Starting /dee2/code/volunteer_pipeline.sh SRR9321780 current disk space = 3051730493440 free memory = 1581774852 SRR9321780 SRAfilesize f79215a3127ae2c1d45b619317491349 SRR9321780.sra SRR9321780.sra file validated SRR9321780 is paired end SRR9321780 is conventional basespace SRR9321780 read1 length is 54-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9321780_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 54-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.61675 32.0 32.0 32.0 32.0 32.0 2 31.54725 32.0 32.0 32.0 32.0 32.0 3 31.63675 32.0 32.0 32.0 32.0 32.0 4 31.6795 32.0 32.0 32.0 32.0 32.0 5 31.707 32.0 32.0 32.0 32.0 32.0 6 35.01025 36.0 36.0 36.0 36.0 36.0 7 35.3255 36.0 36.0 36.0 36.0 36.0 8 35.41475 36.0 36.0 36.0 36.0 36.0 9 35.3125 36.0 36.0 36.0 36.0 36.0 10-11 35.355875 36.0 36.0 36.0 36.0 36.0 12-13 35.351375 36.0 36.0 36.0 36.0 36.0 14-15 35.317750000000004 36.0 36.0 36.0 36.0 36.0 16-17 35.32 36.0 36.0 36.0 36.0 36.0 18-19 35.256375 36.0 36.0 36.0 36.0 36.0 20-21 35.29225 36.0 36.0 36.0 36.0 36.0 22-23 35.34425 36.0 36.0 36.0 36.0 36.0 24-25 35.265 36.0 36.0 36.0 36.0 36.0 26-27 35.20975 36.0 36.0 36.0 36.0 36.0 28-29 35.175375 36.0 36.0 36.0 36.0 36.0 30-31 35.186375 36.0 36.0 36.0 36.0 36.0 32-33 35.245374999999996 36.0 36.0 36.0 36.0 36.0 34-35 35.179625 36.0 36.0 36.0 36.0 36.0 36-37 35.0965 36.0 36.0 36.0 36.0 36.0 38-39 35.11150000000001 36.0 36.0 36.0 36.0 36.0 40-41 35.087875 36.0 36.0 36.0 36.0 36.0 42-43 35.14025 36.0 36.0 36.0 36.0 36.0 44-45 35.152 36.0 36.0 36.0 36.0 36.0 46-47 35.020250000000004 36.0 36.0 36.0 36.0 36.0 48-49 34.954375 36.0 36.0 36.0 36.0 36.0 50-51 35.056875000000005 36.0 36.0 36.0 36.0 36.0 52-53 34.99325 36.0 36.0 36.0 36.0 36.0 54-55 35.00024359214804 36.0 36.0 36.0 36.0 36.0 56-57 35.00300075018755 36.0 36.0 36.0 36.0 36.0 58-59 34.908852213053265 36.0 36.0 36.0 34.0 36.0 60-61 35.01912978244561 36.0 36.0 36.0 36.0 36.0 62-63 34.88259564891223 36.0 36.0 36.0 34.0 36.0 64-65 34.91670835417709 36.0 36.0 36.0 36.0 36.0 66-67 34.849649180357005 36.0 36.0 36.0 36.0 36.0 68-69 34.89442081561171 36.0 36.0 36.0 36.0 36.0 70-71 34.85501626219665 36.0 36.0 36.0 34.0 36.0 72-73 34.68820832583782 36.0 36.0 36.0 32.0 36.0 74-75 34.623561647311035 36.0 36.0 36.0 32.0 36.0 76 34.229268292682924 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 1.0 24 4.0 25 7.0 26 16.0 27 23.0 28 36.0 29 46.0 30 63.0 31 74.0 32 128.0 33 186.0 34 407.0 35 3005.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.725 11.425 10.325 45.525 2 21.575 14.85 38.074999999999996 25.5 3 20.599999999999998 17.7 24.825 36.875 4 24.325 26.775 21.9 27.0 5 22.525000000000002 32.824999999999996 23.799999999999997 20.849999999999998 6 19.188098840141198 34.190620272314675 25.491679273827533 21.12960161371659 7 15.299999999999999 23.9 40.525 20.275000000000002 8 18.375 24.65 32.074999999999996 24.9 9 17.549999999999997 24.0 33.125 25.324999999999996 10-11 22.35 30.887500000000003 23.674999999999997 23.0875 12-13 21.275 25.9625 27.025 25.7375 14-15 20.275000000000002 26.224999999999998 27.762500000000003 25.7375 16-17 20.8 26.487500000000004 27.187499999999996 