Starting /dee2/code/volunteer_pipeline.sh SRR952887 current disk space = 3058916507648 free memory = 1546707528 SRR952887 SRAfilesize 11ecc0c1d657f28ecfa97a11019903a7 SRR952887.sra SRR952887.sra file validated SRR952887 is single end SRR952887 is conventional basespace SRR952887 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR952887_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.82625 38.0 35.0 39.0 31.0 40.0 2 36.21175 38.0 35.0 39.0 30.0 40.0 3 36.33025 38.0 35.0 39.0 30.0 40.0 4 36.12375 38.0 35.0 39.0 29.0 40.0 5 36.288 38.0 35.0 39.0 30.0 40.0 6 36.52875 38.0 35.0 39.0 31.0 40.0 7 36.442 38.0 35.0 39.0 30.0 40.0 8 36.31275 38.0 35.0 39.0 30.0 40.0 9 36.2335 38.0 35.0 39.0 30.0 40.0 10 36.259 38.0 35.0 39.0 30.0 40.0 11 36.46475 38.0 35.0 39.0 31.0 40.0 12 36.233 38.0 35.0 39.0 30.0 40.0 13 36.131 38.0 35.0 39.0 30.0 40.0 14 36.11925 38.0 35.0 39.0 30.0 40.0 15 36.091 38.0 35.0 39.0 30.0 40.0 16 36.14475 38.0 35.0 39.0 30.0 40.0 17 35.981 38.0 35.0 39.0 29.0 40.0 18 35.86375 38.0 35.0 39.0 29.0 40.0 19 35.851 38.0 35.0 39.0 29.0 40.0 20 35.93075 38.0 35.0 39.0 29.0 40.0 21 35.939 38.0 35.0 39.0 29.0 40.0 22 35.813 38.0 35.0 39.0 29.0 40.0 23 35.72225 38.0 35.0 39.0 29.0 40.0 24 35.7485 38.0 35.0 39.0 29.0 40.0 25 35.5985 38.0 35.0 39.0 29.0 40.0 26 35.68 38.0 35.0 39.0 29.0 40.0 27 35.5655 38.0 35.0 39.0 29.0 40.0 28 35.394 38.0 34.0 39.0 28.0 40.0 29 35.3765 38.0 34.0 39.0 29.0 40.0 30 35.21375 38.0 33.0 39.0 28.0 40.0 31 35.22975 38.0 35.0 39.0 28.0 40.0 32 34.94875 38.0 33.0 39.0 27.0 40.0 33 34.9375 38.0 33.0 39.0 27.0 40.0 34 34.77275 38.0 33.0 39.0 27.0 40.0 35 34.58325 38.0 33.0 39.0 27.0 40.0 36 34.66325 38.0 33.0 39.0 26.0 40.0 37 34.5225 38.0 33.0 39.0 26.0 40.0 38 34.4615 38.0 33.0 39.0 27.0 40.0 39 34.37175 38.0 33.0 39.0 26.0 40.0 40 34.14475 37.0 33.0 39.0 26.0 40.0 41 34.24075 38.0 33.0 39.0 26.0 40.0 42 33.986 37.0 33.0 39.0 26.0 40.0 43 33.83975 37.0 33.0 39.0 25.0 40.0 44 33.52075 36.0 32.0 39.0 23.0 40.0 45 33.527 36.0 32.0 39.0 23.0 40.0 46 33.41825 36.0 33.0 39.0 23.0 40.0 47 33.358 36.0 32.0 39.0 23.0 40.0 48 33.0745 36.0 32.0 39.0 23.0 40.0 49 32.9795 36.0 31.0 39.0 23.0 40.0 50 32.7055 36.0 31.0 39.0 23.0 40.0 51 32.69475 36.0 31.0 39.0 22.0 40.0 52 32.34825 36.0 31.0 38.0 20.0 40.0 53 32.19225 35.0 31.0 38.0 20.0 40.0 54 31.9505 35.0 30.0 38.0 18.0 40.0 55 31.86675 35.0 30.0 38.0 18.0 39.0 56 31.64625 35.0 30.0 38.0 17.0 40.0 57 31.39725 35.0 30.0 38.0 16.0 39.0 58 30.98925 35.0 29.0 38.0 13.0 39.0 59 30.88675 35.0 29.0 38.0 11.0 39.0 60 30.55075 35.0 29.0 38.0 8.0 39.0 61 30.3035 35.0 29.0 38.0 2.0 39.0 62 29.94425 35.0 28.0 38.0 2.0 39.0 63 29.9205 34.0 29.0 38.0 2.0 39.0 64 29.48825 34.0 27.0 38.0 2.0 39.0 65 29.28925 34.0 27.0 38.0 2.0 39.0 66 29.08675 34.0 28.0 38.0 2.0 39.0 67 28.699 34.0 27.0 38.0 2.0 39.0 68 28.5235 33.0 27.0 37.