Starting /dee2/code/volunteer_pipeline.sh SRR9321773 current disk space = 3051501760512 free memory = 1580263756 SRR9321773 SRAfilesize 3510a5a6c45525461943b1d6a725ed81 SRR9321773.sra SRR9321773.sra file validated SRR9321773 is paired end SRR9321773 is conventional basespace SRR9321773 read1 length is 40-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9321773_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 40-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5955 32.0 32.0 32.0 32.0 32.0 2 31.6415 32.0 32.0 32.0 32.0 32.0 3 31.638 32.0 32.0 32.0 32.0 32.0 4 31.67375 32.0 32.0 32.0 32.0 32.0 5 31.705 32.0 32.0 32.0 32.0 32.0 6 34.9605 36.0 36.0 36.0 36.0 36.0 7 35.3695 36.0 36.0 36.0 36.0 36.0 8 35.412 36.0 36.0 36.0 36.0 36.0 9 35.426 36.0 36.0 36.0 36.0 36.0 10-11 35.371875 36.0 36.0 36.0 36.0 36.0 12-13 35.370000000000005 36.0 36.0 36.0 36.0 36.0 14-15 35.34525 36.0 36.0 36.0 36.0 36.0 16-17 35.287125 36.0 36.0 36.0 36.0 36.0 18-19 35.35725 36.0 36.0 36.0 36.0 36.0 20-21 35.311375 36.0 36.0 36.0 36.0 36.0 22-23 35.319125 36.0 36.0 36.0 36.0 36.0 24-25 35.34025 36.0 36.0 36.0 36.0 36.0 26-27 35.25125 36.0 36.0 36.0 36.0 36.0 28-29 35.19675 36.0 36.0 36.0 36.0 36.0 30-31 35.216875 36.0 36.0 36.0 36.0 36.0 32-33 35.224375 36.0 36.0 36.0 36.0 36.0 34-35 35.18175 36.0 36.0 36.0 36.0 36.0 36-37 35.184625 36.0 36.0 36.0 36.0 36.0 38-39 35.213375 36.0 36.0 36.0 36.0 36.0 40-41 35.13977038009503 36.0 36.0 36.0 36.0 36.0 42-43 35.12403100775194 36.0 36.0 36.0 36.0 36.0 44-45 35.19567391847962 36.0 36.0 36.0 36.0 36.0 46-47 35.14303575893973 36.0 36.0 36.0 36.0 36.0 48-49 35.02338084521131 36.0 36.0 36.0 36.0 36.0 50-51 35.189797449362345 36.0 36.0 36.0 36.0 36.0 52-53 35.12590647661915 36.0 36.0 36.0 36.0 36.0 54-55 35.08589647411853 36.0 36.0 36.0 36.0 36.0 56-57 34.91847961990497 36.0 36.0 36.0 36.0 36.0 58-59 34.942985746436605 36.0 36.0 36.0 34.0 36.0 60-61 35.0095023755939 36.0 36.0 36.0 36.0 36.0 62-63 34.90267700775581 36.0 36.0 36.0 34.0 36.0 64-65 34.86790092569427 36.0 36.0 36.0 36.0 36.0 66-67 34.89164164164164 36.0 36.0 36.0 36.0 36.0 68-69 34.880630630630634 36.0 36.0 36.0 36.0 36.0 70-71 34.70754258639115 36.0 36.0 36.0 32.0 36.0 72-73 34.719753313916485 36.0 36.0 36.0 32.0 36.0 74-75 34.65429033237672 36.0 36.0 36.0 32.0 36.0 76 34.287793952967526 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 2.0 24 2.0 25 8.0 26 9.0 27 18.0 28 30.0 29 50.0 30 64.0 31 82.0 32 106.0 33 185.0 34 475.0 35 2966.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.0 12.65 8.774999999999999 38.574999999999996 2 21.975 16.400000000000002 37.95 23.674999999999997 3 19.650000000000002 21.275 25.7 33.375 4 23.150000000000002 31.5 21.85 23.5 5 23.75 34.150000000000006 22.95 19.15 6 18.88129587446216 35.509997468995195 25.234117944824096 20.374588711718552 7 14.6 23.799999999999997 42.175000000000004 19.425 8 19.05 23.400000000000002 31.15 26.400000000000002 9 17.9 23.925 32.824999999999996 25.35 10-11 21.9625 31.612499999999997 23.8375 22.5875 12-13 20.474999999999998 25.7375 28.1875 25.6 14-15 20.625 25.825 28.15 25.4 16-17 21.175 28.15 26.087500000000002 24.587500000000002 18-19 22.162499999999998 27.6125 26.0125 24.212500000000002 20-21 21.0 27.487499999999997 26.900000000000002 24.6125 22-23 21.512500000000003 27.0875 27.55 23.849999999999998 24-25 20.549999999999997 28.0625 27.037499999999998 