25.525 18-19 21.3 27.675 25.4875 25.5375 20-21 21.15 27.725 27.800000000000004 23.325000000000003 22-23 21.325 26.1 26.787499999999998 25.7875 24-25 20.125 26.7625 27.325 25.7875 26-27 21.575 26.637499999999996 26.6 25.1875 28-29 21.4 27.9375 26.4625 24.2 30-31 20.599999999999998 27.800000000000004 26.25 25.35 32-33 21.099999999999998 26.6 27.6 24.7 34-35 21.2 26.7125 27.437499999999996 24.65 36-37 21.0375 27.224999999999998 26.5 25.2375 38-39 21.075 27.1625 26.35 25.412499999999998 40-41 22.3 26.8125 25.837500000000002 25.05 42-43 21.512500000000003 27.462500000000002 26.6125 24.4125 44-45 21.4875 27.150000000000002 27.525 23.8375 46-47 22.2125 26.55 26.8625 24.375 48-49 22.0625 27.125 25.7875 25.025 50-51 21.3125 27.0625 27.175 24.45 52-53 21.7875 27.075 26.3125 24.825 54-55 22.14026753344168 27.728466058257283 25.9407425928241 24.190523815476936 56-57 21.48037009252313 26.30657664416104 26.806701675418854 25.406351587896975 58-59 21.842960740185045 27.156789197299325 26.144036009002253 24.85621405351338 60-61 22.43060765191298 26.744186046511626 26.269067266816705 24.55613903475869 62-63 21.29282320580145 26.71917979494874 27.019254813703427 24.968742185546386 64-65 20.99799899949975 26.663331665832917 26.825912956478238 25.512756378189096 66-67 21.638524077548468 27.292057535959973 25.31582238899312 25.753595997498437 68-69 21.22842131598699 27.145359019264447 27.358018513885412 24.26820115086315 70-71 21.691268451338505 26.64498373780335 27.157868401300977 24.505879409557167 72-73 21.395407202911283 26.076044673108296 26.653281465679505 25.875266658300916 74-75 21.76681257461202 23.119777158774372 28.82345138612548 26.28995888048813 76 23.602251407129458 0.0 38.19887429643527 38.19887429643527 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 1.5 20 2.0 21 1.5 22 3.0 23 4.0 24 1.5 25 1.0 26 6.0 27 11.0 28 17.5 29 24.5 30 30.0 31 39.5 32 39.0 33 39.5 34 71.5 35 98.5 36 109.0 37 114.5 38 123.5 39 160.5 40 183.5 41 200.5 42 226.5 43 247.5 44 276.5 45 278.0 46 259.5 47 267.5 48 285.5 49 276.5 50 250.0 51 227.0 52 202.5 53 172.5 54 149.5 55 141.0 56 127.0 57 99.5 58 86.0 59 90.5 60 80.5 61 50.0 62 29.5 63 27.5 64 21.5 65 17.0 66 15.5 67 10.5 68 9.0 69 9.0 70 7.0 71 4.0 72 4.5 73 5.5 74 3.0 75 1.0 76 1.5 77 1.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.8500000000000001 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 54 1.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 1.0 64 0.0 65 0.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 4.0 72 17.0 73 67.0 74 279.0 75 965.0 76 2665.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.25 #Duplication Level Percentage of deduplicated Percentage of total 1 97.22077922077922 93.575 2 2.103896103896104 4.05 3 0.49350649350649356 1.425 4 0.05194805194805195 0.2 5 0.07792207792207792 0.375 6 0.0 0.0 7 0.025974025974025976 0.17500000000000002 8 0.025974025974025976 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAG 8 0.2 No Hit CCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCA 7 0.17500000000000002 No Hit CTTTTATCTAATAAATGCGTCCCTTCCAGAAGTCGGGGTTTGTTGCACGT 5 0.125 No Hit GTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCC 5 0.125 No Hit CGATAGAACTCGCACCGAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGCTACTAGACGGTTCGATT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9321780 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9321780_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3495 32.0 32.0 32.0 32.0 32.0 2 31.16175 32.0 32.0 32.0 32.0 32.0 3 31.293 32.0 32.0 32.0 32.0 32.0 4 31.08075 32.0 32.0 32.0 32.0 32.0 5 31.116 32.0 32.0 32.0 32.0 32.0 6 34.5225 36.0 36.0 36.0 32.0 36.0 7 34.74275 36.0 36.0 36.0 32.0 36.0 8 34.70625 36.0 36.0 36.0 32.0 36.0 9 34.68275 36.0 36.0 36.0 32.0 36.0 10-11 34.694375 36.0 36.0 36.0 32.0 36.0 12-13 34.724125 36.0 36.0 36.0 32.0 36.0 14-15 34.570625 36.0 36.0 36.0 32.0 36.0 16-17 34.600125000000006 36.0 36.0 36.0 32.0 36.0 18-19 34.554875 36.0 36.0 36.0 32.0 36.0 20-21 34.555625 36.0 36.0 36.0 32.0 36.0 22-23 34.60125 36.0 36.0 36.0 32.0 36.0 24-25 34.516625000000005 36.0 36.0 36.0 32.0 36.0 26-27 34.4585 36.0 36.0 36.0 32.0 36.0 28-29 34.5065 36.0 36.0 36.0 32.0 36.0 30-31 34.441625 36.0 36.0 36.0 32.0 36.0 32-33 34.430375 36.0 36.0 36.0 32.0 36.0 34-35 34.414125 36.0 36.0 36.0 32.0 36.0 36-37 34.40620310155077 36.0 36.0 36.0 32.0 36.0 38-39 34.3511755877939 36.0 36.0 36.0 32.0 36.0 40-41 34.40932966483241 36.0 36.0 36.0 32.0 36.0 42-43 34.45785392696348 36.0 36.0 36.0 32.0 36.0 44-45 34.20285142571286 36.0 36.0 36.0 32.0 36.0 46-47 34.19347173586793 36.0 36.0 36.0 32.0 36.0 48-49 34.28961939798192 36.0 36.0 36.0 32.0 36.0 50-51 34.21471471471472 36.0 36.0 36.0 32.0 36.0 52-53 34.13763763763764 36.0 36.0 36.0 32.0 36.0 54-55 33.94393354556058 36.0 36.0 36.0 32.0 36.0 56-57 34.08260325406758 36.0 36.0 36.0 32.0 36.0 58-59 33.94567235709634 36.0 36.0 36.0 32.0 36.0 60-61 34.12406109163746 36.0 36.0 36.0 32.0 36.0 62-63 33.88683024536805 36.0 36.0 36.0 32.0 36.0 64-65 33.760330578512395 36.0 36.0 36.0 29.5 36.0 66-67 33.73337138840667 36.0 36.0 36.0 27.0 36.0 68-69 33.74624248496994 36.0 36.0 36.0 27.0 36.0 70-71 33.66082164328657 36.0 36.0 36.0 27.0 36.0 72-73 33.70477482648128 36.0 36.0 36.0 27.0 36.0 74-75 33.718287465109675 36.0 36.0 36.0 27.0 36.0 76 32.819263238679966 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 7.0 16 10.0 17 8.0 18 1.0 19 3.0 20 8.0 21 8.0 22 16.0 23 9.0 24 20.0 25 28.0 26 29.0 27 48.0 28 65.0 29 75.0 30 101.0 31 117.0 32 175.0 33 261.0 34 620.0 35 2386.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.033033033033036 21.496496496496498 13.98898898898899 31.48148148148148 2 30.365182591295646 25.962981490745374 29.33966983491746 14.33216608304152 3 24.862431215607803 26.313156578289142 26.28814407203602 22.536268134067033 4 25.587793896948476 33.19159579789895 22.336168084042022 18.884442221110557 5 27.988994497248626 33.766883441720864 20.560280140070038 17.68384192096048 6 22.886443221610804 36.89344672336168 21.335667833916958 18.884442221110557 7 22.786393196598297 19.93496748374187 35.767883941970986 21.510755377688845 8 25.03751875937969 22.886443221610804 26.688344172086044 25.387693846923458 9 25.068801601200903 24.0180135101326 27.220415311483613 23.692769577182887 10-11 