Starting /dee2/code/volunteer_pipeline.sh SRR9321775 current disk space = 3051406798848 free memory = 1578360732 SRR9321775 SRAfilesize cb6e6cc004c5fcee79efb873d4bb68fd SRR9321775.sra SRR9321775.sra file validated SRR9321775 is paired end SRR9321775 is conventional basespace SRR9321775 read1 length is 40-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9321775_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 40-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5895 32.0 32.0 32.0 32.0 32.0 2 31.65575 32.0 32.0 32.0 32.0 32.0 3 31.57575 32.0 32.0 32.0 32.0 32.0 4 31.63325 32.0 32.0 32.0 32.0 32.0 5 31.66575 32.0 32.0 32.0 32.0 32.0 6 35.04375 36.0 36.0 36.0 36.0 36.0 7 35.375 36.0 36.0 36.0 36.0 36.0 8 35.33775 36.0 36.0 36.0 36.0 36.0 9 35.372 36.0 36.0 36.0 36.0 36.0 10-11 35.30975 36.0 36.0 36.0 36.0 36.0 12-13 35.377250000000004 36.0 36.0 36.0 36.0 36.0 14-15 35.391875 36.0 36.0 36.0 36.0 36.0 16-17 35.329 36.0 36.0 36.0 36.0 36.0 18-19 35.3725 36.0 36.0 36.0 36.0 36.0 20-21 35.279375 36.0 36.0 36.0 36.0 36.0 22-23 35.325125 36.0 36.0 36.0 36.0 36.0 24-25 35.291250000000005 36.0 36.0 36.0 36.0 36.0 26-27 35.304375 36.0 36.0 36.0 36.0 36.0 28-29 35.23524999999999 36.0 36.0 36.0 36.0 36.0 30-31 35.230125 36.0 36.0 36.0 36.0 36.0 32-33 35.222375 36.0 36.0 36.0 36.0 36.0 34-35 35.16675 36.0 36.0 36.0 36.0 36.0 36-37 35.10525 36.0 36.0 36.0 36.0 36.0 38-39 35.1515 36.0 36.0 36.0 36.0 36.0 40-41 35.11663709677419 36.0 36.0 36.0 36.0 36.0 42-43 35.15803950987747 36.0 36.0 36.0 36.0 36.0 44-45 35.112028007001754 36.0 36.0 36.0 36.0 36.0 46-47 35.12665666416604 36.0 36.0 36.0 36.0 36.0 48-49 35.00237559389848 36.0 36.0 36.0 36.0 36.0 50-51 35.10590147536884 36.0 36.0 36.0 36.0 36.0 52-53 35.12403100775194 36.0 36.0 36.0 36.0 36.0 54-55 34.99437359339835 36.0 36.0 36.0 36.0 36.0 56-57 34.97674418604652 36.0 36.0 36.0 36.0 36.0 58-59 34.9472368092023 36.0 36.0 36.0 34.0 36.0 60-61 34.99287321830458 36.0 36.0 36.0 36.0 36.0 62-63 34.89784946236559 36.0 36.0 36.0 36.0 36.0 64-65 35.0260065016254 36.0 36.0 36.0 36.0 36.0 66-67 34.96385692846423 36.0 36.0 36.0 36.0 36.0 68-69 34.89732366183091 36.0 36.0 36.0 36.0 36.0 70-71 34.76538269134568 36.0 36.0 36.0 32.0 36.0 72-73 34.76587068609581 36.0 36.0 36.0 32.0 36.0 74-75 34.66275670993043 36.0 36.0 36.0 32.0 36.0 76 34.326327856324035 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 3.0 25 10.0 26 12.0 27 24.0 28 37.0 29 42.0 30 43.0 31 91.0 32 120.0 33 198.0 34 419.0 35 3000.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.775000000000006 13.525 9.65 40.050000000000004 2 21.925 17.325 38.324999999999996 22.425 3 18.675 20.424999999999997 26.6 34.300000000000004 4 23.1 29.025000000000002 22.400000000000002 25.474999999999998 5 21.85 34.825 23.400000000000002 19.925 6 18.23915237134208 34.636730575176585 25.70635721493441 21.417759838546925 7 14.649999999999999 22.925 43.55 18.875 8 17.95 22.85 32.775 26.424999999999997 9 18.3 22.725 33.1 25.874999999999996 10-11 21.0625 32.0375 24.3625 22.537499999999998 12-13 20.875 26.174999999999997 27.0875 25.8625 14-15 20.1375 26.625 28.812500000000004 24.425 16-17 21.275 26.724999999999998 28.299999999999997 23.7 18-19 21.2625 28.000000000000004 26.275 24.462500000000002 20-21 20.8125 27.55 28.237499999999997 23.400000000000002 22-23 21.2 27.150000000000002 27.175 24.474999999999998 24-25 20.7375 27.224999999999998 27.175 24.8625 26-27 