Starting /dee2/code/volunteer_pipeline.sh SRR9321776 current disk space = 3051384025088 free memory = 1578594152 SRR9321776 SRAfilesize bad864cae88776c8471f8ebbd20a2677 SRR9321776.sra SRR9321776.sra file validated SRR9321776 is paired end SRR9321776 is conventional basespace SRR9321776 read1 length is 41-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9321776_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 41-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.567 32.0 32.0 32.0 32.0 32.0 2 31.5085 32.0 32.0 32.0 32.0 32.0 3 31.59525 32.0 32.0 32.0 32.0 32.0 4 31.5715 32.0 32.0 32.0 32.0 32.0 5 31.62475 32.0 32.0 32.0 32.0 32.0 6 34.86175 36.0 36.0 36.0 36.0 36.0 7 35.28525 36.0 36.0 36.0 36.0 36.0 8 35.38 36.0 36.0 36.0 36.0 36.0 9 35.2285 36.0 36.0 36.0 36.0 36.0 10-11 35.264375 36.0 36.0 36.0 36.0 36.0 12-13 35.324875000000006 36.0 36.0 36.0 36.0 36.0 14-15 35.26675 36.0 36.0 36.0 36.0 36.0 16-17 35.28725 36.0 36.0 36.0 36.0 36.0 18-19 35.24625 36.0 36.0 36.0 36.0 36.0 20-21 35.220875 36.0 36.0 36.0 36.0 36.0 22-23 35.221125 36.0 36.0 36.0 36.0 36.0 24-25 35.208375000000004 36.0 36.0 36.0 36.0 36.0 26-27 35.1935 36.0 36.0 36.0 36.0 36.0 28-29 35.2325 36.0 36.0 36.0 36.0 36.0 30-31 35.1605 36.0 36.0 36.0 36.0 36.0 32-33 35.173 36.0 36.0 36.0 36.0 36.0 34-35 35.082375 36.0 36.0 36.0 36.0 36.0 36-37 35.115375 36.0 36.0 36.0 36.0 36.0 38-39 35.095 36.0 36.0 36.0 36.0 36.0 40-41 35.061499999999995 36.0 36.0 36.0 36.0 36.0 42-43 35.07051762940735 36.0 36.0 36.0 36.0 36.0 44-45 35.09189797449362 36.0 36.0 36.0 36.0 36.0 46-47 35.093898474618655 36.0 36.0 36.0 36.0 36.0 48-49 34.96861715428857 36.0 36.0 36.0 36.0 36.0 50-51 35.03000750187547 36.0 36.0 36.0 36.0 36.0 52-53 35.07889472368092 36.0 36.0 36.0 36.0 36.0 54-55 34.99212303075769 36.0 36.0 36.0 36.0 36.0 56-57 34.86546636659165 36.0 36.0 36.0 36.0 36.0 58-59 34.81455422009579 36.0 36.0 36.0 34.0 36.0 60-61 34.871810905452726 36.0 36.0 36.0 36.0 36.0 62-63 34.8260380190095 36.0 36.0 36.0 34.0 36.0 64-65 34.88655201381026 36.0 36.0 36.0 36.0 36.0 66-67 34.90765765765766 36.0 36.0 36.0 36.0 36.0 68-69 34.7957957957958 36.0 36.0 36.0 36.0 36.0 70-71 34.747997997998 36.0 36.0 36.0 32.0 36.0 72-73 34.653598311079435 36.0 36.0 36.0 32.0 36.0 74-75 34.574904229995084 36.0 36.0 36.0 32.0 36.0 76 34.10448916408669 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 1.0 23 0.0 24 7.0 25 4.0 26 15.0 27 23.0 28 32.0 29 45.0 30 81.0 31 81.0 32 139.0 33 225.0 34 425.0 35 2920.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.824999999999996 12.125 9.975000000000001 40.075 2 22.025 15.725 37.15 25.1 3 18.25 21.0 25.95 34.8 4 24.375 28.799999999999997 21.5 25.324999999999996 5 22.6 34.475 23.075000000000003 19.85 6 19.74779319041614 34.50189155107188 24.867591424968474 20.88272383354351 7 15.6 24.474999999999998 41.425 18.5 8 18.375 23.65 32.775 25.2 9 18.45 23.7 32.675 25.174999999999997 10-11 22.3 31.887500000000003 23.025000000000002 22.787499999999998 12-13 20.962500000000002 24.75 28.199999999999996 26.087500000000002 14-15 20.599999999999998 26.474999999999998 28.15 24.775 16-17 21.05 27.037499999999998 27.6375 24.275 18-19 20.7875 27.187499999999996 27.425 24.6 20-21 21.1125 27.8875 27.400000000000002 23.599999999999998 22-23 21.625 27.712500000000002 26.875 23.7875 24-25 20.375 27.425 27.500000000000004 24.7 26-27 20.95 27.575 27.2625 24.212500000000002 28-29 21.675 26.674999999999997 27.075 24.575 30-31 20.125 27.487499999999997 27.700000000000003 24.6875 32-33 20.0 27.400000000000002 27.0625 25.5375 34-35 20.1125 27.125 27.900000000000002 