Starting /dee2/code/volunteer_pipeline.sh SRR9321774 current disk space = 3051503607808 free memory = 1579377212 SRR9321774 SRAfilesize 928438eb6148a7a1c71aa22b7fb7a042 SRR9321774.sra SRR9321774.sra file validated SRR9321774 is paired end SRR9321774 is conventional basespace SRR9321774 read1 length is 62-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9321774_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 62-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.64425 32.0 32.0 32.0 32.0 32.0 2 31.577 32.0 32.0 32.0 32.0 32.0 3 31.65575 32.0 32.0 32.0 32.0 32.0 4 31.62775 32.0 32.0 32.0 32.0 32.0 5 31.6755 32.0 32.0 32.0 32.0 32.0 6 35.02025 36.0 36.0 36.0 36.0 36.0 7 35.38325 36.0 36.0 36.0 36.0 36.0 8 35.32 36.0 36.0 36.0 36.0 36.0 9 35.3735 36.0 36.0 36.0 36.0 36.0 10-11 35.34025 36.0 36.0 36.0 36.0 36.0 12-13 35.347625 36.0 36.0 36.0 36.0 36.0 14-15 35.273125 36.0 36.0 36.0 36.0 36.0 16-17 35.29925 36.0 36.0 36.0 36.0 36.0 18-19 35.308125000000004 36.0 36.0 36.0 36.0 36.0 20-21 35.24425 36.0 36.0 36.0 36.0 36.0 22-23 35.26325 36.0 36.0 36.0 36.0 36.0 24-25 35.314750000000004 36.0 36.0 36.0 36.0 36.0 26-27 35.1905 36.0 36.0 36.0 36.0 36.0 28-29 35.233374999999995 36.0 36.0 36.0 36.0 36.0 30-31 35.209 36.0 36.0 36.0 36.0 36.0 32-33 35.144625 36.0 36.0 36.0 36.0 36.0 34-35 35.212999999999994 36.0 36.0 36.0 36.0 36.0 36-37 35.117000000000004 36.0 36.0 36.0 36.0 36.0 38-39 35.109125 36.0 36.0 36.0 36.0 36.0 40-41 35.081999999999994 36.0 36.0 36.0 36.0 36.0 42-43 35.112 36.0 36.0 36.0 36.0 36.0 44-45 35.08525 36.0 36.0 36.0 36.0 36.0 46-47 35.0465 36.0 36.0 36.0 36.0 36.0 48-49 35.07125 36.0 36.0 36.0 36.0 36.0 50-51 35.158500000000004 36.0 36.0 36.0 36.0 36.0 52-53 35.052625 36.0 36.0 36.0 36.0 36.0 54-55 35.035125 36.0 36.0 36.0 36.0 36.0 56-57 34.945 36.0 36.0 36.0 36.0 36.0 58-59 34.931 36.0 36.0 36.0 34.0 36.0 60-61 34.955125 36.0 36.0 36.0 36.0 36.0 62-63 34.88760343210802 36.0 36.0 36.0 34.0 36.0 64-65 34.899599899974994 36.0 36.0 36.0 36.0 36.0 66-67 34.902350587646914 36.0 36.0 36.0 36.0 36.0 68-69 34.90521176442185 36.0 36.0 36.0 36.0 36.0 70-71 34.81994494494495 36.0 36.0 36.0 34.0 36.0 72-73 34.70308643794944 36.0 36.0 36.0 32.0 36.0 74-75 34.60014032912322 36.0 36.0 36.0 32.0 36.0 76 34.5469888761028 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 3.0 25 14.0 26 13.0 27 24.0 28 37.0 29 42.0 30 56.0 31 81.0 32 113.0 33 184.0 34 447.0 35 2984.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.2 11.425 10.825 44.55 2 21.0 16.1 39.675 23.225 3 18.825 19.225 26.05 35.9 4 24.075 28.749999999999996 21.4 25.775 5 23.200000000000003 33.575 23.875 19.35 6 19.50910931174089 34.691295546558706 26.01214574898785 19.78744939271255 7 15.024999999999999 22.400000000000002 43.25 19.325 8 18.925 21.75 30.675 28.65 9 18.025 22.525000000000002 33.7 25.75 10-11 21.7875 30.75 23.5875 23.875 12-13 22.025 23.7875 27.875 26.3125 14-15 21.2625 26.525 28.050000000000004 24.1625 16-17 21.637500000000003 27.1375 26.6125 24.6125 18-19 20.474999999999998 27.1375 26.787499999999998 25.6 20-21 20.9 27.025 27.800000000000004 24.275 22-23 21.725 26.474999999999998 