Starting /dee2/code/volunteer_pipeline.sh SRR952886 current disk space = 3059118305280 free memory = 1410441164 SRR952886 SRAfilesize bffcf6c77b1dafeb56259906ec5a1ea8 SRR952886.sra SRR952886.sra file validated SRR952886 is single end SRR952886 is conventional basespace SRR952886 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR952886_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.46025 38.0 35.0 39.0 33.0 40.0 2 35.597 38.0 35.0 39.0 29.0 40.0 3 35.06225 38.0 33.0 39.0 28.0 40.0 4 35.73875 38.0 35.0 39.0 30.0 40.0 5 34.911 38.0 33.0 39.0 27.0 40.0 6 35.34125 38.0 35.0 39.0 29.0 40.0 7 34.4065 37.0 33.0 39.0 27.0 39.0 8 34.324 36.0 33.0 39.0 27.0 39.0 9 33.83325 36.0 32.0 39.0 25.0 39.0 10 34.63725 37.0 33.0 39.0 27.0 40.0 11 33.42625 36.0 31.0 38.0 24.0 39.0 12 33.0845 35.0 30.0 38.0 23.0 39.0 13 32.93425 35.0 30.0 38.0 23.0 39.0 14 32.737 35.0 30.0 38.0 23.0 39.0 15 32.835 35.0 30.0 38.0 23.0 39.0 16 32.95375 35.0 31.0 38.0 23.0 39.0 17 33.03175 35.0 31.0 38.0 23.0 39.0 18 32.6025 35.0 30.0 38.0 23.0 39.0 19 32.641 35.0 30.0 38.0 23.0 39.0 20 32.574 35.0 30.0 38.0 23.0 39.0 21 32.76075 36.0 31.0 38.0 23.0 39.0 22 32.5195 35.0 30.0 38.0 23.0 39.0 23 32.72225 35.0 30.0 38.0 23.0 39.0 24 32.445 35.0 30.0 38.0 23.0 39.0 25 32.297 35.0 30.0 38.0 23.0 39.0 26 32.5845 35.0 31.0 38.0 22.0 39.0 27 31.946 35.0 30.0 38.0 21.0 39.0 28 31.88775 35.0 30.0 38.0 20.0 39.0 29 31.667 35.0 30.0 38.0 19.0 39.0 30 31.05025 35.0 29.0 38.0 17.0 39.0 31 30.74475 35.0 29.0 38.0 14.0 39.0 32 29.7335 33.0 27.0 37.0 13.0 39.0 33 29.518 33.0 27.0 37.0 11.0 39.0 34 28.94325 33.0 25.0 36.0 10.0 39.0 35 29.1775 33.0 26.0 36.0 9.0 39.0 36 29.241 33.0 27.0 37.0 7.0 39.0 37 28.5225 33.0 25.0 36.0 6.0 39.0 38 28.5265 33.0 25.0 36.0 2.0 39.0 39 28.60675 33.0 25.0 36.0 2.0 39.0 40 28.41475 33.0 25.0 36.0 2.0 38.0 41 28.2595 33.0 25.0 36.0 2.0 38.0 42 28.30725 33.0 25.0 36.0 2.0 38.0 43 27.86825 32.0 24.0 36.0 2.0 38.0 44 28.1815 33.0 25.0 36.0 2.0 38.0 45 27.94825 32.0 25.0 36.0 2.0 38.0 46 27.85225 33.0 25.0 36.0 2.0 38.0 47 28.424 33.0 26.0 36.0 2.0 38.0 48 27.88 33.0 25.0 36.0 2.0 38.0 49 28.01025 33.0 25.0 36.0 2.0 38.0 50 27.79125 33.0 25.0 36.0 2.0 38.0 51 27.58875 33.0 24.0 36.0 2.0 38.0 52 27.1805 32.0 23.0 36.0 2.0 38.0 53 27.27725 33.0 24.0 36.0 2.0 38.0 54 26.87975 32.0 23.0 35.0 2.0 38.0 55 26.7225 32.0 23.0 36.0 2.0 38.0 56 25.39425 31.0 19.0 35.0 2.0 37.0 57 25.3695 31.0 19.0 35.0 2.0 38.0 58 24.86775 31.0 17.0 35.0 2.0 37.0 59 23.9565 29.0 14.0 34.0 2.0 36.0 60 23.953 30.0 14.0 34.0 2.0 36.0 61 24.037 31.0 2.0 35.0 2.0 37.0 62 23.92875 30.0 2.0 35.0 2.0 37.0 63 23.4115 30.0 2.0 34.0 2.0 36.0 64 22.8395 29.0 2.0 33.0 2.0 36.0 65 22.7695 30.0 2.0 34.0 2.0 36.0 66 22.42225 30.0 2.0 34.0 2.0 37.0 67 22.391 30.0 2.0 34.0 2.0 37.0 68 21.71125 29.0 2.0 33.0 2.0 36.