24.349999999999998 26-27 21.0375 26.9625 27.975 24.025 28-29 20.962500000000002 28.499999999999996 26.087500000000002 24.45 30-31 20.5875 28.175 26.737499999999997 24.5 32-33 21.2875 27.9125 26.8375 23.962500000000002 34-35 21.212500000000002 28.512500000000003 26.7125 23.5625 36-37 20.9125 27.9125 27.5875 23.5875 38-39 20.8 27.1 26.700000000000003 25.4 40-41 20.502562820352544 28.82860357544693 26.190773846730842 24.478059757469683 42-43 21.24281070267567 27.881970492623154 26.86921730432608 24.006001500375092 44-45 22.093023255813954 26.65666416604151 27.04426106526632 24.20605151287822 46-47 21.580395098774694 28.169542385596397 26.906726681670417 23.34333583395849 48-49 20.392598149537385 27.994498624656167 26.544136034008503 25.068767191797946 50-51 21.380345086271568 26.981745436359088 27.25681420355089 24.381095273818453 52-53 20.305076269067268 28.019504876219052 28.532133033258315 23.143285821455365 54-55 20.94273568392098 27.60690172543136 27.094273568392097 24.356089022255563 56-57 21.13028257064266 26.78169542385596 27.28182045511378 24.8062015503876 58-59 21.75543885971493 27.656914228557138 27.04426106526632 23.543385846461614 60-61 21.017754438609654 27.38184546136534 26.38159539884971 25.218804701175294 62-63 21.215911933950462 26.582436827620715 27.670753064798596 24.530898173630224 64-65 21.503627720790593 27.633224918689013 26.55741806354766 24.305729296972732 66-67 20.47047047047047 28.203203203203202 27.865365365365363 23.46096096096096 68-69 20.97097097097097 27.87787787787788 27.039539539539543 24.11161161161161 70-71 21.09873607808785 27.593542735577525 26.454761606807658 24.852959579526967 72-73 20.764203117144294 27.33785822021116 27.136752136752136 24.76118652589241 74-75 21.689953426480375 23.92548236859614 29.32801064537591 25.056553559547574 76 21.015304217991787 0.0 40.57484135871594 38.40985442329227 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 3.0 23 5.0 24 8.0 25 7.5 26 6.0 27 10.0 28 17.5 29 25.5 30 28.5 31 35.0 32 44.0 33 45.0 34 65.5 35 93.0 36 112.0 37 132.0 38 143.5 39 170.5 40 205.5 41 242.5 42 266.0 43 287.5 44 308.5 45 299.5 46 292.0 47 309.5 48 316.5 49 283.5 50 247.0 51 223.5 52 194.0 53 150.5 54 119.5 55 109.0 56 112.0 57 94.0 58 70.0 59 56.5 60 42.0 61 33.0 62 25.0 63 20.5 64 11.0 65 5.0 66 4.0 67 3.5 68 3.5 69 2.0 70 0.5 71 1.0 72 2.0 73 2.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.225 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 40 1.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 2.0 62 0.0 63 0.0 64 0.0 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 1.0 71 8.0 72 18.0 73 76.0 74 271.0 75 943.0 76 2679.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.60193187595323 96.975 2 1.1438739196746313 2.25 3 0.22877478393492628 0.675 4 0.02541942043721403 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9321773 read2 length is 59-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9321773_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 59-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3455 32.0 32.0 32.0 32.0 32.0 2 31.21275 32.0 32.0 32.0 32.0 32.0 3 31.24625 32.0 32.0 32.0 32.0 32.0 4 31.19875 32.0 32.0 32.0 32.0 32.0 5 31.142 32.0 32.0 32.0 32.0 32.0 6 34.68575 36.0 36.0 36.0 32.0 36.0 7 34.72225 36.0 36.0 36.0 32.0 36.0 8 34.749 36.0 36.0 36.0 32.0 36.0 9 34.723 36.0 36.0 36.0 32.0 36.0 10-11 