Starting /dee2/code/volunteer_pipeline.sh SRR9321778 current disk space = 3051180142592 free memory = 1494954164 SRR9321778 SRAfilesize 6bbedd9164ff5f20a68d3c2526533892 SRR9321778.sra SRR9321778.sra file validated SRR9321778 is paired end SRR9321778 is conventional basespace SRR9321778 read1 length is 37-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9321778_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 37-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.572 32.0 32.0 32.0 32.0 32.0 2 31.57675 32.0 32.0 32.0 32.0 32.0 3 31.6205 32.0 32.0 32.0 32.0 32.0 4 31.691 32.0 32.0 32.0 32.0 32.0 5 31.6865 32.0 32.0 32.0 32.0 32.0 6 34.9515 36.0 36.0 36.0 36.0 36.0 7 35.37175 36.0 36.0 36.0 36.0 36.0 8 35.3255 36.0 36.0 36.0 36.0 36.0 9 35.3375 36.0 36.0 36.0 36.0 36.0 10-11 35.300749999999994 36.0 36.0 36.0 36.0 36.0 12-13 35.367875 36.0 36.0 36.0 36.0 36.0 14-15 35.386 36.0 36.0 36.0 36.0 36.0 16-17 35.3555 36.0 36.0 36.0 36.0 36.0 18-19 35.347875 36.0 36.0 36.0 36.0 36.0 20-21 35.332375 36.0 36.0 36.0 36.0 36.0 22-23 35.35075 36.0 36.0 36.0 36.0 36.0 24-25 35.288125 36.0 36.0 36.0 36.0 36.0 26-27 35.242 36.0 36.0 36.0 36.0 36.0 28-29 35.2145 36.0 36.0 36.0 36.0 36.0 30-31 35.2965 36.0 36.0 36.0 36.0 36.0 32-33 35.271249999999995 36.0 36.0 36.0 36.0 36.0 34-35 35.183875 36.0 36.0 36.0 36.0 36.0 36-37 35.191874999999996 36.0 36.0 36.0 36.0 36.0 38-39 35.2033008252063 36.0 36.0 36.0 36.0 36.0 40-41 35.173043260815206 36.0 36.0 36.0 36.0 36.0 42-43 35.1609152288072 36.0 36.0 36.0 36.0 36.0 44-45 35.13740935233808 36.0 36.0 36.0 36.0 36.0 46-47 35.146036509127285 36.0 36.0 36.0 36.0 36.0 48-49 35.01412853213303 36.0 36.0 36.0 36.0 36.0 50-51 35.14928732183046 36.0 36.0 36.0 36.0 36.0 52-53 35.17593589868203 36.0 36.0 36.0 36.0 36.0 54-55 35.054902451225615 36.0 36.0 36.0 36.0 36.0 56-57 34.95558396149464 36.0 36.0 36.0 36.0 36.0 58-59 34.911911911911915 36.0 36.0 36.0 34.0 36.0 60-61 34.98235886073809 36.0 36.0 36.0 36.0 36.0 62-63 34.9468085106383 36.0 36.0 36.0 34.0 36.0 64-65 34.97070605908863 36.0 36.0 36.0 36.0 36.0 66-67 35.04783120084585 36.0 36.0 36.0 36.0 36.0 68-69 35.01852766389277 36.0 36.0 36.0 36.0 36.0 70-71 34.82926978989299 36.0 36.0 36.0 32.0 36.0 72-73 34.815705993434975 36.0 36.0 36.0 32.0 36.0 74-75 34.73084467847949 36.0 36.0 36.0 32.0 36.0 76 34.25940138142747 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 5.0 25 4.0 26 18.0 27 17.0 28 33.0 29 46.0 30 52.0 31 89.0 32 119.0 33 167.0 34 442.0 35 3006.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.75 13.125 10.65 35.475 2 20.875 16.425 37.574999999999996 25.124999999999996 3 18.725 20.95 26.700000000000003 33.625 4 23.599999999999998 29.349999999999998 22.2 24.85 5 21.3 35.125 23.525 20.05 6 19.640597317134905 34.80131612250063 25.816249050873196 19.741837509491265 7 15.475 24.525 42.625 17.375 8 18.55 22.925 31.025000000000002 27.500000000000004 9 16.675 24.275 33.1 25.95 10-11 21.212500000000002 32.9875 22.875 22.925 12-13 20.962500000000002 25.337500000000002 28.65 25.05 14-15 20.7 26.5125 28.487499999999997 24.3 16-17 21.05 27.425 27.6125 23.9125 18-19 20.825 28.175 26.875 24.125 20-21 21.1375 27.212500000000002 27.700000000000003 23.95 22-23 21.05 28.599999999999998 26.687499999999996 23.6625 24-25 20.150000000000002 28.425 27.525 23.9 26-27 21.099999999999998 27.5875 27.750000000000004 23.5625 