26.424999999999997 25.374999999999996 24-25 21.0125 27.0875 26.775 25.124999999999996 26-27 22.1 26.437500000000004 25.9875 25.474999999999998 28-29 21.875 27.400000000000002 25.887500000000003 24.837500000000002 30-31 20.9375 26.724999999999998 25.7625 26.575 32-33 21.0625 27.1375 27.537499999999998 24.2625 34-35 21.3125 26.487500000000004 27.275 24.925 36-37 20.6125 27.8375 26.924999999999997 24.625 38-39 21.3125 27.750000000000004 25.5 25.4375 40-41 21.3125 27.712500000000002 25.474999999999998 25.5 42-43 21.3 26.8 26.75 25.15 44-45 21.275 27.150000000000002 26.650000000000002 24.925 46-47 20.9375 27.1 27.237499999999997 24.725 48-49 21.175 26.2125 26.787499999999998 25.825 50-51 20.9375 28.000000000000004 26.1125 24.95 52-53 20.45 27.037499999999998 27.6125 24.9 54-55 20.925 28.0625 26.375 24.637500000000003 56-57 20.2625 26.737499999999997 27.425 25.575 58-59 20.3875 26.674999999999997 27.125 25.8125 60-61 21.15 26.3125 27.1125 25.424999999999997 62-63 20.827603450431305 26.803350418802353 27.790973871733964 24.57807225903238 64-65 20.767691922980745 26.93173293323331 26.91922980745186 25.381345336334082 66-67 20.230057514378593 27.431857964491122 27.131782945736433 25.206301575393848 68-69 21.03288733274978 27.01012879829936 26.79754908090534 25.159434788045516 70-71 21.283783783783782 27.33983983983984 26.626626626626624 24.74974974974975 72-73 21.006399799221988 26.45250345087213 26.992094365666958 25.54900238423893 74-75 21.53682531241691 23.889922892847647 27.77186918372773 26.801382611007714 76 21.940928270042196 0.0 40.62140391254315 37.437667817414656 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 1.5 22 2.0 23 5.0 24 6.5 25 4.0 26 3.5 27 7.5 28 11.5 29 15.0 30 25.5 31 32.5 32 37.0 33 47.0 34 66.5 35 91.0 36 108.0 37 119.0 38 127.5 39 155.0 40 195.5 41 208.5 42 210.5 43 252.0 44 281.0 45 291.5 46 300.0 47 289.0 48 287.5 49 279.0 50 259.5 51 227.0 52 196.0 53 179.5 54 167.0 55 142.0 56 118.5 57 107.5 58 97.5 59 87.5 60 73.5 61 49.5 62 32.0 63 27.0 64 17.0 65 11.0 66 7.5 67 4.5 68 3.5 69 2.5 70 1.0 71 0.5 72 2.0 73 4.0 74 2.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.2 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 62 1.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 2.0 70 0.0 71 5.0 72 13.0 73 79.0 74 276.0 75 1016.0 76 2607.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.475 #Duplication Level Percentage of deduplicated Percentage of total 1 96.9363707776905 92.55 2 1.9900497512437811 3.8 3 0.7069913589945012 2.025 4 0.2356637863315004 0.8999999999999999 5 0.05236973029588898 0.25 6 0.05236973029588898 0.3 7 0.02618486514794449 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGC 7 0.17500000000000002 No Hit CGATAGAACTCGCACCGAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGCTACTAGACGGTTCGATT 6 0.15 No Hit CCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCA 6 0.15 No Hit GTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGC 5 0.125 No Hit CAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9321774 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9321774_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.25075 