Starting /dee2/code/volunteer_pipeline.sh SRR9321777 current disk space = 3051646775296 free memory = 1581618828 SRR9321777 SRAfilesize 82c47c1d0600d24d49fe9b1e45ced49f SRR9321777.sra SRR9321777.sra file validated SRR9321777 is paired end SRR9321777 is conventional basespace SRR9321777 read1 length is 43-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9321777_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 43-76 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.63825 32.0 32.0 32.0 32.0 32.0 2 31.58575 32.0 32.0 32.0 32.0 32.0 3 31.58225 32.0 32.0 32.0 32.0 32.0 4 31.67625 32.0 32.0 32.0 32.0 32.0 5 31.66975 32.0 32.0 32.0 32.0 32.0 6 35.01375 36.0 36.0 36.0 36.0 36.0 7 35.39875 36.0 36.0 36.0 36.0 36.0 8 35.35175 36.0 36.0 36.0 36.0 36.0 9 35.3995 36.0 36.0 36.0 36.0 36.0 10-11 35.317875 36.0 36.0 36.0 36.0 36.0 12-13 35.308125000000004 36.0 36.0 36.0 36.0 36.0 14-15 35.257374999999996 36.0 36.0 36.0 36.0 36.0 16-17 35.33325 36.0 36.0 36.0 36.0 36.0 18-19 35.277875 36.0 36.0 36.0 36.0 36.0 20-21 35.286 36.0 36.0 36.0 36.0 36.0 22-23 35.238 36.0 36.0 36.0 36.0 36.0 24-25 35.25425 36.0 36.0 36.0 36.0 36.0 26-27 35.213375 36.0 36.0 36.0 36.0 36.0 28-29 35.1635 36.0 36.0 36.0 36.0 36.0 30-31 35.11625 36.0 36.0 36.0 36.0 36.0 32-33 35.184625 36.0 36.0 36.0 36.0 36.0 34-35 35.088375 36.0 36.0 36.0 36.0 36.0 36-37 35.123374999999996 36.0 36.0 36.0 36.0 36.0 38-39 35.150125 36.0 36.0 36.0 36.0 36.0 40-41 35.083625 36.0 36.0 36.0 36.0 36.0 42-43 35.094125 36.0 36.0 36.0 36.0 36.0 44-45 35.15328832208052 36.0 36.0 36.0 36.0 36.0 46-47 34.99549887471868 36.0 36.0 36.0 36.0 36.0 48-49 34.94823705926481 36.0 36.0 36.0 36.0 36.0 50-51 35.143285821455365 36.0 36.0 36.0 36.0 36.0 52-53 35.03313328332083 36.0 36.0 36.0 36.0 36.0 54-55 35.03425856464116 36.0 36.0 36.0 36.0 36.0 56-57 34.9057264316079 36.0 36.0 36.0 36.0 36.0 58-59 34.85921480370092 36.0 36.0 36.0 34.0 36.0 60-61 34.88359589897475 36.0 36.0 36.0 36.0 36.0 62-63 34.89532266133067 36.0 36.0 36.0 34.0 36.0 64-65 34.8835667833917 36.0 36.0 36.0 36.0 36.0 66-67 34.833916958479236 36.0 36.0 36.0 34.0 36.0 68-69 34.86593296648324 36.0 36.0 36.0 34.0 36.0 70-71 34.791060543906426 36.0 36.0 36.0 32.0 36.0 72-73 34.66569638269236 36.0 36.0 36.0 32.0 36.0 74-75 34.677259005960096 36.0 36.0 36.0 32.0 36.0 76 34.082086689681624 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 6.0 25 10.0 26 17.0 27 15.0 28 22.0 29 58.0 30 70.0 31 107.0 32 122.0 33 186.0 34 429.0 35 2957.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.949999999999996 11.425 9.525 43.1 2 21.575 15.275 38.35 24.8 3 18.05 19.650000000000002 25.474999999999998 36.825 4 22.55 28.249999999999996 21.85 27.35 5 24.075 32.300000000000004 22.5 21.125 6 19.75836899068714 34.15554996224516 25.597785049081303 20.48829599798641 7 15.55 23.799999999999997 40.325 20.325 8 18.375 24.349999999999998 31.05 26.224999999999998 9 18.8 22.3 33.675 25.224999999999998 10-11 23.0625 30.7625 21.9625 24.212500000000002 12-13 21.0 23.6375 29.2 26.1625 14-15 21.0125 25.2375 28.0625 25.687500000000004 16-17 21.3875 26.4125 26.974999999999998 25.224999999999998 18-19 22.0125 26.087500000000002 26.525 25.374999999999996 20-21 22.075 26.4625 27.400000000000002 24.0625 22-23 21.8875 26.55 26.3625 25.2 24-25 21.275 27.2625 25.8625 25.6 26-27 20.8625 27.3125 25.7875 26.0375 28-29 21.5625 26.9625 26.2625 25.2125 30-31 20.825 26.650000000000002 26.3625 26.1625 32-33 21.512500000000003 26.05 26.8625 25.575 34-35 22.1875 25.95 26.474999999999998 25.387500000000003 36-37 21.4125 26.737499999999997 