 3445 0.01% 67 4099 0.02% 68 3865 0.02% 69 4129 0.02% 70 4762 0.02% 71 6756 0.03% 72 19407 0.08% 73 206625 0.87% 74 1942458 8.14% 75 11447343 47.98% 76 10180365 42.67% 23856922 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=20 prefix-density=0.28 prefix-fanout=2.5 sequence=ACCATCTTTCGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=21.26 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.9 sequence=CAACTTCCTTGACCTTCCGGCACTGGGCAGGCGTCAGCCCCCATACATGGTCTTACGACTTTGCGGAGACCTGTGTTTTTGGTAAACAGTCGCCCGGGCCTGGTCACTGCGACCCCCTTTGTGAGGAGGCACCCCTTCTCCCGAAGTTACGGGGCTATTTTGCCGAGTTCCTTAGAGAGAGTTGTCTCGCGCCCCTAGGTATTCTCTACCTACCCACCTGTGTCGGTTTCGGGTACAGGTACCCTTTTGT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=34 prefix-density=0.24 prefix-fanout=2.0 sequence=CCGAAAGATGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=25.15 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.9 sequence=TGCAGATCTTGGTGGTAGTAGCAAATATTCAAATGAGAACTTTGAAGGCCGAAGAGGGGAAAGGTTCCATGTGAACGGCACTTGCACATGGGTTAGTCGATCCTAAGAGACGGGGGAAGCCCGTCCGACAGCGCGTTCGCGCGCGAGCTTCGAAAGGGAATCGGGTTAAAATTCCTGAACCGGGACGTGGCGGCTGACGGCAACGTTAGGGAGTCCGGAGACGTCGGCGGGGGCCTCGGGAAGAGTTATCTTTTCTGTTTAACAGCCCGCCCACCCTGGAAACGACTTAGTCGGAGGTAGGGTCCAGCGGCTGGAAGAGCACCGCACGTCGCGTGGTGTCCGGTGCGCCCCCGGCGGCCCTTGAAAATCCGGAGGACCGAGTGCCTCCCACGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAACAGCCTCTGGTCGATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTCGGGAAAAGGATTGGCTCT SRR9321772 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 12:33:59 Started mapping on | Feb 12 12:34:00 Finished on | Feb 12 12:35:17 Mapping speed, Million of reads per hour | 1115.39 Number of input reads | 23856922 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 20291060 Uniquely mapped reads % | 85.05% Average mapped length | 150.40 Number of splices: Total | 8979480 Number of splices: Annotated (sjdb) | 8878322 Number of splices: GT/AG | 8817167 Number of splices: GC/AG | 137537 Number of splices: AT/AC | 6786 Number of splices: Non-canonical | 17990 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.02% Deletion average length | 2.21 Insertion rate per base | 0.01% Insertion average length | 2.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1112699 % of reads mapped to multiple loci | 4.66% Number of reads mapped to too many loci | 1596755 % of reads mapped to too many loci | 6.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.38% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2453448 2453448 2453448 N_multimapping 1112699 1112699 1112699 N_noFeature 901841 19986689 991918 N_ambiguous 327039 1854 111138 UnstrandedReadsAssigned:19062180 PositiveStrandReadsAssigned:302517 NegativeStrandReadsAssigned:19188004 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9321772 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9321772-trimmed-pair1.fastq SRR9321772-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,856,922 reads, 20,957,724 reads pseudoaligned [quant] estimated average fragment length: 203.656 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,019 rounds 52401 SRR9321772.ke.tsv 34699 SRR9321772.se.tsv 87100 total ==> SRR9321772.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1815.34 453 9.65084 Potri.005G024800.1.v4.1 1035 832.344 83 3.85657 Potri.004G059700.1.v4.1 961 758.348 51 2.60092 Potri.007G009000.2.v4.1 1416 1213.34 0 0 Potri.003G141000.2.v4.1 2943 2740.34 284 4.00811 Potri.016G087400.1.v4.1 270 87.105 1313.92 583.379 Potri.015G069301.1.v4.1 564 361.555 0 0 Potri.010G195200.1.v4.1 1773 1570.34 10 0.246281 Potri.012G127500.1.v4.1 977 774.348 3755 187.542 ==> SRR9321772.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 22 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 273 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 52 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 7 SRR9321772 completed mapping pipeline successfully