32.0 32.0 32.0 32.0 32.0 2 31.15025 32.0 32.0 32.0 32.0 32.0 3 31.18675 32.0 32.0 32.0 32.0 32.0 4 31.1635 32.0 32.0 32.0 32.0 32.0 5 31.16525 32.0 32.0 32.0 32.0 32.0 6 34.642 36.0 36.0 36.0 32.0 36.0 7 34.78475 36.0 36.0 36.0 32.0 36.0 8 34.72325 36.0 36.0 36.0 32.0 36.0 9 34.6265 36.0 36.0 36.0 32.0 36.0 10-11 34.65525 36.0 36.0 36.0 32.0 36.0 12-13 34.665625 36.0 36.0 36.0 32.0 36.0 14-15 34.71675 36.0 36.0 36.0 32.0 36.0 16-17 34.59825 36.0 36.0 36.0 32.0 36.0 18-19 34.581374999999994 36.0 36.0 36.0 34.0 36.0 20-21 34.557625 36.0 36.0 36.0 32.0 36.0 22-23 34.634875 36.0 36.0 36.0 32.0 36.0 24-25 34.51375 36.0 36.0 36.0 32.0 36.0 26-27 34.508250000000004 36.0 36.0 36.0 32.0 36.0 28-29 34.535250000000005 36.0 36.0 36.0 32.0 36.0 30-31 34.451375 36.0 36.0 36.0 32.0 36.0 32-33 34.413124999999994 36.0 36.0 36.0 32.0 36.0 34-35 34.405 36.0 36.0 36.0 32.0 36.0 36-37 34.444722361180595 36.0 36.0 36.0 32.0 36.0 38-39 34.30702851425713 36.0 36.0 36.0 32.0 36.0 40-41 34.37306153076538 36.0 36.0 36.0 32.0 36.0 42-43 34.34834307947068 36.0 36.0 36.0 32.0 36.0 44-45 34.14911183387541 36.0 36.0 36.0 32.0 36.0 46-47 34.08593945459094 36.0 36.0 36.0 32.0 36.0 48-49 34.22929697272954 36.0 36.0 36.0 32.0 36.0 50-51 34.13322491868902 36.0 36.0 36.0 32.0 36.0 52-53 34.127470602952215 36.0 36.0 36.0 32.0 36.0 54-55 34.000375281461096 36.0 36.0 36.0 32.0 36.0 56-57 34.029397047785835 36.0 36.0 36.0 32.0 36.0 58-59 34.02727727727728 36.0 36.0 36.0 32.0 36.0 60-61 33.95845845845845 36.0 36.0 36.0 32.0 36.0 62-63 33.96045338204287 36.0 36.0 36.0 32.0 36.0 64-65 33.806132665832294 36.0 36.0 36.0 29.5 36.0 66-67 33.83617021276596 36.0 36.0 36.0 29.5 36.0 68-69 33.78683776603579 36.0 36.0 36.0 27.0 36.0 70-71 33.771042084168336 36.0 36.0 36.0 27.0 36.0 72-73 33.61012441474202 36.0 36.0 36.0 27.0 36.0 74-75 33.6378554569036 36.0 36.0 36.0 27.0 36.0 76 32.85326291965296 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 6.0 16 5.0 17 1.0 18 7.0 19 7.0 20 10.0 21 5.0 22 15.0 23 12.0 24 18.0 25 34.0 26 44.0 27 41.0 28 60.0 29 84.0 30 88.0 31 126.0 32 156.0 33 267.0 34 642.0 35 2368.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.5266449837378 19.41456092069052 13.560170127595697 31.49862396797598 2 28.339169584792394 24.412206103051524 33.31665832916458 13.931965982991496 3 22.411205602801402 26.563281640820406 28.339169584792394 22.686343171585793 4 24.537268634317158 33.96698349174587 21.53576788394197 19.959979989995 5 26.788394197098548 35.74287143571786 20.410205102551277 17.058529264632316 6 21.96098049024512 35.81790895447724 22.461230615307652 19.759879939969984 7 22.061030515257627 18.159079539769884 38.094047023511756 21.68584292146073 8 22.336168084042022 24.112056028014006 26.76338169084542 26.788394197098548 9 24.06805103827871 23.617713284963724 28.7215411558669 23.592694520890667 10-11 25.68176132099074 30.63547660745559 21.66624968726545 22.016512384288216 12-13 26.585762542224444 24.48392343300388 25.810083823345426 23.12023020142625 14-15 24.66216216216216 27.865365365365363 25.788288288288285 21.684184184184186 16-17 26.035280870761916 