25.924999999999997 25.924999999999997 38-39 21.45 26.3625 26.825 25.362499999999997 40-41 22.075 26.075 25.8 26.05 42-43 21.349999999999998 28.249999999999996 26.6125 23.7875 44-45 22.268067016754188 25.893973493373345 26.91922980745186 24.918729682420604 46-47 21.6929232308077 26.59414853713428 27.169292323080768 24.543635908977244 48-49 22.093023255813954 26.331582895723933 26.069017254313575 25.506376594148538 50-51 20.31757939484871 27.181795448862218 27.106776694173547 25.393848462115532 52-53 21.142785696424106 26.219054763690924 28.00700175043761 24.63115778944736 54-55 21.417854463615903 26.756689172293076 26.78169542385596 25.04376094023506 56-57 21.180295073768445 25.806451612903224 26.91922980745186 26.094023505876468 58-59 21.66791697924481 26.206551637909474 26.619154788697173 25.506376594148538 60-61 21.31782945736434 26.906726681670417 26.744186046511626 25.03125781445361 62-63 21.83591795897949 26.225612806403202 26.350675337668832 25.587793896948476 64-65 20.785392696348172 26.050525262631314 27.55127563781891 25.6128064032016 66-67 21.14807403701851 26.613306653326664 26.92596298149075 25.312656328164078 68-69 20.885442721360683 26.550775387693847 27.03851925962982 25.52526263131566 70-71 20.580507944451394 27.27386463155261 27.524083573126486 24.62154385086951 72-73 21.135250533718448 26.045460253673237 26.69848047218385 26.12080874042446 74-75 21.028844875714476 24.27223182241127 27.847933005449953 26.8509902964243 76 22.669735327963174 0.0 41.158419639432296 36.17184503260453 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 2.0 20 2.5 21 1.0 22 1.0 23 3.0 24 6.5 25 8.5 26 11.0 27 12.5 28 10.5 29 13.0 30 21.5 31 30.5 32 40.0 33 48.5 34 55.5 35 71.5 36 92.0 37 107.0 38 117.5 39 136.5 40 169.0 41 210.0 42 233.5 43 237.5 44 246.5 45 264.0 46 280.5 47 294.5 48 297.5 49 283.5 50 275.0 51 246.5 52 210.0 53 190.5 54 178.5 55 163.0 56 140.5 57 120.0 58 112.5 59 107.5 60 89.5 61 55.0 62 27.0 63 20.0 64 11.5 65 11.5 66 12.5 67 7.5 68 4.5 69 3.5 70 2.5 71 2.5 72 4.5 73 3.5 74 2.0 75 3.5 76 2.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.675 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 43 1.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 1.0 70 1.0 71 4.0 72 21.0 73 72.0 74 275.0 75 1017.0 76 2607.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.69999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.93453009503696 90.85 2 3.062302006335797 5.800000000000001 3 0.6863780359028511 1.95 4 0.2375923970432946 0.8999999999999999 5 0.026399155227032733 0.125 6 0.0 0.0 7 0.026399155227032733 0.17500000000000002 8 0.026399155227032733 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACT 8 0.2 No Hit CCCAGGCAGACGTGCCCTCGACCAAGAGGCCTCGGGCGCAACTTGCGTTC 7 0.17500000000000002 No Hit GTTGAAGACCAACAATTGCAATGATCTATCCCCATCACGATGAAATTTCAAAGATTACCCGGGCCTGTCGGCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9321777 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9321777_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.33575 32.0 32.0 32.0 32.0 32.0 2 31.17675 32.0 32.0 32.0 32.0 32.0 3 31.167 32.0 32.0 32.0 32.0 32.0 4 31.222 32.0 32.0 32.0 32.0 32.0 5 31.18675 32.0 32.0 32.0 32.0 32.0 6 34.6305 36.0 36.0 36.0 32.0 36.0 7 34.83575 36.0 36.0 36.0 36.0 36.0 8 34.71 36.0 36.0 36.0 32.0 36.0 9 34.69 36.0 36.0 36.0 32.0 36.0 10-11 34.641375 36.0 36.0 36.0 32.0 36.0 12-13 34.656625 36.0 36.0 36.0 32.0 36.0 14-15 34.59775 36.0 36.0 36.0 32.0 36.0 16-17 34.581875 36.0 36.0 36.0 32.0 36.0 18-19 34.59425 36.0 36.0 36.0 32.0 36.0 20-21 34.565 36.0 36.0 36.0 