34.7705 36.0 36.0 36.0 32.0 36.0 12-13 34.7475 36.0 36.0 36.0 34.0 36.0 14-15 34.615375 36.0 36.0 36.0 32.0 36.0 16-17 34.669124999999994 36.0 36.0 36.0 32.0 36.0 18-19 34.681875 36.0 36.0 36.0 32.0 36.0 20-21 34.63725 36.0 36.0 36.0 32.0 36.0 22-23 34.558 36.0 36.0 36.0 32.0 36.0 24-25 34.565625 36.0 36.0 36.0 32.0 36.0 26-27 34.51975 36.0 36.0 36.0 32.0 36.0 28-29 34.456 36.0 36.0 36.0 32.0 36.0 30-31 34.469750000000005 36.0 36.0 36.0 32.0 36.0 32-33 34.491375 36.0 36.0 36.0 32.0 36.0 34-35 34.52475 36.0 36.0 36.0 32.0 36.0 36-37 34.475625 36.0 36.0 36.0 32.0 36.0 38-39 34.368375 36.0 36.0 36.0 32.0 36.0 40-41 34.3435 36.0 36.0 36.0 32.0 36.0 42-43 34.309 36.0 36.0 36.0 32.0 36.0 44-45 34.223625 36.0 36.0 36.0 32.0 36.0 46-47 34.086875000000006 36.0 36.0 36.0 32.0 36.0 48-49 34.274125 36.0 36.0 36.0 32.0 36.0 50-51 34.149125 36.0 36.0 36.0 32.0 36.0 52-53 34.069375 36.0 36.0 36.0 32.0 36.0 54-55 34.00875 36.0 36.0 36.0 32.0 36.0 56-57 34.049625000000006 36.0 36.0 36.0 32.0 36.0 58-59 33.909 36.0 36.0 36.0 32.0 36.0 60-61 34.05551891349526 36.0 36.0 36.0 32.0 36.0 62-63 33.897647647647645 36.0 36.0 36.0 32.0 36.0 64-65 33.774315001030075 36.0 36.0 36.0 29.5 36.0 66-67 33.77222639619334 36.0 36.0 36.0 27.0 36.0 68-69 33.69659403956925 36.0 36.0 36.0 27.0 36.0 70-71 33.835419827343806 36.0 36.0 36.0 27.0 36.0 72-73 33.703049083065466 36.0 36.0 36.0 27.0 36.0 74-75 33.76374398528621 36.0 36.0 36.0 27.0 36.0 76 32.792387543252595 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 14.0 16 15.0 17 7.0 18 5.0 19 6.0 20 7.0 21 7.0 22 13.0 23 9.0 24 15.0 25 33.0 26 36.0 27 41.0 28 53.0 29 60.0 30 91.0 31 125.0 32 154.0 33 248.0 34 616.0 35 2442.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.37421777221527 20.550688360450565 11.188986232790988 28.88610763454318 2 29.299999999999997 26.3 29.475 14.924999999999999 3 22.175 27.875 27.175 22.775000000000002 4 25.624999999999996 34.75 20.549999999999997 19.075 5 27.075 36.7 19.925 16.3 6 21.05 36.75 22.2 20.0 7 21.425 19.475 37.85 21.25 8 24.075 24.075 26.0 25.85 9 23.200000000000003 24.375 28.475 23.95 10-11 25.374999999999996 30.95 21.987499999999997 21.6875 12-13 25.2 24.5 27.3625 22.9375 14-15 23.140392549068633 26.790848856107015 28.491061382672832 21.57769721215152 16-17 24.2375 26.3625 27.175 22.225 18-19 25.0125 27.250000000000004 26.2625 21.475 20-21 23.799999999999997 28.0875 26.6125 21.5 22-23 24.275 26.950000000000003 26.937499999999996 21.837500000000002 24-25 24.075 26.6 27.6375 21.6875 26-27 24.212500000000002 27.4125 27.287499999999998 21.087500000000002 28-29 24.9125 27.125 26.637499999999996 21.325 30-31 24.2875 27.6625 27.0 21.05 32-33 24.1125 27.437499999999996 26.924999999999997 21.525 34-35 23.875 28.525 25.9875 21.6125 36-37 23.45 27.6 27.125 21.825 38-39 23.5625 28.349999999999998 27.037499999999998 21.05 40-41 24.290536317039628 27.278409801225152 26.503312914114264 21.927740967620952 42-43 24.0625 27.487499999999997 27.450000000000003 21.0 44-45 24.349999999999998 27.537499999999998 26.437500000000004 21.675 46-47 25.0125 27.3125 26.687499999999996 20.9875 48-49 23.3125 27.8875 27.3 21.5 50-51 24.275 28.199999999999996 26.6125 20.9125 52-53 23.88097024256064 27.28182045511378 26.36909227306827 22.468117029257314 54-55 24.781195298824706 27.38184546136534 26.994248562140534 20.84271067766942 56-57 24.36859214803701 26.70667666916729 