25.769326995246434 31.023267450587944 21.065799349512133 22.141606204653492 12-13 25.268951713785338 24.193144858643983 26.65749311983988 23.8804103077308 14-15 25.956967725794343 26.695021265949464 25.74430823117338 21.603702777082813 16-17 26.344758568926697 26.7575681761321 25.356517388041034 21.541155866900176 18-19 26.507380535401552 26.08206154615962 25.594195646735052 21.816362271703778 20-21 25.281461095821868 26.682511883912934 26.770077558168627 21.26594946209657 22-23 26.207155366524894 26.26970227670753 25.31898924193145 22.204153114836128 24-25 26.144608456342254 26.344758568926697 25.706780085063798 21.80385288966725 26-27 25.469101826369776 27.23292469352014 25.719289467100324 21.57868401300976 28-29 26.419814861145856 26.057042782086565 25.143857893420062 22.37928446334751 30-31 25.04378283712785 28.008506379784837 24.993745308981737 21.95396547410558 32-33 25.906930197648236 26.695021265949464 25.606705028771582 21.79134350763072 34-35 25.293970477858394 26.8951713785339 25.569176882662 22.241681260945708 36-37 25.83187390542907 26.945208906680012 25.156367275456592 22.066549912434326 38-39 25.74430823117338 26.482361771328495 26.09457092819615 21.678759069301975 40-41 25.69427070302727 26.932699524643482 25.83187390542907 21.541155866900176 42-43 25.40655491618714 27.032774580935705 25.456592444333246 22.10407805854391 44-45 26.35726795096322 25.469101826369776 26.407305479109333 21.766324743557668 46-47 26.670002501876404 26.832624468351263 25.293970477858394 21.203402551913936 48-49 25.941684394944314 26.61744462520335 25.591290201476664 21.84958077837567 50-51 25.857321652065078 27.083854818523157 25.406758448060074 21.65206508135169 52-53 26.273626236074605 27.099762172987855 24.83414695205908 21.79246463887846 54-55 24.98748122183275 25.963945918878316 25.863795693540307 23.184777165748624 56-57 25.650976464697045 25.951427140711065 26.289434151226843 22.108162243365047 58-59 26.008014024542952 25.957926371149508 26.045579764588027 21.98847983971951 60-61 25.93288254445279 26.22088655146506 26.08314550463311 21.763085399449036 62-63 25.557225144002004 25.757575757575758 26.208364638116706 22.476834460305533 64-65 25.21608417888012 26.81949141926594 26.055367656269574 21.909056745584365 66-67 25.532448008018036 26.472062139814582 25.319468804810825 22.67602104735655 68-69 25.620145326985718 25.306940616386868 26.672513154597844 22.400400902029567 70-71 26.14035087719298 25.927318295739347 26.416040100250626 21.51629072681704 72-73 25.563247325361864 26.331025802391437 25.663939584644428 22.441787287602267 74-75 26.926174496644293 22.805369127516776 26.51006711409396 23.758389261744966 76 28.637236084452976 0.0 38.73320537428023 32.629558541266796 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 1.5 17 2.5 18 2.5 19 1.0 20 0.5 21 1.0 22 1.0 23 2.5 24 3.0 25 3.0 26 5.0 27 6.5 28 11.5 29 13.5 30 14.5 31 26.0 32 34.0 33 36.5 34 44.0 35 66.5 36 95.0 37 108.0 38 130.0 39 162.5 40 174.0 41 190.5 42 211.5 43 245.5 44 274.5 45 279.0 46 288.5 47 303.0 48 303.5 49 276.5 50 253.5 51 228.0 52 205.0 53 166.5 54 133.5 55 125.0 56 114.5 57 109.0 58 98.5 59 90.5 60 77.5 61 67.5 62 58.5 63 35.5 64 18.0 65 17.0 66 18.0 67 15.5 68 11.5 69 8.0 70 8.5 71 9.0 72 13.0 73 16.0 74 9.5 75 4.5 76 3.5 77 1.5 78 0.