20.7375 27.8125 27.3875 24.0625 28-29 20.1 28.3875 26.424999999999997 25.087500000000002 30-31 20.5375 27.425 26.950000000000003 25.087500000000002 32-33 20.325 26.900000000000002 27.85 24.925 34-35 20.825 27.287499999999998 26.724999999999998 25.162499999999998 36-37 21.637500000000003 27.175 26.700000000000003 24.4875 38-39 20.25 28.199999999999996 27.787499999999998 23.7625 40-41 21.09013626703338 28.22852856607076 26.328291036379547 24.353044130516317 42-43 21.742935733933482 27.481870467616904 26.944236059014752 23.830957739434858 44-45 21.030257564391096 26.93173293323331 27.84446111527882 24.193548387096776 46-47 20.69267316829207 27.59439859964991 27.85696424106027 23.85596399099775 48-49 21.10527631907977 26.6816704176044 26.93173293323331 25.28132033008252 50-51 20.46761690422606 27.894473618404604 26.30657664416104 25.331332833208304 52-53 21.567891972993248 27.60690172543136 26.86921730432608 23.95598899724931 54-55 20.605151287821954 28.257064266066518 26.731682920730183 24.406101525381345 56-57 20.017504376094024 26.531632908227053 28.33208302075519 25.11877969492373 58-59 20.31757939484871 27.056764191047762 28.069517379344838 24.55613903475869 60-61 21.54288572143036 26.819204801200303 27.11927981995499 24.518629657414355 62-63 21.180295073768445 26.619154788697173 28.08202050512628 24.118529632408105 64-65 20.6176544136034 28.044511127781945 26.85671417854464 24.48112028007002 66-67 21.1855927963982 26.650825412706354 26.76338169084542 25.400200100050025 68-69 20.69784892446223 27.67633816908454 26.28814407203602 25.337668834417208 70-71 20.822911455727862 27.70135067533767 27.613806903451728 23.861930965482742 72-73 22.014550928248873 27.383341695935776 25.95333667837431 24.648770697441044 74-75 20.06888329580077 24.692012187044643 29.05020532520864 26.188899191945954 76 22.43026366068017 0.0 40.16048910966756 37.40924722965227 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 2.0 21 3.5 22 4.0 23 5.5 24 5.5 25 4.5 26 8.0 27 13.5 28 15.0 29 17.5 30 26.0 31 37.0 32 48.0 33 55.5 34 69.0 35 89.0 36 110.5 37 126.5 38 145.5 39 182.0 40 203.0 41 219.5 42 232.5 43 254.5 44 296.0 45 315.5 46 326.0 47 321.0 48 305.0 49 279.5 50 250.0 51 226.0 52 207.0 53 171.0 54 131.5 55 123.5 56 105.5 57 79.0 58 69.0 59 58.0 60 49.5 61 38.0 62 20.0 63 11.5 64 5.0 65 6.0 66 6.0 67 3.5 68 3.0 69 1.0 70 0.5 71 1.0 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.8999999999999999 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 40 1.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 6.0 72 12.0 73 79.0 74 253.0 75 1031.0 76 2617.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.52454846095141 96.825 2 1.2465021622996693 2.45 3 0.17807173747138133 0.525 4 0.05087763927753752 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9321775 read2 length is 38-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9321775_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 38-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.35175 32.0 32.0 32.0 32.0 32.0 2 31.1245 32.0 32.0 32.0 32.0 32.0 3 31.19525 32.0 32.0 32.0 32.0 32.0 4 31.21475 32.0 32.0 32.0 32.0 32.0 5 31.20225 32.0 32.0 32.0 32.0 32.0 6 34.7275 36.0 36.0 36.0 32.0 36.0 7 34.92725 36.0 36.0 36.0 36.0 36.0 8 34.6805 36.0 36.0 36.0 32.0 36.0 9 34.7165 36.0 36.0 36.0 32.0 36.0 10-11 34.758875 36.0 36.0 36.0 32.0 36.0 12-13 34.796 36.0 36.0 36.0 32.0 36.0 14-15 34.6665 36.0 36.0 