24.8625 36-37 21.3875 27.5125 27.150000000000002 23.95 38-39 21.5625 26.85 27.4125 24.175 40-41 21.1375 28.462500000000002 26.25 24.15 42-43 20.555138784696176 27.33183295823956 27.581895473868467 24.5311327831958 44-45 21.042760690172543 27.35683920980245 26.669167291822955 24.93123280820205 46-47 20.94273568392098 27.86946736684171 27.206801700425103 23.980995248812203 48-49 20.59264816204051 27.781945486371594 27.156789197299325 24.468617154288573 50-51 21.43035758939735 26.79419854963741 27.25681420355089 24.518629657414355 52-53 21.255313828457115 27.306826706676667 27.306826706676667 24.131032758189548 54-55 20.967741935483872 27.86946736684171 26.569142285571395 24.593648412103025 56-57 20.84271067766942 27.031757939484873 27.131782945736433 24.99374843710928 58-59 20.907840440165064 27.64786795048143 26.84756783793923 24.59672377141428 60-61 20.860430215107552 27.351175587793897 27.188594297148573 24.599799899949975 62-63 21.410705352676338 26.550775387693847 27.238619309654826 24.79989994997499 64-65 20.925578486554098 27.24202626641651 27.31707317073171 24.515322076297686 66-67 21.10860860860861 27.627627627627625 26.2012012012012 25.06256256256256 68-69 20.808308308308305 27.002002002002 26.764264264264266 25.425425425425423 70-71 21.85935935935936 27.039539539539543 26.864364364364363 24.236736736736734 72-73 21.366553416383542 27.230401409336856 27.645652447464453 23.757392726815148 74-75 21.020216896505556 25.31798098808408 28.03588164412907 25.625920471281294 76 22.3297213622291 0.0 40.90557275541796 36.76470588235294 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.5 22 2.0 23 2.5 24 3.5 25 5.0 26 8.5 27 13.0 28 16.5 29 21.0 30 29.5 31 47.5 32 57.0 33 57.5 34 67.5 35 83.5 36 105.5 37 124.5 38 153.5 39 178.5 40 198.0 41 226.0 42 241.0 43 250.0 44 262.5 45 286.0 46 293.0 47 294.5 48 323.0 49 298.5 50 249.0 51 219.0 52 183.0 53 168.0 54 163.0 55 141.5 56 115.5 57 95.5 58 81.5 59 68.5 60 53.0 61 37.5 62 26.0 63 19.0 64 11.5 65 7.0 66 4.5 67 6.0 68 5.0 69 2.5 70 1.5 71 2.5 72 2.5 73 2.5 74 1.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.8750000000000001 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 41 1.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 1.0 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 10.0 72 25.0 73 80.0 74 293.0 75 1004.0 76 2584.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.18692543411645 96.125 2 1.5577119509703778 3.05 3 0.20429009193054137 0.6 4 0.02553626149131767 0.1 5 0.02553626149131767 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9321776 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9321776_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.17275 32.0 32.0 32.0 32.0 32.0 2 31.147 32.0 32.0 32.0 32.0 32.0 3 31.1895 32.0 32.0 32.0 32.0 32.0 4 31.0395 32.0 32.0 32.0 32.0 32.0 5 31.0215 32.0 32.0 32.0 32.0 32.0 6 34.3745 36.0 36.0 36.0 32.0 36.0 7 34.69025 36.0 36.0 36.0 32.0 36.0 8 34.46575 36.0 36.0 36.0 32.0 36.0 9 34.6485 36.0 36.0 36.0 32.0 36.0 10-11 34.612375 36.0 36.0 36.0 32.0 36.0 12-13 34.630750000000006 36.0 36.0 36.0 32.0 36.0 14-15 34.549625 36.0 36.0 36.0 32.0 36.0 16-17 34.3655 36.0 36.0 36.0 32.0 36.0 18-19 34.331125 36.0 36.0 36.0 32.0 36.0 20-21 34.484375 36.0 36.0 36.0 32.0 36.0 22-23 34.482 36.0 36.0 36.0 32.0 36.0 24-25 34.338 36.0 36.0 36.0 32.0 36.0 26-27 34.279375 36.0 36.0 36.0 32.0 36.0 28-29 34.365375 36.0 36.0 36.0 32.0 36.0 30-31 34.368750000000006 36.0 36.0 36.0 32.0 36.0 32-33 34.314 36.0 36.0 36.0 32.0 36.0 34-35 34.2645 36.0 36.0 36.0 32.0 36.0 36-37 34.33370842710678 36.0 