28-29 20.6375 27.800000000000004 26.387500000000003 25.174999999999997 30-31 20.3625 28.1625 27.237499999999997 24.2375 32-33 20.9875 27.0125 27.275 24.725 34-35 21.375 27.425 27.187499999999996 24.0125 36-37 20.1125 28.299999999999997 28.000000000000004 23.5875 38-39 21.21780445111278 27.44436109027257 26.569142285571395 24.76869217304326 40-41 21.205301325331334 29.232308077019255 26.494123530882717 23.068267066766694 42-43 21.29282320580145 28.157039259814955 27.106776694173547 23.443360840210055 44-45 20.417604401100277 27.969492373093274 27.344336084021002 24.268567141785446 46-47 21.405351337834457 27.569392348087025 26.669167291822955 24.356089022255563 48-49 20.64266066516629 27.7569392348087 26.906726681670417 24.69367341835459 50-51 20.830207551887973 27.35683920980245 27.894473618404604 23.918479619904975 52-53 20.78279354758034 28.210578967112664 27.747905464549206 23.258722020757787 54-55 21.285642821410704 28.526763381690845 27.43871935967984 22.748874437218607 56-57 21.418741398723885 27.348930314024773 27.699236832228202 23.533091455023143 58-59 21.07107107107107 27.965465465465467 26.43893893893894 24.524524524524523 60-61 21.236390939807283 27.856338380678263 26.066825178325615 24.84044550118884 62-63 21.68961201501877 27.396745932415516 27.584480600750936 23.329161451814766 64-65 21.695042563845767 27.391086629944915 26.952929394091136 23.960941412118178 66-67 21.12182296231376 27.845248528859397 26.818580192813325 24.214348316013524 68-69 20.76393237319975 28.2780212899186 27.100814026299314 23.85723231058234 70-71 21.220092696981084 28.422898659651757 26.957284228986595 23.39972441438056 72-73 21.220893643801134 27.765890497168026 27.174323473882943 23.838892385147894 74-75 20.159786950732357 24.460719041278296 29.82689747003995 25.552596537949402 76 21.75748273215656 0.0 40.368380660015355 37.87413660782809 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 2.0 23 5.0 24 6.5 25 4.0 26 7.5 27 14.5 28 18.0 29 19.5 30 25.0 31 37.5 32 54.5 33 64.5 34 69.0 35 89.5 36 126.0 37 148.0 38 157.5 39 181.0 40 214.5 41 241.5 42 254.0 43 267.0 44 293.5 45 309.0 46 319.5 47 313.5 48 302.5 49 282.5 50 244.5 51 214.0 52 190.5 53 154.5 54 121.0 55 109.0 56 101.5 57 87.5 58 70.5 59 53.5 60 31.0 61 22.0 62 17.0 63 10.5 64 5.0 65 3.5 66 3.5 67 4.0 68 2.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.225 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 37 1.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 1.0 53 0.0 54 0.0 55 1.0 56 1.0 57 0.0 58 0.0 59 0.0 60 1.0 61 0.0 62 0.0 63 1.0 64 0.0 65 0.0 66 1.0 67 0.0 68 1.0 69 0.0 70 1.0 71 6.0 72 25.0 73 73.0 74 264.0 75 1017.0 76 2606.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.125 #Duplication Level Percentage of deduplicated Percentage of total 1 98.47133757961784 96.625 2 1.2738853503184715 2.5 3 0.2038216560509554 0.6 4 0.025477707006369425 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025477707006369425 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9321778 read2 length is 37-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9321778_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 37-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3805 32.0 32.0 32.0 32.0 32.0 2 31.2685 32.0 32.0 32.0 32.0 32.0 3 31.165 32.0 32.0 32.0 32.0 32.0 4 31.209 32.0 32.0 32.0 32.0 32.0 5 31.28725 32.0 32.0 32.0 