36.0 34.0 36.0 16-17 34.714625 36.0 36.0 36.0 34.0 36.0 18-19 34.619625 36.0 36.0 36.0 32.0 36.0 20-21 34.583749999999995 36.0 36.0 36.0 32.0 36.0 22-23 34.628 36.0 36.0 36.0 32.0 36.0 24-25 34.645624999999995 36.0 36.0 36.0 32.0 36.0 26-27 34.488375 36.0 36.0 36.0 32.0 36.0 28-29 34.523125 36.0 36.0 36.0 32.0 36.0 30-31 34.554125 36.0 36.0 36.0 32.0 36.0 32-33 34.47475 36.0 36.0 36.0 32.0 36.0 34-35 34.446375 36.0 36.0 36.0 32.0 36.0 36-37 34.554500000000004 36.0 36.0 36.0 32.0 36.0 38-39 34.408166010252565 36.0 36.0 36.0 32.0 36.0 40-41 34.39927991002253 36.0 36.0 36.0 32.0 36.0 42-43 34.43859429714857 36.0 36.0 36.0 32.0 36.0 44-45 34.35705352676338 36.0 36.0 36.0 32.0 36.0 46-47 34.24387193596798 36.0 36.0 36.0 32.0 36.0 48-49 34.34017008504252 36.0 36.0 36.0 32.0 36.0 50-51 34.24487243621811 36.0 36.0 36.0 32.0 36.0 52-53 34.2096048024012 36.0 36.0 36.0 32.0 36.0 54-55 34.00662831415708 36.0 36.0 36.0 32.0 36.0 56-57 34.18309154577289 36.0 36.0 36.0 32.0 36.0 58-59 34.081790895447725 36.0 36.0 36.0 32.0 36.0 60-61 34.17258629314657 36.0 36.0 36.0 32.0 36.0 62-63 34.045033775331504 36.0 36.0 36.0 32.0 36.0 64-65 33.89754816112084 36.0 36.0 36.0 29.5 36.0 66-67 33.87625125125125 36.0 36.0 36.0 29.5 36.0 68-69 33.78490990990991 36.0 36.0 36.0 27.0 36.0 70-71 33.88213213213213 36.0 36.0 36.0 29.5 36.0 72-73 33.85130744510691 36.0 36.0 36.0 27.0 36.0 74-75 33.81327103515382 36.0 36.0 36.0 27.0 36.0 76 33.054810272134915 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 9.0 16 3.0 17 6.0 18 3.0 19 6.0 20 8.0 21 8.0 22 12.0 23 9.0 24 21.0 25 19.0 26 41.0 27 41.0 28 58.0 29 85.0 30 89.0 31 102.0 32 174.0 33 269.0 34 626.0 35 2410.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.59574468085106 21.00125156445557 12.715894868585732 29.687108886107634 2 28.499999999999996 26.325 31.424999999999997 13.750000000000002 3 22.525000000000002 28.175 27.925 21.375 4 26.0 34.175 21.325 18.5 5 26.05 36.0 19.900000000000002 18.05 6 21.05 38.3 20.75 19.900000000000002 7 21.925 18.675 38.4 21.0 8 23.025000000000002 23.525 26.400000000000002 27.05 9 21.95 24.375 28.475 25.2 10-11 25.2375 30.475 22.275 22.0125 12-13 25.078134766845857 24.840605075634453 26.253281660207527 23.827978497312163 14-15 23.0432608152038 27.369342335583895 27.819454863715933 21.767941985496375 16-17 24.60615153788447 25.868967241810452 27.131782945736433 22.393098274568644 18-19 24.54056757094637 27.640955119389925 26.078259782472806 21.7402175271909 20-21 24.66558319789974 27.028378547318415 26.26578322290286 22.040255031878985 22-23 24.493623405851466 27.144286071517882 26.294073518379594 22.06801700425106 24-25 24.968742185546386 26.569142285571395 27.19429857464366 21.267816954238562 26-27 23.78094523630908 28.257064266066518 25.64391097774444 22.31807951987997 28-29 24.99374843710928 27.53188297074269 26.281570392598148 21.192798199549888 30-31 23.768442110527634 26.78169542385596 27.66941735433858 21.780445111277817 32-33 23.905976494123532 27.506876719179797 26.894223555888974 21.6929232308077 34-35 24.840605075634453 26.740842605325664 27.728466058257283 20.690086260782596 36-37 24.04050506313289 27.140892611576444 26.8533566695837 21.965245655706962 38-39 24.243560890222557 27.60690172543136 26.6816704176044 21.467866966741685 40-41 24.871826935100664 27.060147555333252 27.022633487557833 21.04539202200825 42-43 24.387193596798397 27.43871935967984 26.500750375187593 