36.0 36.0 32.0 36.0 38-39 34.122280570142536 36.0 36.0 36.0 32.0 36.0 40-41 34.17379344836209 36.0 36.0 36.0 32.0 36.0 42-43 34.217733866933465 36.0 36.0 36.0 32.0 36.0 44-45 33.94884942471236 36.0 36.0 36.0 29.5 36.0 46-47 33.99924962481241 36.0 36.0 36.0 32.0 36.0 48-49 34.19297148574287 36.0 36.0 36.0 32.0 36.0 50-51 33.84884966256902 36.0 36.0 36.0 29.5 36.0 52-53 33.96534034034034 36.0 36.0 36.0 32.0 36.0 54-55 33.97134634634635 36.0 36.0 36.0 32.0 36.0 56-57 33.8948948948949 36.0 36.0 36.0 29.5 36.0 58-59 33.753003003003 36.0 36.0 36.0 27.0 36.0 60-61 33.959209209209206 36.0 36.0 36.0 29.5 36.0 62-63 33.79642142142142 36.0 36.0 36.0 29.5 36.0 64-65 33.64159046405605 36.0 36.0 36.0 27.0 36.0 66-67 33.64697045568353 36.0 36.0 36.0 27.0 36.0 68-69 33.712944416624936 36.0 36.0 36.0 27.0 36.0 70-71 33.622849228752955 36.0 36.0 36.0 27.0 36.0 72-73 33.72303741899612 36.0 36.0 36.0 27.0 36.0 74-75 33.64437000632935 36.0 36.0 36.0 27.0 36.0 76 32.8536866359447 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 2.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 7.0 16 7.0 17 8.0 18 6.0 19 9.0 20 7.0 21 7.0 22 8.0 23 10.0 24 18.0 25 33.0 26 39.0 27 45.0 28 65.0 29 109.0 30 103.0 31 144.0 32 180.0 33 294.0 34 589.0 35 2306.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.95196397297973 21.491118338754063 13.309982486865149 29.246935201401055 2 27.806951737934483 26.581645411352838 31.48287071767942 14.128532133033259 3 22.53063265816454 26.78169542385596 28.60715178794699 22.080520130032507 4 25.98149537384346 33.4333583395849 21.305326331582897 19.279819954988746 5 25.98149537384346 34.358589647411854 21.8304576144036 17.829457364341085 6 22.18054513628407 35.68392098024506 21.905476369092273 20.230057514378593 7 21.080270067516878 18.554638659664917 39.13478369592398 21.230307576894223 8 22.761380690345174 24.087043521760883 27.813906953476735 25.337668834417208 9 23.94894894894895 23.94894894894895 27.902902902902905 24.1991991991992 10-11 25.25025025025025 31.243743743743746 21.90940940940941 21.596596596596594 12-13 25.05005005005005 25.125125125125123 26.989489489489486 22.835335335335337 14-15 25.36603679139031 26.041797021649355 27.480916030534353 21.111250156425978 16-17 24.512012012012015 27.52752752752753 26.476476476476474 21.483983983983983 18-19 24.386886886886888 28.315815815815814 25.963463463463466 21.333833833833836 20-21 24.637137137137138 26.901901901901905 26.213713713713716 22.24724724724725 22-23 23.41091091091091 28.415915915915917 25.813313313313312 22.35985985985986 24-25 24.54954954954955 27.5025025025025 27.014514514514516 20.933433433433432 26-27 24.424424424424423 27.27727727727728 26.576576576576578 21.72172172172172 28-29 24.94994994994995 27.18968968968969 27.3023023023023 20.558058058058055 30-31 24.83733733733734 27.602602602602605 25.58808808808809 21.97197197197197 32-33 23.886386386386384 27.515015015015017 27.177177177177175 21.42142142142142 34-35 24.674674674674673 27.602602602602605 26.013513513513516 21.70920920920921 36-37 23.936436436436438 27.75275275275275 26.326326326326328 21.984484484484483 38-39 24.124124124124123 26.776776776776778 27.077077077077078 22.02202202202202 40-41 23.773773773773772 27.94044044044044 26.151151151151154 22.134634634634633 42-43 24.04255319148936 27.34668335419274 26.307884856070086 22.302878598247812 44-45 24.618272841051315 27.584480600750936 26.62077596996245 21.176470588235293 46-47 24.993742177722154 26.971214017521906 26.320400500625784 21.714643304130163 48-49 24.893617021276597 27.171464330413013 26.070087609511887 