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 38.0 3 8.0 4 8.0 5 9.0 6 25.0 7 17.0 8 14.0 9 32.0 10 32.0 11 31.0 12 38.0 13 41.0 14 47.0 15 32.0 16 29.0 17 43.0 18 33.0 19 40.0 20 47.0 21 57.0 22 64.0 23 78.0 24 94.0 25 97.0 26 115.0 27 128.0 28 153.0 29 166.0 30 179.0 31 232.0 32 242.0 33 291.0 34 359.0 35 384.0 36 346.0 37 296.0 38 144.0 39 11.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.1774880922537 15.843569816996741 16.7711205815994 39.207821509150165 2 21.95 24.425 33.1 20.525 3 24.099999999999998 26.400000000000002 26.424999999999997 23.075000000000003 4 26.325 31.125000000000004 20.549999999999997 22.0 5 25.924999999999997 35.9 20.674999999999997 17.5 6 18.5 38.4 24.075 19.025 7 17.0 18.8 43.25 20.95 8 19.625 24.3 29.875 26.200000000000003 9 21.075 23.075000000000003 31.275 24.575 10 20.05 38.35 24.349999999999998 17.25 11 26.35 29.175 21.9 22.575 12 21.4 24.95 28.625 25.025 13 20.1 28.325 29.75 21.825 14 21.775 27.275 28.449999999999996 22.5 15 22.875 26.724999999999998 27.975 22.425 16 21.325 28.349999999999998 27.525 22.8 17 23.5 27.925 27.05 21.525 18 22.325 28.475 27.150000000000002 22.05 19 21.425 29.049999999999997 27.575 21.95 20 20.5 29.075 27.375 23.05 21 22.2 27.325 27.925 22.55 22 21.125 28.425 27.224999999999998 23.225 23 21.175 29.599999999999998 27.450000000000003 21.775 24 21.625 28.849999999999998 26.8 22.725 25 22.275 28.799999999999997 27.224999999999998 21.7 26 21.675 28.275 27.375 22.675 27 20.925 28.325 27.650000000000002 23.1 28 21.8 28.325 26.625 23.25 29 23.150000000000002 28.549999999999997 27.325 20.974999999999998 30 22.650000000000002 28.999999999999996 28.375 19.975 31 22.075 27.3 28.225 22.400000000000002 32 21.8 29.099999999999998 27.0 22.1 33 22.575 26.700000000000003 28.549999999999997 22.175 34 22.925 27.450000000000003 27.250000000000004 22.375 35 22.825 28.249999999999996 27.775 21.15 36 22.025 27.825 27.6 22.55 37 22.75 27.575 27.425 22.25 38 23.25 28.000000000000004 27.175 21.575 39 21.775 28.075 26.400000000000002 23.75 40 22.25 28.025 28.325 21.4 41 23.9 26.8 27.400000000000002 21.9 42 21.525 28.9 27.1 22.475 43 21.75 28.525 27.725 22.0 44 22.025 28.1 27.875 22.0 45 23.400000000000002 27.224999999999998 27.224999999999998 22.15 46 21.6 27.200000000000003 28.799999999999997 22.400000000000002 47 23.05 27.975 27.150000000000002 21.825 48 22.575 28.075 27.55 21.8 49 23.400000000000002 28.275 27.35 20.974999999999998 50 23.65 28.199999999999996 26.525 21.625 51 22.175 28.025 26.25 23.549999999999997 52 23.95 27.675 26.825 21.55 53 23.799999999999997 28.425 27.55 20.225 54 22.45 26.900000000000002 28.525 22.125 55 23.400000000000002 26.825 27.925 21.85 56 22.75 27.900000000000002 28.175 21.175 57 22.175 27.925 28.199999999999996 21.7 58 22.15 28.025 27.725 22.1 59 22.650000000000002 27.125 