32.0 32.0 6 34.70525 36.0 36.0 36.0 32.0 36.0 7 34.72225 36.0 36.0 36.0 36.0 36.0 8 34.70875 36.0 36.0 36.0 32.0 36.0 9 34.7385 36.0 36.0 36.0 32.0 36.0 10-11 34.778625000000005 36.0 36.0 36.0 34.0 36.0 12-13 34.777 36.0 36.0 36.0 36.0 36.0 14-15 34.712 36.0 36.0 36.0 36.0 36.0 16-17 34.664500000000004 36.0 36.0 36.0 34.0 36.0 18-19 34.633250000000004 36.0 36.0 36.0 32.0 36.0 20-21 34.678125 36.0 36.0 36.0 32.0 36.0 22-23 34.595875 36.0 36.0 36.0 34.0 36.0 24-25 34.501000000000005 36.0 36.0 36.0 32.0 36.0 26-27 34.5625 36.0 36.0 36.0 32.0 36.0 28-29 34.641 36.0 36.0 36.0 32.0 36.0 30-31 34.547875 36.0 36.0 36.0 32.0 36.0 32-33 34.56575 36.0 36.0 36.0 32.0 36.0 34-35 34.601749999999996 36.0 36.0 36.0 32.0 36.0 36-37 34.468 36.0 36.0 36.0 32.0 36.0 38-39 34.37409352338084 36.0 36.0 36.0 32.0 36.0 40-41 34.37456228114057 36.0 36.0 36.0 32.0 36.0 42-43 34.454352176088044 36.0 36.0 36.0 32.0 36.0 44-45 34.34442221110555 36.0 36.0 36.0 32.0 36.0 46-47 34.17083541770886 36.0 36.0 36.0 32.0 36.0 48-49 34.343171585792895 36.0 36.0 36.0 32.0 36.0 50-51 34.191643732799605 36.0 36.0 36.0 32.0 36.0 52-53 34.129841281110984 36.0 36.0 36.0 32.0 36.0 54-55 34.12137137137137 36.0 36.0 36.0 32.0 36.0 56-57 34.003508234817815 36.0 36.0 36.0 32.0 36.0 58-59 34.064346519779676 36.0 36.0 36.0 32.0 36.0 60-61 34.10816964239247 36.0 36.0 36.0 32.0 36.0 62-63 34.00638617580766 36.0 36.0 36.0 32.0 36.0 64-65 33.88476953907816 36.0 36.0 36.0 29.5 36.0 66-67 33.80746324144154 36.0 36.0 36.0 29.5 36.0 68-69 33.908153589938266 36.0 36.0 36.0 32.0 36.0 70-71 33.9200300827275 36.0 36.0 36.0 32.0 36.0 72-73 33.80183704285926 36.0 36.0 36.0 27.0 36.0 74-75 33.78003030472095 36.0 36.0 36.0 27.0 36.0 76 33.11153994596681 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 3.0 15 6.0 16 12.0 17 10.0 18 9.0 19 8.0 20 8.0 21 8.0 22 7.0 23 14.0 24 15.0 25 26.0 26 29.0 27 37.0 28 53.0 29 73.0 30 96.0 31 123.0 32 140.0 33 250.0 34 553.0 35 2519.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.38434608652163 21.580395098774694 13.553388347086774 27.481870467616904 2 28.549999999999997 27.275 29.349999999999998 14.825 3 23.775 26.174999999999997 28.525 21.525 4 25.15 34.0 21.224999999999998 19.625 5 26.775 34.675 20.9 17.65 6 21.45 37.4 21.4 19.75 7 20.925 18.525 38.75 21.8 8 22.7 24.125 25.575 27.6 9 22.975 25.025 28.275 23.724999999999998 10-11 25.8 30.562499999999996 21.349999999999998 22.287499999999998 12-13 24.615576947118388 24.70308788598575 27.390923865483185 23.29041130141268 14-15 24.78429411029136 27.172689758659494 26.947605352007002 21.09541077904214 16-17 24.968742185546386 27.056764191047762 26.094023505876468 21.880470117529384 18-19 25.143785946486624 26.6816704176044 26.70667666916729 21.467866966741685 20-21 25.056264066016503 27.131782945736433 26.19404851212803 21.61790447611903 22-23 24.421658121795673 27.972989871201705 25.959734900587723 21.645617106414903 24-25 24.406101525381345 27.84446111527882 27.106776694173547 20.64266066516629 26-27 25.1937984496124 27.144286071517882 26.11902975743936 21.54288572143036 28-29 25.03125781445361 27.781945486371594 25.656414103525883 21.530382595648913 30-31 23.943485871467868 27.369342335583895 27.24431107776944 21.442860715178792 32-33 24.306076519129782 28.35708927231808 26.19404851212803 21.142785696424106 34-35 25.365670708838607 27.25340667583448 26.31578947368421 