26.623295383460526 26.41060928312273 20.930814462654823 18-19 25.071937945702487 26.6733391717753 26.260477918178402 21.9942449643438 20-21 24.82171900412861 26.72338296009008 27.036156637057424 21.418741398723885 22-23 25.45045045045045 27.177177177177175 25.375375375375377 21.996996996996998 24-25 26.13209907430573 26.332249186890166 26.28221165874406 21.253440080060045 26-27 24.4994994994995 28.403403403403406 25.88838838838839 21.20870870870871 28-29 25.910171399974978 26.648317277617917 25.00938321030902 22.432128112098084 30-31 24.86236236236236 27.5025025025025 25.625625625625624 22.00950950950951 32-33 25.262762762762765 27.239739739739736 26.326326326326328 21.17117117117117 34-35 25.531648736552416 27.270452839629723 25.83187390542907 21.36602451838879 36-37 25.381536152114087 26.419814861145856 26.1195896922692 22.079059294470856 38-39 25.247091204804207 27.036156637057424 25.197047416489426 22.519704741648944 40-41 26.113613613613612 26.226226226226224 26.113613613613612 21.546546546546548 42-43 25.11261261261261 26.226226226226224 26.664164164164166 21.996996996996998 44-45 25.075075075075077 27.32732732732733 26.076076076076077 21.52152152152152 46-47 25.262762762762765 27.7027027027027 25.538038038038035 21.496496496496498 48-49 25.55055055055055 26.33883883883884 26.401401401401404 21.70920920920921 50-51 25.412912912912912 27.177177177177175 26.626626626626624 20.783283283283282 52-53 26.354648980102613 26.304592666750093 26.49230384182205 20.84845451132524 54-55 25.728945063196097 26.83018395695157 26.21699411838318 21.22387686146915 56-57 23.94894894894895 27.990490490490487 25.95095095095095 22.10960960960961 58-59 25.18147684605757 26.883604505632043 26.020025031289112 21.914893617021278 60-61 25.41927409261577 26.99624530663329 25.93241551939925 21.65206508135169 62-63 25.52259356615346 27.21241707347603 25.910627112279382 21.354362248091125 64-65 26.872026045579766 27.160030052592038 25.39444027047333 20.57350363135487 66-67 25.43200601051841 26.69671925870273 26.62158777861257 21.249686952166293 68-69 25.82947289345186 25.75435082008263 26.856141229497933 21.56003505696757 70-71 26.190476190476193 27.017543859649123 26.190476190476193 20.601503759398497 72-73 25.078488007032522 27.037548662564358 25.681275901042323 22.202687429360793 74-75 25.280298985584626 23.518419647624135 27.77629471436199 23.424986652429258 76 28.79245283018868 0.0 38.79245283018868 32.41509433962264 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 3.5 21 5.0 22 4.0 23 3.0 24 2.0 25 1.5 26 4.0 27 7.5 28 9.5 29 10.5 30 15.0 31 19.0 32 26.5 33 34.5 34 38.5 35 65.5 36 95.5 37 102.5 38 119.5 39 170.0 40 198.0 41 218.0 42 251.0 43 277.0 44 317.0 45 328.5 46 319.0 47 312.5 48 295.0 49 270.5 50 244.5 51 219.5 52 193.5 53 156.0 54 129.5 55 127.0 56 115.5 57 91.5 58 76.0 59 70.5 60 63.0 61 50.5 62 39.5 63 30.5 64 23.5 65 18.5 66 10.0 67 6.5 68 10.0 69 11.5 70 6.5 71 2.5 72 5.0 73 6.0 74 3.0 75 1.5 76 2.0 77 1.5 78 0.5 79 0.0 80 0.5 81 1.0 82 1.0 83 1.0 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 1.0 95 1.0 96 0.0 97 0.5 98 0.5 99 12.0 100 24.