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 1.0 4 2.0 5 3.0 6 12.0 7 3.0 8 1.0 9 6.0 10 5.0 11 7.0 12 13.0 13 8.0 14 14.0 15 17.0 16 17.0 17 15.0 18 20.0 19 22.0 20 26.0 21 29.0 22 28.0 23 32.0 24 37.0 25 40.0 26 49.0 27 78.0 28 72.0 29 101.0 30 139.0 31 144.0 32 178.0 33 235.0 34 275.0 35 318.0 36 448.0 37 548.0 38 602.0 39 442.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.174999999999997 16.55 15.65 41.625 2 20.50125313283208 26.11528822055138 34.711779448621556 18.671679197994987 3 23.599999999999998 28.9 25.45 22.05 4 24.7 33.675 20.150000000000002 21.475 5 26.3 35.3 21.925 16.475 6 18.375 38.6 23.025000000000002 20.0 7 16.825000000000003 19.400000000000002 43.475 20.3 8 19.375 23.95 31.2 25.474999999999998 9 20.225 23.95 31.775 24.05 10 20.275000000000002 39.35 23.3 17.075000000000003 11 25.15 29.4 20.674999999999997 24.775 12 21.0 24.575 29.849999999999998 24.575 13 19.175 29.875 30.125 20.825 14 20.424999999999997 28.725 27.950000000000003 22.900000000000002 15 19.5 28.749999999999996 28.95 22.8 16 21.65 27.925 27.725 22.7 17 23.849999999999998 27.900000000000002 26.35 21.9 18 20.724999999999998 28.425 28.000000000000004 22.85 19 20.125 28.199999999999996 27.775 23.9 20 22.175 28.375 27.325 22.125 21 22.400000000000002 29.025000000000002 26.525 22.05 22 21.8 28.375 27.875 21.95 23 21.3 29.825000000000003 28.1 20.775 24 20.225 28.525 28.225 23.025000000000002 25 22.575 25.674999999999997 28.575 23.175 26 20.674999999999997 29.225 28.15 21.95 27 20.724999999999998 28.749999999999996 27.6 22.925 28 20.724999999999998 29.975 28.299999999999997 21.0 29 23.400000000000002 28.325 26.05 22.225 30 21.625 28.325 28.575 21.475 31 21.15 28.125 28.575 22.15 32 22.325 29.875 26.525 21.275 33 21.349999999999998 27.1 28.175 23.375 34 20.5 27.55 29.375 22.575 35 20.625 28.475 29.125 21.775 36 21.099999999999998 28.849999999999998 27.900000000000002 22.15 37 22.525000000000002 27.650000000000002 28.325 21.5 38 23.474999999999998 28.349999999999998 27.6 20.575 39 21.55 28.249999999999996 28.299999999999997 21.9 40 21.25 29.425 27.675 21.65 41 22.85 27.675 27.975 21.5 42 21.85 28.175 27.775 22.2 43 22.400000000000002 26.55 28.375 22.675 44 22.825 28.249999999999996 27.250000000000004 21.675 45 22.575 28.375 27.700000000000003 21.349999999999998 46 21.8 27.55 28.175 22.475 47 23.325000000000003 28.799999999999997 27.500000000000004 20.375 48 21.875 28.199999999999996 28.1 21.825 49 23.474999999999998 27.85 28.000000000000004 20.674999999999997 50 22.925 27.125 26.775 23.175 51 21.125 27.35 29.15 22.375 52 22.55 27.450000000000003 28.025 21.975 53 22.625 27.650000000000002 28.599999999999998 