32.0 36.0 22-23 34.489374999999995 36.0 36.0 36.0 32.0 36.0 24-25 34.459 36.0 36.0 36.0 32.0 36.0 26-27 34.48825 36.0 36.0 36.0 32.0 36.0 28-29 34.54375 36.0 36.0 36.0 32.0 36.0 30-31 34.400875 36.0 36.0 36.0 32.0 36.0 32-33 34.35025 36.0 36.0 36.0 32.0 36.0 34-35 34.360125 36.0 36.0 36.0 32.0 36.0 36-37 34.439609902475624 36.0 36.0 36.0 32.0 36.0 38-39 34.29119779944986 36.0 36.0 36.0 32.0 36.0 40-41 34.35046261565391 36.0 36.0 36.0 32.0 36.0 42-43 34.30520130032508 36.0 36.0 36.0 32.0 36.0 44-45 34.10905452726364 36.0 36.0 36.0 32.0 36.0 46-47 34.07178589294648 36.0 36.0 36.0 32.0 36.0 48-49 34.201975987994 36.0 36.0 36.0 32.0 36.0 50-51 34.04789894947474 36.0 36.0 36.0 32.0 36.0 52-53 33.9723611805903 36.0 36.0 36.0 32.0 36.0 54-55 33.90620310155077 36.0 36.0 36.0 32.0 36.0 56-57 33.98349174587294 36.0 36.0 36.0 32.0 36.0 58-59 33.905692056686334 36.0 36.0 36.0 32.0 36.0 60-61 34.10007505629222 36.0 36.0 36.0 32.0 36.0 62-63 33.84321821821822 36.0 36.0 36.0 32.0 36.0 64-65 33.742452746864515 36.0 36.0 36.0 29.5 36.0 66-67 33.746517210108024 36.0 36.0 36.0 27.0 36.0 68-69 33.60615923885828 36.0 36.0 36.0 27.0 36.0 70-71 33.732724086129195 36.0 36.0 36.0 27.0 36.0 72-73 33.64672306494973 36.0 36.0 36.0 27.0 36.0 74-75 33.538076766379405 36.0 36.0 36.0 27.0 36.0 76 32.88555133079848 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 7.0 16 8.0 17 4.0 18 10.0 19 4.0 20 11.0 21 9.0 22 10.0 23 10.0 24 11.0 25 26.0 26 46.0 27 33.0 28 57.0 29 90.0 30 113.0 31 135.0 32 180.0 33 287.0 34 620.0 35 2326.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.0 19.7 13.775 29.525000000000002 2 28.65 25.575 31.3 14.475 3 23.799999999999997 25.2 28.425 22.575 4 25.474999999999998 32.75 21.05 20.724999999999998 5 27.825 35.949999999999996 19.85 16.375 6 23.575 37.425000000000004 20.349999999999998 18.65 7 22.075 18.175 36.925000000000004 22.825 8 24.55 22.650000000000002 26.75 26.05 9 23.861930965482742 23.736868434217108 27.888944472236116 24.512256128064035 10-11 26.450725362681343 30.202601300650322 21.623311655827916 21.72336168084042 12-13 25.77861163227017 24.42776735459662 26.00375234521576 23.78986866791745 14-15 25.028142589118197 26.816760475297063 25.8411507191995 22.31394621638524 16-17 25.737868934467233 26.713356678339167 26.075537768884445 21.473236618309155 18-19 25.42521260630315 26.075537768884445 26.138069034517258 22.36118059029515 20-21 26.088044022011005 26.138069034517258 25.887943971985994 21.885942971485743 22-23 24.9906191369606 26.25390869293308 25.878674171357098 22.87679799874922 24-25 25.175087543771884 26.988494247123562 25.775387693846923 22.061030515257627 26-27 25.71285642821411 27.163581790895446 25.87543771885943 21.248124062031014 28-29 25.250125062531264 27.75137568784392 24.96248124062031 22.0360180090045 30-31 25.68784392196098 27.176088044022013 25.475237618809405 21.660830415207606 32-33 24.487243621810904 28.489244622311155 25.700350175087543 21.323161580790394 34-35 26.113056528264135 26.43821910955478 25.71285642821411 21.735867933966986 36-37 25.369026770077557 27.220415311483613 25.431573680260193 21.978984238178633 38-39 25.91943957968476 27.595696772579437 25.39404553415061 21.09081811358519 40-41 25.88838838838839 27.264764764764767 25.225225225225223 21.62162162162162 42-43 25.856892669502123 27.195396547410557 25.156367275456592 21.79134350763072 44-45 25.38788788788789 27.114614614614613 25.275275275275277 22.22222222222222 46-47 25.012512512512515 27.790290290290294 25.375375375375377 21.82182182182182 48-49 25.728945063196097 27.08046552371418 