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.05 3 0.05 4 0.05 5 0.05 6 0.05 7 0.05 8 0.05 9 0.075 10-11 0.075 12-13 0.08750000000000001 14-15 0.1 16-17 0.08750000000000001 18-19 0.08750000000000001 20-21 0.08750000000000001 22-23 0.1 24-25 0.075 26-27 0.1 28-29 0.08750000000000001 30-31 0.1 32-33 0.1 34-35 0.075 36-37 0.02501250625312656 38-39 0.03751875937968985 40-41 0.05002501250625312 42-43 0.0375234521575985 44-45 0.02501876407305479 46-47 0.02501876407305479 48-49 0.02501876407305479 50-51 0.02501876407305479 52-53 0.03752814610958219 54-55 0.03752814610958219 56-57 0.02501876407305479 58-59 0.025025025025025023 60-61 0.025025025025025023 62-63 0.02502815667626079 64-65 0.05006257822277847 66-67 0.05006257822277847 68-69 0.025034422330704718 70-71 0.0501002004008016 72-73 0.050207104305259195 74-75 0.0400266844563042 76 0.03772161448509996 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 2.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 1.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 1.0 58 0.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 2.0 70 0.0 71 1.0 72 15.0 73 83.0 74 291.0 75 951.0 76 2651.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.375 #Duplication Level Percentage of deduplicated Percentage of total 1 96.85452162516383 92.375 2 2.5688073394495414 4.9 3 0.28833551769331583 0.8250000000000001 4 0.1310615989515072 0.5 5 0.07863695937090433 0.375 6 0.02621231979030144 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05242463958060288 0.8750000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 24 0.6 No Hit GTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTCG 11 0.27499999999999997 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAA 6 0.15 No Hit CAACGGGCGAGTAAACCCGTAAGGCGCAAGGAAGCTGACTGGCGGGATCC 5 0.125 No Hit CTTGGATTTATGAAAGACGAACAACTGCGAAAGCATTTGCCAAGGATGTT 5 0.125 No Hit CTCGTCCCTTCTACCGGCGATGCGCTCCTGGCCTTAACTGGCCGGGTCGTGCCTCCGGTGCTGTTACTTTGAAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1465926 spots for SRR9321774.sra Written 1465926 spots for SRR9321774.sra Read 1465926 spots for SRR9321774.sra Written 1465926 spots for SRR9321774.sra Read 1465926 spots for SRR9321774.sra Written 1465926 spots for SRR9321774.sra Read 1465926 spots for SRR9321774.sra Written 1465926 spots for SRR9321774.sra Read 1465926 spots for SRR9321774.sra Written 1465926 spots for SRR9321774.sra Read 1465926 spots for SRR9321774.sra Written 1465926 spots for SRR9321774.sra Read 1465926 spots for SRR9321774.sra Written 1465926 spots for SRR9321774.sra Read 1465926 spots for SRR9321774.sra Written 1465926 spots for SRR9321774.sra Read 1465926 spots for SRR9321774.sra Written 1465926 spots for SRR9321774.sra Read 1465926 spots for SRR9321774.sra Written 1465926 spots for SRR9321774.sra Read 1465926 spots for SRR9321774.sra Written 1465926 spots for SRR9321774.sra Read 1465926 spots for SRR9321774.sra Written 1465926 spots for SRR9321774.sra Read 1465926 spots for SRR9321774.sra Written 1465926 spots for SRR9321774.sra Read 1465926 spots for SRR9321774.sra Written 1465926 spots for SRR9321774.sra Read 1465926 spots for SRR9321774.sra Written 1465926 spots for SRR9321774.sra Read 1465926 spots for SRR9321774.sra Written 1465926 spots for SRR9321774.sra Read 1465926 spots for SRR9321774.sra Written 1465926 spots for SRR9321774.sra Read 1465929 spots for SRR9321774.sra Written 1465929 spots for SRR9321774.sra Read 1465926 spots for SRR9321774.sra Written 1465926 spots for SRR9321774.sra Read 1465926 spots for SRR9321774.sra Written 1465926 spots for SRR9321774.sra SRR ids: ['SRR9321774.