26.894223555888974 22.030507626906726 58-59 25.806451612903224 26.944236059014752 25.76894223555889 21.48037009252313 60-61 24.180635476607456 27.60820615461596 26.745058794095574 21.46609957468101 62-63 23.71056584877316 27.391086629944915 27.215823735603408 21.682523785678516 64-65 24.546023794614904 27.438948027551657 26.399499060738883 21.615529117094553 66-67 24.82456140350877 26.92982456140351 26.56641604010025 21.67919799498747 68-69 24.09170633926334 27.048358807316465 26.98571786519669 21.874216988223502 70-71 23.971915747241727 28.32246740220662 26.855566700100304 20.850050150451356 72-73 24.53353504790721 27.55925365607665 25.99596570852244 21.911245587493696 74-75 24.322874765352644 24.041297935103245 28.291767229820326 23.34406006972379 76 27.307692307692307 0.0 39.42307692307692 33.26923076923077 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 1.0 13 0.5 14 0.5 15 0.5 16 0.5 17 1.0 18 1.0 19 1.0 20 1.0 21 0.5 22 1.0 23 1.0 24 2.0 25 5.5 26 5.0 27 6.5 28 10.5 29 14.0 30 15.0 31 26.0 32 41.5 33 43.5 34 50.0 35 68.5 36 86.5 37 105.5 38 143.0 39 189.5 40 224.0 41 256.5 42 282.5 43 297.5 44 318.5 45 335.0 46 341.5 47 325.5 48 297.0 49 269.0 50 246.5 51 226.5 52 182.5 53 143.0 54 129.5 55 109.5 56 84.5 57 76.0 58 71.0 59 55.5 60 38.0 61 30.5 62 26.5 63 19.5 64 11.5 65 8.5 66 5.5 67 2.0 68 2.5 69 4.0 70 4.0 71 3.0 72 2.0 73 2.5 74 2.5 75 1.5 76 1.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 1.0 97 0.5 98 0.0 99 8.5 100 17.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0125 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0125 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.025 54-55 0.025 56-57 0.025 58-59 0.025 60-61 0.03751406777541578 62-63 0.050050050050050046 64-65 0.0625782227784731 66-67 0.07513148009015778 68-69 0.050087653393438514 70-71 0.1002004008016032 72-73 0.05040322580645161 74-75 0.04020908725371934 76 0.03844675124951942 >>END_MODULE >>Sequence Length Distribution warn #Length Count 59 1.0 60 1.0 61 2.0 62 0.0 63 0.0 64 2.0 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 2.0 71 8.0 72 30.0 73 83.0 74 279.0 75 990.0 76 2601.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.72870582252733 97.075 2 1.1950165268243071 2.35 3 0.05085176709890668 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02542588354945334 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 17 0.42500000000000004 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1399272 spots for SRR9321773.sra Written 1399272 spots for SRR9321773.sra Read 1399272 spots for SRR9321773.sra Written 1399272 spots for SRR9321773.sra Read 1399272 spots for SRR9321773.sra Written 1399272 spots for SRR9321773.sra Read 1399272 spots for SRR9321773.sra Written 1399272 spots for SRR9321773.sra Read 1399272 spots for SRR9321773.sra Written 1399272 spots for SRR9321773.sra Read 1399272 spots for SRR9321773.sra Written 1399272 spots for SRR9321773.sra Read 1399272 spots for SRR9321773.sra Written 1399272 spots for SRR9321773.sra Read 1399272 spots for SRR9321773.sra Written 1399272 spots for SRR9321773.sra Read 1399272 spots for SRR9321773.sra Written 1399272 spots for SRR9321773.sra Read 1399272 spots for SRR9321773.sra Written 1399272 spots for SRR9321773.sra Read 1399272 spots for SRR9321773.sra Written 1399272 spots for SRR9321773.sra Read 1399272 spots for SRR9321773.sra Written 