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.5 98 1.0 99 20.5 100 40.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.05 3 0.05 4 0.05 5 0.05 6 0.05 7 0.05 8 0.05 9 0.075 10-11 0.075 12-13 0.075 14-15 0.075 16-17 0.075 18-19 0.075 20-21 0.075 22-23 0.075 24-25 0.075 26-27 0.075 28-29 0.075 30-31 0.075 32-33 0.075 34-35 0.075 36-37 0.02501250625312656 38-39 0.02501250625312656 40-41 0.02501250625312656 42-43 0.02501250625312656 44-45 0.02501250625312656 46-47 0.02501250625312656 48-49 0.025021894157387717 50-51 0.025025025025025023 52-53 0.03753753753753754 54-55 0.03754223501439119 56-57 0.025031289111389236 58-59 0.03755163349605708 60-61 0.025037556334501748 62-63 0.025037556334501748 64-65 0.03756574004507889 66-67 0.037570444583594244 68-69 0.0250501002004008 70-71 0.0501002004008016 72-73 0.0377453447408153 74-75 0.026838432635534086 76 0.03837298541826554 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 2.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 1.0 48 1.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 1.0 55 0.0 56 0.0 57 0.0 58 1.0 59 0.0 60 0.0 61 0.0 62 0.0 63 1.0 64 0.0 65 0.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 6.0 72 24.0 73 86.0 74 300.0 75 970.0 76 2606.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.05 #Duplication Level Percentage of deduplicated Percentage of total 1 97.6314419573139 93.77499999999999 2 1.8740239458615304 3.5999999999999996 3 0.2863092139510671 0.8250000000000001 4 0.10411244143675169 0.4 5 0.052056220718375845 0.25 6 0.026028110359187923 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026028110359187923 1.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 40 1.0 No Hit GTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTCG 6 0.15 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAA 5 0.125 No Hit AGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1217792 spots for SRR9321780.sra Written 1217792 spots for SRR9321780.sra Read 1217792 spots for SRR9321780.sra Written 1217792 spots for SRR9321780.sra Read 1217792 spots for SRR9321780.sra Written 1217792 spots for SRR9321780.sra Read 1217792 spots for SRR9321780.sra Written 1217792 spots for SRR9321780.sra Read 1217792 spots for SRR9321780.sra Written 1217792 spots for SRR9321780.sra Read 1217792 spots for SRR9321780.sra Written 1217792 spots for SRR9321780.sra Read 1217792 spots for SRR9321780.sra Written 1217792 spots for SRR9321780.sra Read 1217792 spots for SRR9321780.sra Written 1217792 spots for SRR9321780.sra Read 1217792 spots for SRR9321780.sra Written 1217792 spots for SRR9321780.sra Read 1217796 spots for SRR9321780.sra Written 1217796 spots for SRR9321780.sra Read 1217792 spots for SRR9321780.sra Written 1217792 spots for SRR9321780.sra Read 1217792 spots for SRR9321780.sra Written 1217792 spots for SRR9321780.sra Read 1217792 spots for SRR9321780.sra Written 1217792 spots for SRR9321780.sra Read 1217792 spots for SRR9321780.sra Written 1217792 spots for SRR9321780.sra Read 1217792 