27.750000000000004 22.475 60 21.925 26.025 28.775000000000002 23.275000000000002 61 22.625 27.025 28.725 21.625 62 23.075000000000003 27.825 27.85 21.25 63 22.175 28.075 27.400000000000002 22.35 64 22.25 28.249999999999996 26.724999999999998 22.775000000000002 65 22.175 29.849999999999998 27.474999999999998 20.5 66 22.075 29.175 26.775 21.975 67 22.25 27.675 28.025 22.05 68 23.025000000000002 28.375 26.275 22.325 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 1.0 20 0.5 21 2.0 22 4.0 23 5.5 24 7.0 25 7.0 26 9.5 27 15.0 28 18.0 29 22.0 30 32.5 31 39.0 32 45.0 33 74.0 34 97.0 35 105.0 36 145.5 37 178.0 38 213.5 39 260.5 40 304.5 41 337.0 42 356.5 43 374.0 44 372.0 45 371.0 46 331.5 47 293.0 48 290.0 49 261.5 50 236.0 51 198.0 52 137.5 53 115.0 54 95.0 55 70.5 56 66.0 57 58.5 58 44.5 59 38.0 60 36.5 61 32.0 62 29.0 63 24.0 64 17.5 65 13.5 66 11.0 67 12.5 68 14.5 69 15.0 70 10.5 71 4.0 72 2.0 73 1.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79874213836479 99.175 2 0.12578616352201258 0.25 3 0.0 0.0 4 0.05031446540880503 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025157232704402514 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTGAAAAA 15 0.375 TruSeq Adapter, Index 3 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.175 0.0 0.0 0.0 0.0 2 0.175 0.0 0.0 0.0 0.0 3 0.175 0.0 0.0 0.0 0.0 4 0.175 0.0 0.0 0.0 0.0 5 0.175 0.0 0.0 0.0 0.0 6 0.175 0.0 0.0 0.0 0.0 7 0.175 0.0 0.0 0.0 0.0 8 0.175 0.0 0.0 0.0 0.0 9 0.175 0.0 0.0 0.0 0.0 10 0.175 0.0 0.0 0.0 0.0 11 0.175 0.0 0.0 0.0 0.0 12 0.175 0.0 0.0 0.0 0.0 13 0.175 0.0 0.0 0.0 0.0 14 0.175 0.0 0.0 0.0 0.0 15 0.175 0.0 0.0 0.0 0.0 16 0.175 0.0 0.0 0.0 0.0 17 0.175 0.0 0.0 0.0 0.0 18 0.175 0.0 0.0 0.0 0.0 19 0.175 0.0 0.0 0.0 0.0 20 0.175 0.0 0.0 0.0 0.0 21 0.175 0.0 0.0 0.0 0.0 22 0.175 0.0 0.0 0.0 0.0 23 0.175 0.0 0.0 0.0 0.0 24 0.175 0.0 0.0 0.0 0.0 25 0.175 0.0 0.0 0.0 0.0 26 0.175 0.0 0.0 0.0 0.0 27 0.175 0.0 0.0 0.0 0.0 28 0.175 0.0 0.0 0.0 0.0 29 0.175 0.0 0.0 0.0 0.0 30 0.175 0.0 0.0 0.0 0.0 31 0.175 0.0 0.0 0.0 0.0 32 0.175 0.0 0.0 0.0 0.0 33 0.175 0.0 0.0 0.0 0.0 34 0.175 0.0 0.0 0.0 0.0 35 0.175 0.0 0.0 0.0 0.0 36 0.175 0.0 0.0 0.0 0.0 37 0.175 0.0 0.0 0.0 0.0 38 0.175 0.0 0.0 0.0 0.0 39 0.175 0.0 0.0 0.0 0.0 40 0.175 0.0 0.0 0.0 0.0 41 0.175 0.0 0.0 0.0 0.0 42 0.175 0.0 0.0 0.0 0.0 43 0.175 0.0 0.0 0.0 0.0 44 0.175 0.0 0.0 0.0 0.0 45 0.175 0.0 0.0 0.0 0.0 46 0.175 0.0 0.0 0.0 0.0 47 0.175 0.0 0.0 0.0 0.0 48 0.175 0.0 0.0 0.0 0.0 49 0.175 0.0 0.0 0.0 0.0 50 0.175 0.0 0.0 0.0 0.0 51 0.175 0.0 0.0 0.0 0.0 52 0.175 0.0 0.0 0.0 0.0 53 0.175 0.0 0.0 0.0 0.0 54 0.175 0.0 0.0 0.0 0.0 55 0.175 0.0 0.0 0.0 0.0 56 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 204201 spots for SRR952886.sra Written 204201 spots for SRR952886.sra Read 204201 spots for SRR952886.sra