21.065133141642704 36-37 23.952994124265533 27.17839729966246 27.203400425053132 21.665208151018877 38-39 24.099549774887443 27.538769384692348 26.93846923461731 21.4232116058029 40-41 24.102564102564102 27.592245153220762 27.392120075046904 20.913070669168228 42-43 23.54927463731866 27.313656828414207 27.163581790895446 21.973486743371687 44-45 24.112056028014006 27.71385692846423 26.18809404702351 21.98599299649825 46-47 25.22511255627814 27.801400700350175 25.87543771885943 21.098049024512257 48-49 24.112056028014006 26.600800400200097 27.501250625312657 21.785892946473236 50-51 24.168126094570926 27.733299974981236 26.695021265949464 21.403552664498374 52-53 25.697485299637187 27.098711372450897 26.08532465907669 21.11847866883523 54-55 23.96146146146146 27.177177177177175 27.402402402402405 21.45895895895896 56-57 24.88421579672049 26.824383527350104 26.924521216672925 21.366879459256477 58-59 25.0250375563345 28.267401101652478 26.61492238357536 20.092638958437657 60-61 25.21597596093652 27.407036434205583 26.242644296982597 21.134343307875298 62-63 24.142248935637365 27.07237665915352 27.335336839469072 21.450037565740047 64-65 24.824649298597194 27.25450901803607 26.50300601202405 21.417835671342687 66-67 24.77765251158712 26.75685832393837 27.320556181886506 21.144932982588 68-69 24.85904022052374 27.51534895376519 26.600676606941487 21.024934218769577 70-71 25.542319749216304 27.28526645768025 25.818181818181817 21.354231974921632 72-73 24.571788413098236 28.299748110831235 26.322418136020154 20.806045340050378 74-75 24.641180415828305 24.305835010060363 27.96780684104628 23.085177733065056 76 27.556927827093787 0.0 40.216132767271326 32.226939405634894 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 1.5 17 2.0 18 1.5 19 1.0 20 0.5 21 0.5 22 1.5 23 1.5 24 1.5 25 1.0 26 3.5 27 8.0 28 12.5 29 17.0 30 23.5 31 31.5 32 42.0 33 53.0 34 59.0 35 65.5 36 84.0 37 112.5 38 149.5 39 172.5 40 202.0 41 247.5 42 274.0 43 288.5 44 298.0 45 317.0 46 324.5 47 328.5 48 326.5 49 297.5 50 270.0 51 233.5 52 193.0 53 150.5 54 122.0 55 110.5 56 88.5 57 72.5 58 64.5 59 51.5 60 35.0 61 23.5 62 16.5 63 12.5 64 7.5 65 4.5 66 3.5 67 2.5 68 3.0 69 2.5 70 2.0 71 3.5 72 2.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.5 83 1.0 84 1.5 85 1.0 86 0.0 87 0.0 88 1.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.5 98 2.0 99 15.5 100 28.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0125 14-15 0.0375 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.0375 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.0125 36-37 0.0125 38-39 0.025006251562890724 40-41 0.01250625312656328 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0376034093757834 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 37 1.0 38 0.0 39 1.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 1.0 50 0.0 51 0.0 52 1.0 53 0.0 54 0.0 55 1.0 56 1.0 57 0.0 58 0.0 59 0.0 60 1.0 61 0.0 62 0.0 63 1.0 64 0.0 65 0.0 66 1.0 67 0.0 68 1.0 69 1.0 70 0.0 71 10.0 72 18.0 73 88.0 74 291.0 75 991.0 76 2591.