21.8648310387985 50-51 24.061091637456183 28.029544316474713 25.98898347521282 21.920380570856285 52-53 24.75582268970699 27.235161532682195 26.120711244678184 21.888304532932633 54-55 24.530428249436515 27.222639619333833 26.72176308539945 21.525169045830204 56-57 24.855997996493866 27.172551965940393 26.35862759829702 21.61282243926872 58-59 24.480340596043078 26.884547958928124 27.210117705985475 21.424993739043327 60-61 24.98121712997746 26.508890558477333 26.521412471825695 21.98847983971951 62-63 24.217380415727526 27.197595792637113 26.584022038567497 22.001001753067868 64-65 25.86422845691383 26.44038076152305 26.565631262525052 21.12975951903808 66-67 25.062656641604008 26.842105263157894 26.654135338345863 21.44110275689223 68-69 24.617890253069405 26.384364820846905 26.73515409671762 22.262590829366076 70-71 25.535915757803686 27.153065062053404 25.6362040867494 21.674815093393505 72-73 26.20637520473731 25.979589265465542 26.39536348746378 21.418672042333377 74-75 25.3843069108408 23.138617831840662 28.405293409971925 23.07178184734661 76 27.258746635909265 0.0 39.44636678200692 33.29488658208382 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 1.0 5 1.5 6 1.0 7 0.0 8 0.0 9 0.5 10 1.5 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 2.0 22 1.0 23 0.5 24 2.0 25 4.0 26 5.5 27 7.0 28 7.5 29 10.5 30 18.5 31 28.0 32 35.5 33 37.5 34 49.0 35 67.0 36 92.5 37 126.0 38 147.5 39 164.5 40 200.5 41 250.0 42 280.5 43 286.5 44 299.0 45 317.0 46 324.5 47 323.0 48 302.5 49 265.5 50 236.0 51 224.0 52 197.0 53 157.5 54 134.5 55 124.0 56 112.0 57 90.0 58 71.0 59 57.5 60 46.0 61 36.5 62 30.5 63 22.5 64 11.0 65 9.5 66 8.5 67 6.5 68 7.0 69 6.0 70 3.5 71 3.5 72 4.0 73 3.0 74 2.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 1.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.5 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 2.0 99 11.0 100 18.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.05 9 0.1 10-11 0.1 12-13 0.1 14-15 0.11249999999999999 16-17 0.1 18-19 0.1 20-21 0.1 22-23 0.1 24-25 0.1 26-27 0.1 28-29 0.1 30-31 0.1 32-33 0.1 34-35 0.1 36-37 0.07501875468867217 38-39 0.07501875468867217 40-41 0.07501875468867217 42-43 0.0750375187593797 44-45 0.0750375187593797 46-47 0.0750375187593797 48-49 0.0750375187593797 50-51 0.07505629221916438 52-53 0.07507507507507508 54-55 0.07507507507507508 56-57 0.07507507507507508 58-59 0.07507507507507508 60-61 0.07507507507507508 62-63 0.07507507507507508 64-65 0.08759854836691278 66-67 0.10015022533800699 68-69 0.07511266900350526 70-71 0.11269722013523666 72-73 0.08811681772406849 74-75 0.09348290598290598 76 0.1152073732718894 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 1.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 2.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 1.0 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 2.0 71 5.0 72 30.0 73 80.0 74 266.0 75 1007.0 76 2604.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.75031879622546 96.8 2 1.0456516194848253 2.0500000000000003 3 0.102014792144861 0.3 4 0.02550369803621525 0.1 5 0.02550369803621525 0.125 6 0.02550369803621525 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02550369803621525 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 19 0.475 No Hit GTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTCG 6 0.15 No Hit GGAGTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1336909 spots for SRR9321776.sra Written 1336909 spots for SRR9321776.sra Read 1336909 spots for SRR9321776.sra Written 1336909 spots for SRR9321776.sra Read 