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rmp9bg8w SRR9321774.sra spots: 29318523 blocks: [[1, 1465926], [1465927, 2931852], [2931853, 4397778], [4397779, 5863704], [5863705, 7329630], [7329631, 8795556], [8795557, 10261482], [10261483, 11727408], [11727409, 13193334], [13193335, 14659260], [14659261, 16125186], [16125187, 17591112], [17591113, 19057038], [19057039, 20522964], [20522965, 21988890], [21988891, 23454816], [23454817, 24920742], [24920743, 26386668], [26386669, 27852594], [27852595, 29318523]] SRR9321774 file size 5562126 SRR9321774 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9321774 SRR9321774_1.fastq SRR9321774_2.fastq Input file: SRR9321774_1.fastq Paired file: SRR9321774_2.fastq trimmed: SRR9321774-trimmed-pair1.fastq, SRR9321774-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 13:58:05 2025 >> started Wed Feb 12 13:58:29 2025 >> done (24.415s) 29318523 read pairs processed; of these: 4306 ( 0.01%) short read pairs filtered out after trimming by size control 9053 ( 0.03%) empty read pairs filtered out after trimming by size control 29305164 (99.95%) read pairs available; of these: 14588 ( 0.05%) trimmed read pairs available after processing 29290576 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 3 0.00% 22 3 0.00% 23 7 0.00% 24 7 0.00% 25 7 0.00% 26 5 0.00% 27 10 0.00% 28 11 0.00% 29 10 0.00% 30 11 0.00% 31 16 0.00% 32 14 0.00% 33 20 0.00% 34 14 0.00% 35 170 0.00% 36 174 0.00% 37 207 0.00% 38 253 0.00% 39 237 0.00% 40 298 0.00% 41 305 0.00% 42 348 0.00% 43 401 0.00% 44 447 0.00% 45 440 0.00% 46 425 0.00% 47 510 0.00% 48 541 0.00% 49 620 0.00% 50 713 0.00% 51 837 0.00% 52 928 0.00% 53 992 0.00% 54 982 0.00% 55 1390 0.00% 56 1343 0.00% 57 1519 0.01% 58 1749 0.01% 59 2197 0.01% 60 2602 0.01% 61 2655 0.01% 62 2693 0.01% 63 2824 0.01% 64 3133 0.01% 65 3579 0.01% 66 3471 0.01% 67 4041 0.01% 68 3749 0.01% 69 4097 0.01% 70 4828 0.02% 71 7342 0.03% 72 21816 0.07% 73 241831 0.83% 74 2338982 7.98% 75 14013276 47.82% 76 12626078 43.08% 29305164 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=34 prefix-density=0.28 prefix-fanout=2.0 sequence=GTATTTAGCCTTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=21.22 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=2.4 sequence=ATTGTTCTTACAGTCACAATATTTTATTCTCTAAGAACTTATCGTCTTCTCCATCAGAGCTGAGCATGATTGATATCGTAAGCATCAGAATCATCAAGCTTCAGCTTAACTAGTTCGCTGATATCATATGGATAGGCGTCCTTTGGTGACTGACGTTTATATGCTCTTTTTCCAAAGGCCCAAGCTTTAGCTTCAGTAAAATGGGCTCCATCCCAGTACACATAGTCACTCCTGTTGCTACATGGGAAGGAGAGAGATTTACATGGGACTGAACCAGGTTCTACCTCGCAACAGCTCTTACGGGTTTGTGTAAAACCTGTATT criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=26 