Written 204201 spots for SRR952886.sra Read 204201 spots for SRR952886.sra Written 204201 spots for SRR952886.sra Read 204201 spots for SRR952886.sra Written 204201 spots for SRR952886.sra Read 204201 spots for SRR952886.sra Written 204201 spots for SRR952886.sra Read 204201 spots for SRR952886.sra Written 204201 spots for SRR952886.sra Read 204201 spots for SRR952886.sra Written 204201 spots for SRR952886.sra Read 204201 spots for SRR952886.sra Written 204201 spots for SRR952886.sra Read 204201 spots for SRR952886.sra Written 204201 spots for SRR952886.sra Read 204201 spots for SRR952886.sra Written 204201 spots for SRR952886.sra Read 204201 spots for SRR952886.sra Written 204201 spots for SRR952886.sra Read 204201 spots for SRR952886.sra Written 204201 spots for SRR952886.sra Read 204201 spots for SRR952886.sra Written 204201 spots for SRR952886.sra Read 204201 spots for SRR952886.sra Written 204201 spots for SRR952886.sra Read 204201 spots for SRR952886.sra Written 204201 spots for SRR952886.sra Read 204201 spots for SRR952886.sra Written 204201 spots for SRR952886.sra Read 204201 spots for SRR952886.sra Written 204201 spots for SRR952886.sra Read 204201 spots for SRR952886.sra Written 204201 spots for SRR952886.sra Read 204201 spots for SRR952886.sra Written 204201 spots for SRR952886.sra Read 204204 spots for SRR952886.sra Written 204204 spots for SRR952886.sra SRR ids: ['SRR952886.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_13jlu3th SRR952886.sra spots: 4084023 blocks: [[1, 204201], [204202, 408402], [408403, 612603], [612604, 816804], [816805, 1021005], [1021006, 1225206], [1225207, 1429407], [1429408, 1633608], [1633609, 1837809], [1837810, 2042010], [2042011, 2246211], [2246212, 2450412], [2450413, 2654613], [2654614, 2858814], [2858815, 3063015], [3063016, 3267216], [3267217, 3471417], [3471418, 3675618], [3675619, 3879819], [3879820, 4084023]] SRR952886 file size 853153 SRR952886 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR952886 SRR952886_1.fastq Input file: SRR952886_1.fastq trimmed: SRR952886-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 10:42:41 2025 >> started Mon Feb 10 10:42:43 2025 >> done (1.950s) 4084023 reads processed; of these: 12092 ( 0.30%) short reads filtered out after trimming by size control 56102 ( 1.37%) empty reads filtered out after trimming by size control 4015829 (98.33%) reads available; of these: 471137 (11.73%) trimmed reads available after processing 3544692 (88.27%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1334 0.03% 19 2157 0.05% 20 3485 0.09% 21 1102 0.03% 22 1569 0.04% 23 2531 0.06% 24 3903 0.10% 25 6855 0.17% 26 1735 0.04% 27 2312 0.06% 28 3208 0.08% 29 4806 0.12% 30 7946 0.20% 31 2076 0.05% 32 2406 0.06% 33 3301 0.08% 34 5024 0.13% 35 7831 0.20% 36 2045 0.05% 37 2642 