1336909 spots for SRR9321776.sra Written 1336909 spots for SRR9321776.sra Read 1336909 spots for SRR9321776.sra Written 1336909 spots for SRR9321776.sra Read 1336909 spots for SRR9321776.sra Written 1336909 spots for SRR9321776.sra Read 1336909 spots for SRR9321776.sra Written 1336909 spots for SRR9321776.sra Read 1336909 spots for SRR9321776.sra Written 1336909 spots for SRR9321776.sra Read 1336909 spots for SRR9321776.sra Written 1336909 spots for SRR9321776.sra Read 1336909 spots for SRR9321776.sra Written 1336909 spots for SRR9321776.sra Read 1336909 spots for SRR9321776.sra Written 1336909 spots for SRR9321776.sra Read 1336927 spots for SRR9321776.sra Written 1336927 spots for SRR9321776.sra Read 1336909 spots for SRR9321776.sra Written 1336909 spots for SRR9321776.sra Read 1336909 spots for SRR9321776.sra Written 1336909 spots for SRR9321776.sra Read 1336909 spots for SRR9321776.sra Written 1336909 spots for SRR9321776.sra Read 1336909 spots for SRR9321776.sra Written 1336909 spots for SRR9321776.sra Read 1336909 spots for SRR9321776.sra Written 1336909 spots for SRR9321776.sra Read 1336909 spots for SRR9321776.sra Written 1336909 spots for SRR9321776.sra Read 1336909 spots for SRR9321776.sra Written 1336909 spots for SRR9321776.sra Read 1336909 spots for SRR9321776.sra Written 1336909 spots for SRR9321776.sra Read 1336909 spots for SRR9321776.sra Written 1336909 spots for SRR9321776.sra SRR ids: ['SRR9321776.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_thoa6d45 SRR9321776.sra spots: 26738198 blocks: [[1, 1336909], [1336910, 2673818], [2673819, 4010727], [4010728, 5347636], [5347637, 6684545], [6684546, 8021454], [8021455, 9358363], [9358364, 10695272], [10695273, 12032181], [12032182, 13369090], [13369091, 14705999], [14706000, 16042908], [16042909, 17379817], [17379818, 18716726], [18716727, 20053635], [20053636, 21390544], [21390545, 22727453], [22727454, 24064362], [24064363, 25401271], [25401272, 26738198]] SRR9321776 file size 5070088 SRR9321776 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9321776 SRR9321776_1.fastq SRR9321776_2.fastq Input file: SRR9321776_1.fastq Paired file: SRR9321776_2.fastq trimmed: SRR9321776-trimmed-pair1.fastq, SRR9321776-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 14:15:41 2025 >> started Wed Feb 12 14:16:03 2025 >> done (21.990s) 26738198 read pairs processed; of these: 3902 ( 0.01%) short read pairs filtered out after trimming by size control 9698 ( 0.04%) empty read pairs filtered out after trimming by size control 26724598 (99.95%) read pairs available; of these: 13607 ( 0.05%) trimmed read pairs available after processing 26710991 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 4 0.00% 22 2 0.00% 23 0 0.00% 24 10 0.00% 25 4 0.00% 26 5 0.00% 27 12 0.00% 28 16 0.00% 29 12 0.00% 30 10 0.00% 31 13 0.00% 32 16 0.00% 33 14 0.00% 34 18 0.00% 35 147 0.00% 36 169 0.00% 37 197 0.00% 38 231 0.00% 39 220 0.00% 40 235 0.00% 41 271 0.00% 42 277 0.00% 43 324 0.00% 44 396 0.00% 45 355 0.00% 46 330 0.00% 47 382 0.00% 48 505 0.00% 49 521 0.00% 50 617 0.00% 51 707 0.00% 52 764 0.00% 53 785 0.00% 54 868 0.00% 55 1190 0.00% 56 1143 0.00% 57 1243 0.00% 58 1495 0.01% 59 2005 0.01% 60 2159 0.01% 61 2304 0.01% 62 2475 0.01% 63 2492 0.01% 64 2778 0.01% 65 3114 0.01% 66 3100 0.01% 67 3767 0.01% 68 3467 0.01% 69 3820 0.01% 70 4443 0.02% 71 6161 0.02% 72 20372 0.08% 73 233526 0.87% 74 2200771 8.24% 75 12893743 48.25% 76 11320592 42.36% 26724598 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=26 prefix-density=0.52 prefix-fanout=2.1 