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.05 #Duplication Level Percentage of deduplicated Percentage of total 1 98.87812340642529 96.95 2 1.0198878123406425 2.0 3 0.05099439061703213 0.15 4 0.0 0.0 5 0.025497195308516064 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025497195308516064 0.775 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 31 0.775 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1402899 spots for SRR9321778.sra Written 1402899 spots for SRR9321778.sra Read 1402899 spots for SRR9321778.sra Written 1402899 spots for SRR9321778.sra Read 1402899 spots for SRR9321778.sra Written 1402899 spots for SRR9321778.sra Read 1402899 spots for SRR9321778.sra Written 1402899 spots for SRR9321778.sra Read 1402899 spots for SRR9321778.sra Written 1402899 spots for SRR9321778.sra Read 1402899 spots for SRR9321778.sra Written 1402899 spots for SRR9321778.sra Read 1402899 spots for SRR9321778.sra Written 1402899 spots for SRR9321778.sra Read 1402899 spots for SRR9321778.sra Written 1402899 spots for SRR9321778.sra Read 1402899 spots for SRR9321778.sra Written 1402899 spots for SRR9321778.sra Read 1402899 spots for SRR9321778.sra Written 1402899 spots for SRR9321778.sra Read 1402899 spots for SRR9321778.sra Written 1402899 spots for SRR9321778.sra Read 1402899 spots for SRR9321778.sra Written 1402899 spots for SRR9321778.sra Read 1402899 spots for SRR9321778.sra Written 1402899 spots for SRR9321778.sra Read 1402899 spots for SRR9321778.sra Written 1402899 spots for SRR9321778.sra Read 1402899 spots for SRR9321778.sra Written 1402899 spots for SRR9321778.sra Read 1402899 spots for SRR9321778.sra Written 1402899 spots for SRR9321778.sra Read 1402899 spots for SRR9321778.sra Written 1402899 spots for SRR9321778.sra Read 1402899 spots for SRR9321778.sra Written 1402899 spots for SRR9321778.sra Read 1402899 spots for SRR9321778.sra Written 1402899 spots for SRR9321778.sra Read 1402906 spots for SRR9321778.sra Written 1402906 spots for SRR9321778.sra SRR ids: ['SRR9321778.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sbyhbymn SRR9321778.sra spots: 28057987 blocks: [[1, 1402899], [1402900, 2805798], [2805799, 4208697], [4208698, 5611596], [5611597, 7014495], [7014496, 8417394], [8417395, 9820293], [9820294, 11223192], [11223193, 12626091], [12626092, 14028990], [14028991, 15431889], [15431890, 16834788], [16834789, 18237687], [18237688, 19640586], [19640587, 21043485], [21043486, 22446384], [22446385, 23849283], [23849284, 25252182], [25252183, 26655081], [26655082, 28057987]] SRR9321778 file size 5320895 SRR9321778 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9321778 SRR9321778_1.fastq SRR9321778_2.fastq Input file: SRR9321778_1.fastq Paired file: SRR9321778_2.fastq trimmed: SRR9321778-trimmed-pair1.fastq, SRR9321778-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 13:30:42 2025 >> started Wed Feb 12 13:31:08 2025 >> done (26.023s) 28057987 read pairs processed; of these: 4143 ( 0.01%) short read pairs filtered out after trimming by size control 10912 ( 0.04%) empty read pairs filtered out after trimming by size control 28042932 (99.95%) read pairs available; of these: 15085 ( 0.05%) trimmed read pairs available after processing 28027847 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 4 0.00% 22 11 0.00% 23 4 0.00% 24 12 0.00% 25 14 0.00% 26 16 0.00% 27 9 0.00% 28 17 0.00% 29 19 0.00% 30 16 0.00% 31 24 0.00% 32 16 0.00% 33 17 0.00% 34 19 0.00% 35 183 0.00% 36 181 0.00% 37 199 0.00% 38 237 0.00% 39 225 0.00% 40 241 0.00% 41 276 0.00% 42 294 0.00% 43 302 0.00% 44 353 0.00% 45 331 0.00% 46 291 0.00% 47 361 0.00% 48 510 0.00% 49 511 0.00% 50 567 0.00% 51 637 0.00% 52 