spots for SRR9321780.sra Written 1217792 spots for SRR9321780.sra Read 1217792 spots for SRR9321780.sra Written 1217792 spots for SRR9321780.sra Read 1217792 spots for SRR9321780.sra Written 1217792 spots for SRR9321780.sra Read 1217792 spots for SRR9321780.sra Written 1217792 spots for SRR9321780.sra Read 1217792 spots for SRR9321780.sra Written 1217792 spots for SRR9321780.sra Read 1217792 spots for SRR9321780.sra Written 1217792 spots for SRR9321780.sra SRR ids: ['SRR9321780.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0ygy1ip6 SRR9321780.sra spots: 24355844 blocks: [[1, 1217792], [1217793, 2435584], [2435585, 3653376], [3653377, 4871168], [4871169, 6088960], [6088961, 7306752], [7306753, 8524544], [8524545, 9742336], [9742337, 10960128], [10960129, 12177920], [12177921, 13395712], [13395713, 14613504], [14613505, 15831296], [15831297, 17049088], [17049089, 18266880], [18266881, 19484672], [19484673, 20702464], [20702465, 21920256], [21920257, 23138048], [23138049, 24355844]] SRR9321780 file size 4617486 SRR9321780 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9321780 SRR9321780_1.fastq SRR9321780_2.fastq Input file: SRR9321780_1.fastq Paired file: SRR9321780_2.fastq trimmed: SRR9321780-trimmed-pair1.fastq, SRR9321780-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 14:40:24 2025 >> started Wed Feb 12 14:40:44 2025 >> done (20.931s) 24355844 read pairs processed; of these: 3713 ( 0.02%) short read pairs filtered out after trimming by size control 9147 ( 0.04%) empty read pairs filtered out after trimming by size control 24342984 (99.95%) read pairs available; of these: 12172 ( 0.05%) trimmed read pairs available after processing 24330812 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 21 1 0.00% 22 5 0.00% 23 1 0.00% 24 1 0.00% 25 6 0.00% 26 8 0.00% 27 7 0.00% 28 14 0.00% 29 4 0.00% 30 13 0.00% 31 16 0.00% 32 14 0.00% 33 14 0.00% 34 15 0.00% 35 124 0.00% 36 133 0.00% 37 143 0.00% 38 154 0.00% 39 141 0.00% 40 170 0.00% 41 191 0.00% 42 186 0.00% 43 226 0.00% 44 268 0.00% 45 243 0.00% 46 224 0.00% 47 285 0.00% 48 320 0.00% 49 394 0.00% 50 414 0.00% 51 458 0.00% 52 531 0.00% 53 546 0.00% 54 552 0.00% 55 798 0.00% 56 779 0.00% 57 914 0.00% 58 1065 0.00% 59 1396 0.01% 60 1763 0.01% 61 1777 0.01% 62 1693 0.01% 63 1896 0.01% 64 2004 0.01% 65 2382 0.01% 66 2278 0.01% 67 2690 0.01% 68 2531 0.01% 69 2765 0.01% 70 3437 0.01% 71 5018 0.02% 72 16493 0.07% 73 196367 0.81% 74 1902972 7.82% 75 11499247 47.24% 76 10686897 43.90% 24342984 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=32 prefix-density=0.53 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=21.61 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=1.1 sequence=ATGCCTCAGCTGCATACATCACTGCACTTCCACTTGACACCTATCGTAATGATAAACGGCTCGTCTCGCCGTGACCTTCTCTTGAATTCTCAAAACTTCTGTCGCTCCATCCCCGCAGGGGCAGAGAACCCGTCGCTGTCTCGGCTGTGCTACCGGAGGCTCTGGGGAAGTCGGAATAGGAGAGCACTCATCTTGGGGTGGGCTTACTACTTAGATGCTTTCAGCAGTTATCCGCTCCGCACTTGGCTACCCAGCGTTTACCGTGGGCACAATAACTGGTACACCAGAGGTGCGTCCTTCCCGGTCCTCTCGTAC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=33 prefix-density=0.35 prefix-fanout=2.1 