sequence=CTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=14.86 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=2.1 sequence=CGCATCGCCGGTAGAAGGGACGAGGCGACCGGTGCACACCTGAGGCGGACCGGCCGACCCAACCCAAAGTCCAACTACGAGCTTTTTAACTGCAACAACTTAAATATACGCTATTGGAGCTGGAATTACCGCGGCTGCTGGCACCAGACTTGCCCTCCAATGGATCCTCGTTAAGGGATTTAGATTGTACTCATTCCAATTACCAGACTCGAAGAGCCCGGTATTGTTATTTATTGTCACTACCTCCCCGTGTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTAATTCTCCGTCACCCGTCACCACCATGGTAGGCCTCTATCCTACCATCGAAAGTTGATAGGGCAGAAATTTGAATGATGCGTCGCCAGCACGAAGGCCGTGCGATCCGTCGAGTTATCATGAATCATCAGAGCAACGGGCAGAGCCCGCGTCGACCTTTTATCTAATAAATGCGTC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=33 prefix-density=0.29 prefix-fanout=2.0 sequence=GAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGTCCCTAGCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=15.43 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.9 sequence=AGGAAAGGCTTACGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGTAAGCGACGAAATGCTTCGGGGAGTTGAAAATAAGCGTAGATCCGGAGATTCCCGAATAGGTCAACCTTTCAAACTGCTGCCGAATCCATGGGCAGGCAAGAGACAACCTGGCGAACTGAAACATCTTAGTAACCAGAGGAAAAGAA SRR9321776 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 14:16:31 Started mapping on | Feb 12 14:16:31 Finished on | Feb 12 14:18:02 Mapping speed, Million of reads per hour | 1057.24 Number of input reads | 26724598 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 22744817 Uniquely mapped reads % | 85.11% Average mapped length | 150.42 Number of splices: Total | 10000168 Number of splices: Annotated (sjdb) | 9887941 Number of splices: GT/AG | 9819340 Number of splices: GC/AG | 153410 Number of splices: AT/AC | 7200 Number of splices: Non-canonical | 20218 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.02% Deletion average length | 2.16 Insertion rate per base | 0.01% Insertion average length | 1.93 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1093773 % of reads mapped to multiple loci | 4.09% Number of reads mapped to too many loci | 1681740 % of reads mapped to too many loci | 6.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.30% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2886358 2886358 2886358 N_multimapping 1093773 1093773 1093773 N_noFeature 623616 22458495 709950 N_ambiguous 335962 1312 134939 UnstrandedReadsAssigned:21785239 PositiveStrandReadsAssigned:285010 NegativeStrandReadsAssigned:21899928 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9321776 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9321776-trimmed-pair1.fastq SRR9321776-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,724,598 reads, 23,749,234 reads pseudoaligned [quant] estimated average fragment length: 196.045 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,293 rounds 52401 SRR9321776.ke.tsv 34699 SRR9321776.se.tsv 87100 total ==> SRR9321776.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1822.95 350 6.61552 Potri.005G024800.1.v4.1 1035 839.955 166 6.80963 Potri.004G059700.1.v4.1 961 765.959 56 2.51915 Potri.007G009000.2.v4.1 1416 1220.95 0 0 Potri.003G141000.2.v4.1 2943 2747.95 335 4.20056 Potri.016G087400.1.v4.1 270 90.5384 1761.73 670.468 Potri.015G069301.1.v4.1 564 369.083 0 0 Potri.010G195200.1.v4.1 1773 1577.95 5 0.109181 Potri.012G127500.1.v4.1 977 781.959 8060 355.159 ==> SRR9321776.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 20 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 356 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 76 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 14 SRR9321776 completed mapping pipeline successfully