25.82905768990114 21.361531723188588 50-51 26.408010012515643 26.858573216520647 25.544430538172712 21.188986232790988 52-53 26.070087609511887 27.008760951188986 26.207759699624532 20.713391739674595 54-55 25.281602002503128 27.42177722152691 26.057571964956196 21.239048811013767 56-57 26.570713391739677 26.758448060075096 26.520650813516895 20.150187734668336 58-59 26.57403930404306 26.398798347728125 25.77293778946051 21.254224558768307 60-61 25.7386079118678 26.627441161742617 26.239359038557836 21.394591887831748 62-63 26.145755071374904 26.321061858251944 25.895316804407713 21.63786626596544 64-65 26.38697557921102 26.687539135879774 25.98622417031935 20.939261114589854 66-67 25.67956908430415 27.495928848803707 25.491669798321432 21.332832268570712 68-69 26.07116011024806 26.45953395139063 24.818341267852666 22.650964670508642 70-71 25.870709095464793 26.710097719869708 25.0814332247557 22.337759959909796 72-73 25.730110775427995 28.159617321248742 24.609768378650553 21.50050352467271 74-75 25.30508247284431 24.406597827544587 26.94112914040499 23.347190559206116 76 29.881994670727064 0.0 36.353254663113816 33.76475066615912 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.5 23 1.0 24 0.5 25 2.5 26 5.0 27 7.0 28 9.5 29 12.0 30 15.5 31 23.5 32 35.0 33 43.0 34 48.5 35 68.0 36 96.5 37 109.5 38 124.5 39 155.0 40 181.0 41 214.5 42 247.5 43 266.5 44 272.0 45 281.0 46 294.0 47 300.5 48 289.5 49 273.0 50 258.5 51 214.0 52 182.0 53 173.0 54 162.5 55 158.0 56 142.0 57 103.0 58 76.5 59 65.5 60 69.5 61 66.0 62 50.5 63 31.5 64 17.0 65 20.5 66 12.0 67 5.0 68 6.0 69 7.0 70 7.0 71 7.0 72 6.5 73 5.5 74 4.0 75 2.0 76 1.5 77 1.0 78 0.5 79 1.0 80 1.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 1.0 95 1.5 96 1.0 97 1.0 98 0.5 99 15.0 100 30.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.05 10-11 0.05 12-13 0.0625 14-15 0.0625 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.0625 24-25 0.05 26-27 0.05 28-29 0.05 30-31 0.05 32-33 0.05 34-35 0.05 36-37 0.05001250312578145 38-39 0.05001250312578145 40-41 0.07501875468867217 42-43 0.05001250312578145 44-45 0.05002501250625312 46-47 0.05002501250625312 48-49 0.06253126563281641 50-51 0.0750375187593797 52-53 0.0750375187593797 54-55 0.0750375187593797 56-57 0.0750375187593797 58-59 0.075046904315197 60-61 0.07505629221916438 62-63 0.07507507507507508 64-65 0.07508447002878238 66-67 0.07510326699211416 68-69 0.07511266900350526 70-71 0.07511266900350526 72-73 0.07547169811320754 74-75 0.08039662334181964 76 0.11406844106463879 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 1.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 1.0 65 0.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 7.0 72 24.0 73 84.0 74 295.0 75 954.0 76 2630.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 96.69117647058823 92.05 2 2.7573529411764706 5.25 3 0.34138655462184875 0.975 4 0.07878151260504201 0.3 5 0.026260504201680673 0.125 6 0.026260504201680673 0.15 7 0.026260504201680673 0.17500000000000002 8 0.026260504201680673 0.2 9 0.0 0.0 >10 0.026260504201680673 0.775 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 31 0.775 No Hit GTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTCG 8 0.2 No Hit CTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGGAA 7 0.17500000000000002 No Hit GTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTAATCCAACCTAGTACGAGAGGAACCGTTGATTCGCACA 6 0.15 No Hit CGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1270617 spots for SRR9321777.sra Written 1270617 spots for SRR9321777.sra Read 1270617 