1399272 spots for SRR9321773.sra Read 1399272 spots for SRR9321773.sra Written 1399272 spots for SRR9321773.sra Read 1399272 spots for SRR9321773.sra Written 1399272 spots for SRR9321773.sra Read 1399272 spots for SRR9321773.sra Written 1399272 spots for SRR9321773.sra Read 1399272 spots for SRR9321773.sra Written 1399272 spots for SRR9321773.sra Read 1399272 spots for SRR9321773.sra Written 1399272 spots for SRR9321773.sra Read 1399272 spots for SRR9321773.sra Written 1399272 spots for SRR9321773.sra Read 1399282 spots for SRR9321773.sra Written 1399282 spots for SRR9321773.sra Read 1399272 spots for SRR9321773.sra Written 1399272 spots for SRR9321773.sra SRR ids: ['SRR9321773.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xsih0m42 SRR9321773.sra spots: 27985450 blocks: [[1, 1399272], [1399273, 2798544], [2798545, 4197816], [4197817, 5597088], [5597089, 6996360], [6996361, 8395632], [8395633, 9794904], [9794905, 11194176], [11194177, 12593448], [12593449, 13992720], [13992721, 15391992], [15391993, 16791264], [16791265, 18190536], [18190537, 19589808], [19589809, 20989080], [20989081, 22388352], [22388353, 23787624], [23787625, 25186896], [25186897, 26586168], [26586169, 27985450]] SRR9321773 file size 5307687 SRR9321773 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9321773 SRR9321773_1.fastq SRR9321773_2.fastq Input file: SRR9321773_1.fastq Paired file: SRR9321773_2.fastq trimmed: SRR9321773-trimmed-pair1.fastq, SRR9321773-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 14:05:51 2025 >> started Wed Feb 12 14:06:14 2025 >> done (22.925s) 27985450 read pairs processed; of these: 4207 ( 0.02%) short read pairs filtered out after trimming by size control 9729 ( 0.03%) empty read pairs filtered out after trimming by size control 27971514 (99.95%) read pairs available; of these: 14846 ( 0.05%) trimmed read pairs available after processing 27956668 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 4 0.00% 21 9 0.00% 22 11 0.00% 23 13 0.00% 24 19 0.00% 25 15 0.00% 26 35 0.00% 27 37 0.00% 28 29 0.00% 29 45 0.00% 30 48 0.00% 31 54 0.00% 32 43 0.00% 33 52 0.00% 34 52 0.00% 35 202 0.00% 36 225 0.00% 37 226 0.00% 38 261 0.00% 39 264 0.00% 40 275 0.00% 41 271 0.00% 42 306 0.00% 43 305 0.00% 44 401 0.00% 45 371 0.00% 46 305 0.00% 47 387 0.00% 48 414 0.00% 49 467 0.00% 50 482 0.00% 51 578 0.00% 52 630 0.00% 53 669 0.00% 54 585 0.00% 55 952 0.00% 56 1028 0.00% 57 1117 0.00% 58 1262 0.00% 59 1657 0.01% 60 2102 0.01% 61 1932 0.01% 62 2112 0.01% 63 2137 0.01% 64 2308 0.01% 65 2662 0.01% 66 2629 0.01% 67 3180 0.01% 68 2856 0.01% 69 3140 0.01% 70 3965 0.01% 71 5665 0.02% 72 21013 0.08% 73 246933 0.88% 74 2332933 8.34% 75 13578757 48.54% 76 11743083 41.98% 27971514 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=1.66 fanout-score-rank=34 prefix-density=0.46 prefix-fanout=1.0 sequence=TAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=20.88 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=4.0 sequence=CCATCTTTCGGCTAACCTAGCCTCCTCCGTCCCTCGGGACCAACAAGGGGTAGTACAGGAATATTCGCCTGTTGTCCATCGACTACGCCTTTCGGCCTGATCTTAGGCCCTGACTCACCCTCCGTGGACGAACCTTGCGGAGGAACCCTTAGGTTTTCGGGGCATTGGATTCTCACCAATGTTTGCGTTACTCAAGCCGACATTCTCGCTTCCGCTTCGTCCACCCCCGCTCGCGCGGGTGCTTCCCTCTAAGCGGAACGCTCCCCTACCGATGCATTTTTACATCCCACAGCTTCGGCAGATCGCTTAGCCCCGTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTATTACGCACTCTTTCAAGGGTGGCTGCTTCTAGGCAAACCTCCTGGCTGTCTCTGCACCCCTACCTCCTTTATCACTGAGCGGTCATTTAGGGGCCTTAGCTGGTGATCCGGGCTGTTTCCCTCTCGACGATGAAGCTTATCCCCCACCGTCTCACTGGC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=12.16 