21.673336668334166 44-45 24.912456228114056 27.088544272136065 26.23811905952976 21.76088044022011 46-47 24.487243621810904 27.226113056528263 27.201100550275136 21.085542771385693 48-49 24.362181090545274 26.313156578289142 27.213606803401703 22.11105552776388 50-51 23.56178089044522 27.913956978489246 26.463231615807903 22.061030515257627 52-53 25.087543771885944 28.01400700350175 26.025512756378188 20.87293646823412 54-55 24.062031015507753 27.176088044022013 27.238619309654826 21.52326163081541 56-57 24.249624812406203 26.750875437718857 27.776388194097045 21.223111555777887 58-59 24.387193596798397 26.87593796898449 27.55127563781891 21.1855927963982 60-61 24.349674837418707 26.613306653326664 27.851425712856425 21.1855927963982 62-63 24.78108581436077 26.38228671503628 27.683262446835126 21.153365023767826 64-65 25.2064048036027 26.857643232424316 26.782586940205157 21.153365023767826 66-67 24.477537229383056 26.604930546865223 27.04292328869979 21.874608935051935 68-69 24.54954954954955 27.47747747747748 26.564064064064063 21.40890890890891 70-71 24.33988236766362 27.656113127268178 26.88024027030409 21.12376423476411 72-73 24.937154348919055 27.023629964806435 26.797385620915033 21.241830065359476 74-75 24.932795698924732 24.032258064516128 28.776881720430108 22.258064516129032 76 27.17516289766194 0.0 38.482177079340744 34.342660022997315 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 3.5 25 4.5 26 5.5 27 8.5 28 12.0 29 16.0 30 18.0 31 21.0 32 33.5 33 48.0 34 58.5 35 83.0 36 106.0 37 112.5 38 149.0 39 192.0 40 218.0 41 242.0 42 250.5 43 282.5 44 309.5 45 303.5 46 294.0 47 306.5 48 291.5 49 261.5 50 256.0 51 224.0 52 189.5 53 161.5 54 136.0 55 124.5 56 108.0 57 84.5 58 72.5 59 63.5 60 53.5 61 39.5 62 28.5 63 20.0 64 10.0 65 6.0 66 5.0 67 5.0 68 5.5 69 4.5 70 3.5 71 4.0 72 4.0 73 3.0 74 1.5 75 1.0 76 1.0 77 0.5 78 0.5 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.5 99 9.0 100 17.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0125 14-15 0.025 16-17 0.025 18-19 0.0125 20-21 0.0125 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.0125 36-37 0.0125 38-39 0.012501562695336917 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.012512512512512512 68-69 0.0 70-71 0.012512512512512512 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 38 1.0 39 0.0 40 1.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 0.0 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 3.0 72 30.0 73 92.0 74 302.0 75 960.0 76 2609.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.075 #Duplication Level Percentage of deduplicated Percentage of total 1 98.6744838134081 96.775 2 1.0960999235279123 2.15 3 0.1784348712719857 0.525 4 0.025490695895997964 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025490695895997964 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 18 0.44999999999999996 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1400379 spots for SRR9321775.sra Written 1400379 spots for SRR9321775.sra Read 1400379 spots for SRR9321775.sra Written 1400379 spots for SRR9321775.sra Read 1400379 spots for SRR9321775.sra Written 1400379 spots for SRR9321775.sra Read 1400379 spots for SRR9321775.sra Written 1400379 spots for SRR9321775.sra Read 1400379 spots for SRR9321775.sra Written 1400379 spots for SRR9321775.sra Read 1400379 spots for SRR9321775.sra Written 1400379 spots for SRR9321775.sra Read 1400379 spots