sequence=CCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=36.87 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=1.9 sequence=GGCCGTCGGTGCAGATCTTGGTGGTAGTAGCAAATATTCAAATGAGAACTTTGAAGGCCGAAGAGGGGAAAGGTTCCATGTGAACGGCACTTGCACATGGGTTAGTCGATCCTAAGAGACGGGGGAAGCCCGTCCGACAGCGCGTTCGCGCGCGAGCTTCGAAAGGGAATCGGGTTAAAATTCCTGAACCGGGACGTGGCGGCTGACGGCAACGTTAGGGAGTCCGGAGACGTCGGCGGGGGCCTCGGGAAGAGTTATCTTTTCTGTTTAACAGCCCGCCCACCCTGGAAACGACTTAGTCGGAGGTAGGGTCCAGCGGCTGGAAGAGCACCGCACGTCGCGTGGTGTCCGGTGCGCCCCCGGCGGCCCTTGAAAATCCGGAGGACCGAGTGCCTCCCACGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAACAGCCTCTGGTCGATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTCGGGAAAAGG SRR9321780 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 14:41:09 Started mapping on | Feb 12 14:41:10 Finished on | Feb 12 14:43:05 Mapping speed, Million of reads per hour | 762.04 Number of input reads | 24342984 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 18903510 Uniquely mapped reads % | 77.65% Average mapped length | 150.42 Number of splices: Total | 7877578 Number of splices: Annotated (sjdb) | 7790882 Number of splices: GT/AG | 7724125 Number of splices: GC/AG | 132326 Number of splices: AT/AC | 5604 Number of splices: Non-canonical | 15523 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.02% Deletion average length | 2.17 Insertion rate per base | 0.02% Insertion average length | 1.95 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1086490 % of reads mapped to multiple loci | 4.46% Number of reads mapped to too many loci | 3297767 % of reads mapped to too many loci | 13.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.92% % of reads unmapped: other | 0.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4353232 4353232 4353232 N_multimapping 1086490 1086490 1086490 N_noFeature 985006 18615852 1055361 N_ambiguous 338972 1517 120390 UnstrandedReadsAssigned:17579532 PositiveStrandReadsAssigned:286141 NegativeStrandReadsAssigned:17727759 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9321780 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9321780-trimmed-pair1.fastq SRR9321780-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,342,984 reads, 20,868,301 reads pseudoaligned [quant] estimated average fragment length: 191.647 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,027 rounds 52401 SRR9321780.ke.tsv 34699 SRR9321780.se.tsv 87100 total ==> SRR9321780.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1827.35 251.526 5.04264 Potri.005G024800.1.v4.1 1035 844.353 86 3.73141 Potri.004G059700.1.v4.1 961 770.353 53 2.52049 Potri.007G009000.2.v4.1 1416 1225.35 0 0 Potri.003G141000.2.v4.1 2943 2752.35 213.095 2.8364 Potri.016G087400.1.v4.1 270 92.3572 1157.96 459.326 Potri.015G069301.1.v4.1 564 373.421 0 0 Potri.010G195200.1.v4.1 1773 1582.35 4 0.0926093 Potri.012G127500.1.v4.1 977 786.353 2609 121.55 ==> SRR9321780.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 23 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 251 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 42 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 5 SRR9321780 completed mapping pipeline successfully