fanout-score-rank=4 prefix-density=0.34 prefix-fanout=5.4 sequence=CAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=34.55 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=1.5 sequence=GAAATTCTTTTGCGTGATAAAAAAAGAGAGAGTGTGCAAAATGATGTCAAGCAAGATTTCTCTTGCTTTCTTTACTCTTATAACCTTATCCCTAATCCTTCCCTCTCGTGCCCAAGACAACCCACAAGATTACCTTGATGCTCATAATGCAGCTCGTGCAGCTGTAGGTGTTGGTCCACTAACCTGGGACACCACAGTGCAAGCCTATGCACAAAATTATGCTAACCAACGTGCCGGCGATTGCAACCTTGTCCATTCAGGTGGACCTTATGGGGAGAACATTGCATGGAGCAGCGCGGACCTTTCAGGTACAGATGCTGTAAAACTGTGGGTTGATGAGAAGGCTTACTACGACTACAACTCCAACTCATGTGCCGCTGGCCAGCAGTGTGGGCACTATACTCAGGTGGTTTGGCGTAACTCTGCTCGCCTAGGATGTGCTAAAGTGAAGTGTAGCACCGGAGGAACCTTCATTGGGTGCAACTATGATCCACCCGGCAACTATGTTGGG SRR9321773 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 14:06:42 Started mapping on | Feb 12 14:06:42 Finished on | Feb 12 14:07:59 Mapping speed, Million of reads per hour | 1307.76 Number of input reads | 27971514 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 24122186 Uniquely mapped reads % | 86.24% Average mapped length | 150.43 Number of splices: Total | 10765725 Number of splices: Annotated (sjdb) | 10644162 Number of splices: GT/AG | 10574337 Number of splices: GC/AG | 162429 Number of splices: AT/AC | 7799 Number of splices: Non-canonical | 21160 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.02% Deletion average length | 2.16 Insertion rate per base | 0.01% Insertion average length | 1.94 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1211091 % of reads mapped to multiple loci | 4.33% Number of reads mapped to too many loci | 1228463 % of reads mapped to too many loci | 4.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.89% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2638585 2638585 2638585 N_multimapping 1211091 1211091 1211091 N_noFeature 670268 23827047 764864 N_ambiguous 338469 1268 136903 UnstrandedReadsAssigned:23113449 PositiveStrandReadsAssigned:293871 NegativeStrandReadsAssigned:23220419 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9321773 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9321773-trimmed-pair1.fastq SRR9321773-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,971,514 reads, 24,866,473 reads pseudoaligned [quant] estimated average fragment length: 196.618 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,214 rounds 52401 SRR9321773.ke.tsv 34699 SRR9321773.se.tsv 87100 total ==> SRR9321773.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1822.38 482 8.81486 Potri.005G024800.1.v4.1 1035 839.382 134 5.32051 Potri.004G059700.1.v4.1 961 765.382 52 2.26429 Potri.007G009000.2.v4.1 1416 1220.38 0 0 Potri.003G141000.2.v4.1 2943 2747.38 363.188 4.40575 Potri.016G087400.1.v4.1 270 90.1974 1817.04 671.395 Potri.015G069301.1.v4.1 564 368.557 0 0 Potri.010G195200.1.v4.1 1773 1577.38 7 0.1479 Potri.012G127500.1.v4.1 977 781.382 7196 306.927 ==> SRR9321773.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 32 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 327 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 65 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 13 SRR9321773 completed mapping pipeline successfully