for SRR9321775.sra Written 1400379 spots for SRR9321775.sra Read 1400379 spots for SRR9321775.sra Written 1400379 spots for SRR9321775.sra Read 1400379 spots for SRR9321775.sra Written 1400379 spots for SRR9321775.sra Read 1400379 spots for SRR9321775.sra Written 1400379 spots for SRR9321775.sra Read 1400379 spots for SRR9321775.sra Written 1400379 spots for SRR9321775.sra Read 1400379 spots for SRR9321775.sra Written 1400379 spots for SRR9321775.sra Read 1400379 spots for SRR9321775.sra Written 1400379 spots for SRR9321775.sra Read 1400379 spots for SRR9321775.sra Written 1400379 spots for SRR9321775.sra Read 1400395 spots for SRR9321775.sra Written 1400395 spots for SRR9321775.sra Read 1400379 spots for SRR9321775.sra Written 1400379 spots for SRR9321775.sra Read 1400379 spots for SRR9321775.sra Written 1400379 spots for SRR9321775.sra Read 1400379 spots for SRR9321775.sra Written 1400379 spots for SRR9321775.sra Read 1400379 spots for SRR9321775.sra Written 1400379 spots for SRR9321775.sra Read 1400379 spots for SRR9321775.sra Written 1400379 spots for SRR9321775.sra SRR ids: ['SRR9321775.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sallm4qd SRR9321775.sra spots: 28007596 blocks: [[1, 1400379], [1400380, 2800758], [2800759, 4201137], [4201138, 5601516], [5601517, 7001895], [7001896, 8402274], [8402275, 9802653], [9802654, 11203032], [11203033, 12603411], [12603412, 14003790], [14003791, 15404169], [15404170, 16804548], [16804549, 18204927], [18204928, 19605306], [19605307, 21005685], [21005686, 22406064], [22406065, 23806443], [23806444, 25206822], [25206823, 26607201], [26607202, 28007596]] SRR9321775 file size 5311806 SRR9321775 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9321775 SRR9321775_1.fastq SRR9321775_2.fastq Input file: SRR9321775_1.fastq Paired file: SRR9321775_2.fastq trimmed: SRR9321775-trimmed-pair1.fastq, SRR9321775-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 14:10:53 2025 >> started Wed Feb 12 14:11:18 2025 >> done (24.429s) 28007596 read pairs processed; of these: 4053 ( 0.01%) short read pairs filtered out after trimming by size control 9592 ( 0.03%) empty read pairs filtered out after trimming by size control 27993951 (99.95%) read pairs available; of these: 14933 ( 0.05%) trimmed read pairs available after processing 27979018 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 8 0.00% 21 5 0.00% 22 7 0.00% 23 13 0.00% 24 18 0.00% 25 17 0.00% 26 22 0.00% 27 30 0.00% 28 52 0.00% 29 48 0.00% 30 29 0.00% 31 45 0.00% 32 40 0.00% 33 64 0.00% 34 53 0.00% 35 219 0.00% 36 213 0.00% 37 238 0.00% 38 279 0.00% 39 270 0.00% 40 309 0.00% 41 346 0.00% 42 368 0.00% 43 400 0.00% 44 382 0.00% 45 399 0.00% 46 392 0.00% 47 441 0.00% 48 558 0.00% 49 603 0.00% 50 678 0.00% 51 767 0.00% 52 783 0.00% 53 858 0.00% 54 836 0.00% 55 1180 0.00% 56 1238 0.00% 57 1286 0.00% 58 1561 0.01% 59 1929 0.01% 60 2365 0.01% 61 2426 0.01% 62 2392 0.01% 63 2364 0.01% 64 2819 0.01% 65 3108 0.01% 66 2972 0.01% 67 3556 0.01% 68 3291 0.01% 69 3570 0.01% 70 4252 0.02% 71 6072 0.02% 72 21267 0.08% 73 244543 0.87% 74 2317988 8.28% 75 13554204 48.42% 76 11799774 42.15% 27993951 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=1.75 fanout-score-rank=38 prefix-density=0.45 prefix-fanout=1.0 sequence=TAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGG criterion=fanout-score sequence-density=0.05 sequence-density-rank=32 