prefix-density=0.20 prefix-fanout=1.8 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=21.65 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.9 sequence=TGCAGATCTTGGTGGTAGTAGCAAATATTCAAATGAGAACTTTGAAGGCCGAAGAGGGGAAAGGTTCCATGTGAACGGCACTTGCACATGGGTTAGTCGATCCTAAGAGACGGGGGAAGCCCGTCCGACAGCGCGTTCGCGCGCGAGCTTCGAAAGGGAATCGGGTTAAAATTCCTGAACCGGGACGTGGCGGCTGACGGCAACGTTAGGGAGTCCGGAGACGTCGGCGGGGGCCTCGGGAAGAGTTATCTTTTCTGTTTAACAGCCCGCCCACCCTGGAAACGACTTAGTCGGAGGTAGGGTCCAGCGGCTGGAAGAGCACCGCACGTCGCGTGGTGTCCGGTGCGCCCCCGGCGGCCCTTGAAAATCCGGAGGACCGAGTGCCTCCCACGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAACAGCCTCTGGTCGATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTCGGGAAAAGGATTGGCTCT SRR9321774 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 13:58:57 Started mapping on | Feb 12 13:58:58 Finished on | Feb 12 14:01:19 Mapping speed, Million of reads per hour | 748.22 Number of input reads | 29305164 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 22697104 Uniquely mapped reads % | 77.45% Average mapped length | 150.38 Number of splices: Total | 9960057 Number of splices: Annotated (sjdb) | 9848563 Number of splices: GT/AG | 9784775 Number of splices: GC/AG | 147608 Number of splices: AT/AC | 7806 Number of splices: Non-canonical | 19868 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.02% Deletion average length | 2.16 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1347893 % of reads mapped to multiple loci | 4.60% Number of reads mapped to too many loci | 4229512 % of reads mapped to too many loci | 14.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.02% % of reads unmapped: other | 0.50% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5260498 5260498 5260498 N_multimapping 1347893 1347893 1347893 N_noFeature 1346854 22368422 1428789 N_ambiguous 368902 1513 120874 UnstrandedReadsAssigned:20981348 PositiveStrandReadsAssigned:327169 NegativeStrandReadsAssigned:21147441 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9321774 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9321774-trimmed-pair1.fastq SRR9321774-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,305,164 reads, 24,396,918 reads pseudoaligned [quant] estimated average fragment length: 201.583 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 990 rounds 52401 SRR9321774.ke.tsv 34699 SRR9321774.se.tsv 87100 total ==> SRR9321774.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1817.42 417 7.20092 Potri.005G024800.1.v4.1 1035 834.417 173 6.50683 Potri.004G059700.1.v4.1 961 760.417 63 2.60013 Potri.007G009000.2.v4.1 1416 1215.42 0 0 Potri.003G141000.2.v4.1 2943 2742.42 363.09 4.15516 Potri.016G087400.1.v4.1 270 86.741 1777.23 643.021 Potri.015G069301.1.v4.1 564 363.594 0 0 Potri.010G195200.1.v4.1 1773 1572.42 12 0.239508 Potri.012G127500.1.v4.1 977 776.417 7565 305.788 ==> SRR9321774.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 35 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 272 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 69 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 16 SRR9321774 completed mapping pipeline successfully