0.07% 38 3640 0.09% 39 5803 0.14% 40 8825 0.22% 41 2193 0.05% 42 3048 0.08% 43 4703 0.12% 44 7469 0.19% 45 12312 0.31% 46 2565 0.06% 47 3912 0.10% 48 6046 0.15% 49 10134 0.25% 50 17368 0.43% 51 4092 0.10% 52 6065 0.15% 53 9458 0.24% 54 15587 0.39% 55 27440 0.68% 56 5700 0.14% 57 8243 0.21% 58 12940 0.32% 59 23401 0.58% 60 43276 1.08% 61 8491 0.21% 62 12243 0.30% 63 18785 0.47% 64 33049 0.82% 65 56988 1.42% 66 11066 0.28% 67 18027 0.45% 68 3544692 88.27% 4015829 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=3.04 fanout-score-rank=14 prefix-density=0.04 prefix-fanout=2.7 sequence=CCTCTGCTGGTCTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=22 fanout-score=233.86 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=21.8 sequence=AAGAAGAAGAAG Started job on | Feb 10 10:43:03 Started mapping on | Feb 10 10:43:03 Finished on | Feb 10 10:43:10 Mapping speed, Million of reads per hour | 2065.28 Number of input reads | 4015829 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 3570411 Uniquely mapped reads % | 88.91% Average mapped length | 66.43 Number of splices: Total | 742635 Number of splices: Annotated (sjdb) | 729374 Number of splices: GT/AG | 731291 Number of splices: GC/AG | 9769 Number of splices: AT/AC | 726 Number of splices: Non-canonical | 849 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.81 Insertion rate per base | 0.01% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 204796 % of reads mapped to multiple loci | 5.10% Number of reads mapped to too many loci | 36454 % of reads mapped to too many loci | 0.91% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.08% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 240622 240622 240622 N_multimapping 204796 204796 204796 N_noFeature 150279 1818109 1890973 N_ambiguous 21185 5071 4623 UnstrandedReadsAssigned:3398947 PositiveStrandReadsAssigned:1747231 NegativeStrandReadsAssigned:1674815 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR952886 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR952886-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,015,829 reads, 3,535,287 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 987 rounds 52401 SRR952886.ke.tsv 34699 SRR952886.se.tsv 87100 total ==> SRR952886.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 912 191.675 Potri.005G024800.1.v4.1 1035 936 397 171.065 Potri.004G059700.1.v4.1 961 862 1 0.467884 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 139.114 19.7282 Potri.016G087400.1.v4.1 270 171 103 242.933 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 76.1426 18.345 Potri.012G127500.1.v4.1 977 878 702 322.469 ==> SRR952886.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 67 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 0 SRR952886 completed mapping pipeline successfully