spots for SRR9321777.sra Written 1270617 spots for SRR9321777.sra Read 1270617 spots for SRR9321777.sra Written 1270617 spots for SRR9321777.sra Read 1270617 spots for SRR9321777.sra Written 1270617 spots for SRR9321777.sra Read 1270617 spots for SRR9321777.sra Written 1270617 spots for SRR9321777.sra Read 1270617 spots for SRR9321777.sra Written 1270617 spots for SRR9321777.sra Read 1270617 spots for SRR9321777.sra Written 1270617 spots for SRR9321777.sra Read 1270617 spots for SRR9321777.sra Written 1270617 spots for SRR9321777.sra Read 1270617 spots for SRR9321777.sra Written 1270617 spots for SRR9321777.sra Read 1270617 spots for SRR9321777.sra Written 1270617 spots for SRR9321777.sra Read 1270617 spots for SRR9321777.sra Written 1270617 spots for SRR9321777.sra Read 1270617 spots for SRR9321777.sra Written 1270617 spots for SRR9321777.sra Read 1270617 spots for SRR9321777.sra Written 1270617 spots for SRR9321777.sra Read 1270617 spots for SRR9321777.sra Written 1270617 spots for SRR9321777.sra Read 1270633 spots for SRR9321777.sra Written 1270633 spots for SRR9321777.sra Read 1270617 spots for SRR9321777.sra Written 1270617 spots for SRR9321777.sra Read 1270617 spots for SRR9321777.sra Written 1270617 spots for SRR9321777.sra Read 1270617 spots for SRR9321777.sra Written 1270617 spots for SRR9321777.sra Read 1270617 spots for SRR9321777.sra Written 1270617 spots for SRR9321777.sra Read 1270617 spots for SRR9321777.sra Written 1270617 spots for SRR9321777.sra SRR ids: ['SRR9321777.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nammhpev SRR9321777.sra spots: 25412356 blocks: [[1, 1270617], [1270618, 2541234], [2541235, 3811851], [3811852, 5082468], [5082469, 6353085], [6353086, 7623702], [7623703, 8894319], [8894320, 10164936], [10164937, 11435553], [11435554, 12706170], [12706171, 13976787], [13976788, 15247404], [15247405, 16518021], [16518022, 17788638], [17788639, 19059255], [19059256, 20329872], [20329873, 21600489], [21600490, 22871106], [22871107, 24141723], [24141724, 25412356]] SRR9321777 file size 4818732 SRR9321777 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9321777 SRR9321777_1.fastq SRR9321777_2.fastq Input file: SRR9321777_1.fastq Paired file: SRR9321777_2.fastq trimmed: SRR9321777-trimmed-pair1.fastq, SRR9321777-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 14:28:06 2025 >> started Wed Feb 12 14:28:27 2025 >> done (21.253s) 25412356 read pairs processed; of these: 3685 ( 0.01%) short read pairs filtered out after trimming by size control 8712 ( 0.03%) empty read pairs filtered out after trimming by size control 25399959 (99.95%) read pairs available; of these: 12403 ( 0.05%) trimmed read pairs available after processing 25387556 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 4 0.00% 23 5 0.00% 24 7 0.00% 25 6 0.00% 26 11 0.00% 27 7 0.00% 28 13 0.00% 29 16 0.00% 30 13 0.00% 31 12 0.00% 32 17 0.00% 33 8 0.00% 34 15 0.00% 35 147 0.00% 36 149 0.00% 37 150 0.00% 38 151 0.00% 39 197 0.00% 40 168 0.00% 41 220 0.00% 42 245 0.00% 43 297 0.00% 44 278 0.00% 45 274 0.00% 46 235 0.00% 47 307 0.00% 48 333 0.00% 49 394 0.00% 50 400 0.00% 51 447 0.00% 52 472 0.00% 53 575 0.00% 54 525 0.00% 55 796 0.00% 56 826 0.00% 57 905 0.00% 58 1064 0.00% 59 1314 0.01% 60 1718 0.01% 61 1635 0.01% 62 1661 0.01% 63 1775 0.01% 64 1909 0.01% 65 2257 0.01% 66 2216 0.01% 67 2623 0.01% 68 2277 0.01% 69 2344 0.01% 70 3082 0.01% 71 5084 0.02% 72 17005 0.07% 73 205749 0.81% 74 2011854 7.92% 75 12090413 47.60% 76 11035353 43.45% 25399959 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=33 