653 0.00% 53 802 0.00% 54 762 0.00% 55 1075 0.00% 56 1218 0.00% 57 1269 0.00% 58 1485 0.01% 59 2019 0.01% 60 2288 0.01% 61 2440 0.01% 62 2565 0.01% 63 2631 0.01% 64 3019 0.01% 65 3368 0.01% 66 3369 0.01% 67 3931 0.01% 68 3890 0.01% 69 4291 0.02% 70 5081 0.02% 71 6709 0.02% 72 22359 0.08% 73 253025 0.90% 74 2347218 8.37% 75 13638479 48.63% 76 11723087 41.80% 28042932 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=28 prefix-density=0.74 prefix-fanout=2.1 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=38.60 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=7.3 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCA criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=32 prefix-density=0.41 prefix-fanout=2.0 sequence=GAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGTCCCTAGCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=12.33 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.3 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR9321778 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 13:31:34 Started mapping on | Feb 12 13:31:34 Finished on | Feb 12 13:32:46 Mapping speed, Million of reads per hour | 1402.15 Number of input reads | 28042932 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 24974355 Uniquely mapped reads % | 89.06% Average mapped length | 150.44 Number of splices: Total | 11126610 Number of splices: Annotated (sjdb) | 11006757 Number of splices: GT/AG | 10919008 Number of splices: GC/AG | 178075 Number of splices: AT/AC | 7221 Number of splices: Non-canonical | 22306 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.01% Insertion average length | 1.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1094480 % of reads mapped to multiple loci | 3.90% Number of reads mapped to too many loci | 387873 % of reads mapped to too many loci | 1.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.61% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1974443 1974443 1974443 N_multimapping 1094480 1094480 1094480 N_noFeature 385220 24675301 481197 N_ambiguous 360199 953 156448 UnstrandedReadsAssigned:24228936 PositiveStrandReadsAssigned:298101 NegativeStrandReadsAssigned:24336710 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9321778 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9321778-trimmed-pair1.fastq SRR9321778-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,042,932 reads, 25,461,704 reads pseudoaligned [quant] estimated average fragment length: 192.468 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52401 SRR9321778.ke.tsv 34699 SRR9321778.se.tsv 87100 total ==> SRR9321778.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1826.53 304 5.62475 Potri.005G024800.1.v4.1 1035 843.532 136 5.44872 Potri.004G059700.1.v4.1 961 769.538 73 3.2059 Potri.007G009000.2.v4.1 1416 1224.53 0 0 Potri.003G141000.2.v4.1 2943 2751.53 318.097 3.90698 Potri.016G087400.1.v4.1 270 93.7842 1935.39 697.422 Potri.015G069301.1.v4.1 564 372.632 0 0 Potri.010G195200.1.v4.1 1773 1581.53 3 0.0641062 Potri.012G127500.1.v4.1 977 785.532 6751 290.443 ==> SRR9321778.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 23 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 348 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 82 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 13 SRR9321778 completed mapping pipeline successfully