fanout-score=16.41 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=3.5 sequence=CCATCTTTCGGCTAACCTAGCCTCCTCCGTCCCTCGGGACCAACAAGGGGTAGTACAGGAATATTCGCCTGTTGTCCATCGACTACGCCTTTCGGCCTGATCTTAGGCCCTGACTCACCCTCCGTGGACGAACCTTGCGGAGGAACCCTTAGGTTTTCGGGGCATTGGATTCTCACCAATGTTTGCGTTACTCAAGCCGACATTCTCGCTTCCGCTTCGTCCACCCCCGCTCGCGCGGGTGCTTCCCTCTAAGCGGAACGCTCCCCTACCGATGCATTTTTACATCCCACAGCTTCGGCAGATCGCTTAGCCCCGTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTATTACGCACTCTTTCAAGGGTGGCTGCTTCTAGGCAAACCTCCTGGCTGTCTCTGCACCCCTACCTCCTTTATCACTGAGCGGTCATTTAGGGGCCTTAGCTGGTGATCCGGGCTGTTTCCCTCTCGACGATGAAGCTTATCCCCCACCGTCTCACTGGC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=33 prefix-density=0.29 prefix-fanout=1.9 sequence=GAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGTCCCTAGCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=46.91 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.2 sequence=AACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTT SRR9321775 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 14:11:52 Started mapping on | Feb 12 14:11:52 Finished on | Feb 12 14:13:16 Mapping speed, Million of reads per hour | 1199.74 Number of input reads | 27993951 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 24056585 Uniquely mapped reads % | 85.93% Average mapped length | 150.42 Number of splices: Total | 10736480 Number of splices: Annotated (sjdb) | 10614489 Number of splices: GT/AG | 10541216 Number of splices: GC/AG | 166485 Number of splices: AT/AC | 7324 Number of splices: Non-canonical | 21455 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.02% Deletion average length | 2.16 Insertion rate per base | 0.01% Insertion average length | 1.95 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1170144 % of reads mapped to multiple loci | 4.18% Number of reads mapped to too many loci | 1618986 % of reads mapped to too many loci | 5.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.91% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2767562 2767562 2767562 N_multimapping 1170144 1170144 1170144 N_noFeature 743053 23749487 836373 N_ambiguous 348113 1403 133207 UnstrandedReadsAssigned:22965419 PositiveStrandReadsAssigned:305695 NegativeStrandReadsAssigned:23087005 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9321775 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9321775-trimmed-pair1.fastq SRR9321775-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,993,951 reads, 24,854,812 reads pseudoaligned [quant] estimated average fragment length: 199.535 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR9321775.ke.tsv 34699 SRR9321775.se.tsv 87100 total ==> SRR9321775.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1819.46 410 7.52229 Potri.005G024800.1.v4.1 1035 836.465 140 5.58715 Potri.004G059700.1.v4.1 961 762.469 72 3.15224 Potri.007G009000.2.v4.1 1416 1217.46 2 0.0548382 Potri.003G141000.2.v4.1 2943 2744.46 361.095 4.39212 Potri.016G087400.1.v4.1 270 88.9779 1836.02 688.82 Potri.015G069301.1.v4.1 564 365.656 0 0 Potri.010G195200.1.v4.1 1773 1574.46 7 0.148414 Potri.012G127500.1.v4.1 977 778.469 7806 334.732 ==> SRR9321775.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 44 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 321 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 84 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR9321775 completed mapping pipeline successfully