prefix-density=0.54 prefix-fanout=1.9 sequence=CCGTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCAGAACCCAAAAACTTTGATTTCTCATAAGGTGCTGGCGGAGTCCTAAAAGCAACATCCGCCAATCCCTGGTCGGCATCGTTTATGGTTGAGACTAGGACGGTATCTGATCGTCTTCGAGCCCCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCAAATGCTTTCGCAGTTGTTCGTCTTTCATAAATCCAAGAATTTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAAGGCCAGGAGCGCATCGCCG criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=19.74 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=1.1 sequence=ATGCCTCAGCTGCATACATCACTGCACTTCCACTTGACACCTATCGTAATGATAAACGGCTCGTCTCGCCGTGACCTTCTCTTGAATTCTCAAAACTTCTGTCGCTCCATCCCCGCAGGGGCAGAGAACCCGTCGCTGTCTCGGCTGTGCTACCGGAGGCTCTGGGGAAGTCGGAATAGGAGAGCACTCATCTTGGGGTGGGCTTACTACTTAGATGCTTTCAGCAGTTATCCGCTCCGCACTTGGCTACCCAGCGTTTACCGTGGGCACAATAACTGGTACACCAGAGGTGCGTCCTTCCCGGTCCTCTCGTAC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=28 prefix-density=0.25 prefix-fanout=2.2 sequence=CAAGGCTAAATAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=27.31 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.2 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR9321777 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 14:28:57 Started mapping on | Feb 12 14:28:58 Finished on | Feb 12 14:30:48 Mapping speed, Million of reads per hour | 831.27 Number of input reads | 25399959 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 19639613 Uniquely mapped reads % | 77.32% Average mapped length | 150.39 Number of splices: Total | 8291417 Number of splices: Annotated (sjdb) | 8201483 Number of splices: GT/AG | 8138097 Number of splices: GC/AG | 130436 Number of splices: AT/AC | 6110 Number of splices: Non-canonical | 16774 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.02% Deletion average length | 2.17 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1201634 % of reads mapped to multiple loci | 4.73% Number of reads mapped to too many loci | 3556218 % of reads mapped to too many loci | 14.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.48% % of reads unmapped: other | 0.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4558986 4558986 4558986 N_multimapping 1201634 1201634 1201634 N_noFeature 1320890 19309043 1401501 N_ambiguous 365263 1958 113565 UnstrandedReadsAssigned:17953460 PositiveStrandReadsAssigned:328612 NegativeStrandReadsAssigned:18124547 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9321777 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9321777-trimmed-pair1.fastq SRR9321777-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,399,959 reads, 21,021,308 reads pseudoaligned [quant] estimated average fragment length: 206.208 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52401 SRR9321777.ke.tsv 34699 SRR9321777.se.tsv 87100 total ==> SRR9321777.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1812.79 295 5.5013 Potri.005G024800.1.v4.1 1035 829.792 109 4.44067 Potri.004G059700.1.v4.1 961 755.792 46 2.05753 Potri.007G009000.2.v4.1 1416 1210.79 0 0 Potri.003G141000.2.v4.1 2943 2737.79 219 2.70417 Potri.016G087400.1.v4.1 270 83.7808 1414.26 570.657 Potri.015G069301.1.v4.1 564 358.926 0 0 Potri.010G195200.1.v4.1 1773 1567.79 2 0.0431253 Potri.012G127500.1.v4.1 977 771.792 4828 211.475 ==> SRR9321777.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 23 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 270 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 36 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 10 SRR9321777 completed mapping pipeline successfully