21.125 54 21.6 27.55 28.050000000000004 22.8 55 22.45 27.3 28.7 21.55 56 21.099999999999998 28.299999999999997 29.425 21.175 57 22.375 27.775 27.200000000000003 22.650000000000002 58 21.099999999999998 28.025 28.675 22.2 59 22.900000000000002 27.725 26.724999999999998 22.650000000000002 60 21.975 27.950000000000003 26.875 23.200000000000003 61 22.075 27.55 28.449999999999996 21.925 62 22.45 28.475 28.199999999999996 20.875 63 22.400000000000002 28.15 27.175 22.275 64 21.8 28.125 27.500000000000004 22.575 65 21.3 28.725 28.15 21.825 66 21.625 27.950000000000003 28.275 22.15 67 22.225 28.299999999999997 27.925 21.55 68 21.4 28.325 28.199999999999996 22.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.5 21 2.5 22 3.0 23 2.5 24 5.0 25 8.0 26 7.5 27 14.0 28 21.0 29 22.0 30 33.5 31 44.0 32 52.5 33 94.0 34 127.0 35 140.5 36 189.0 37 224.0 38 234.5 39 289.5 40 331.5 41 329.0 42 339.0 43 339.5 44 330.0 45 323.5 46 322.0 47 327.0 48 317.0 49 244.5 50 182.0 51 175.0 52 137.0 53 106.0 54 96.0 55 69.0 56 52.0 57 47.0 58 37.5 59 33.0 60 33.0 61 32.0 62 31.0 63 23.0 64 14.0 65 9.5 66 6.0 67 7.0 68 5.5 69 3.0 70 2.0 71 1.0 72 1.0 73 2.0 74 1.5 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82363315696648 99.05000000000001 2 0.15117157974300832 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02519526329050139 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTGAAAAA 26 0.65 TruSeq Adapter, Index 3 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10 0.075 0.0 0.0 0.0 0.0 11 0.075 0.0 0.0 0.0 0.0 12 0.075 0.0 0.0 0.0 0.0 13 0.075 0.0 0.0 0.0 0.0 14 0.075 0.0 0.0 0.0 0.0 15 0.075 0.0 0.0 0.0 0.0 16 0.075 0.0 0.0 0.0 0.0 17 0.075 0.0 0.0 0.0 0.0 18 0.075 0.0 0.0 0.0 0.0 19 0.075 0.0 0.0 0.0 0.0 20 0.075 0.0 0.0 0.0 0.0 21 0.075 0.0 0.0 0.0 0.0 22 0.075 0.0 0.0 0.0 0.0 23 0.075 0.0 0.0 0.0 0.0 24 0.075 0.0 0.0 0.0 0.0 25 0.075 0.0 0.0 0.0 0.0 26 0.075 0.0 0.0 0.0 0.0 27 0.075 0.0 0.0 0.0 0.0 28 0.1 0.0 0.0 0.0 0.0 29 0.1 0.0 0.0 0.0 0.0 30 0.1 0.0 0.0 0.0 0.0 31 0.1 0.0 0.0 0.0 0.0 32 0.1 0.0 0.0 0.0 0.0 33 0.1 0.0 0.0 0.0 0.0 34 0.1 0.0 0.0 0.0 0.0 35 0.1 0.0 0.0 0.0 0.0 36 0.1 0.0 0.0 0.0 0.0 37 0.1 0.0 0.0 0.0 0.0 38 0.1 0.0 0.0 0.0 0.0 39 0.1 0.0 0.0 0.0 0.0 40 0.1 0.0 0.0 0.0 0.0 41 0.1 0.0 0.0 0.0 0.0 42 0.1 0.0 0.0 0.0 0.0 43 0.1 0.0 0.0 0.0 0.0 44 0.1 0.0 0.0 0.0 0.0 45 0.1 0.0 0.0 0.0 0.0 46 0.1 0.0 0.0 0.0 0.0 47 0.1 0.0 0.0 0.0 0.0 48 0.1 0.0 0.0 0.0 0.0 49 0.1 0.0 0.0 0.0 0.0 50 0.1 0.0 0.0 0.0 0.0 51 0.1 0.0 0.0 0.0 0.0 52 0.1 0.0 0.0 0.0 0.0 53 0.1 0.0 0.0 0.0 0.0 54 0.1 0.0 0.0 0.0 0.0 55 0.1 0.0 0.0 0.0 0.0 56 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 257220 spots for SRR952887.sra Written 257220 spots for SRR952887.sra Read 257220 spots for SRR952887.sra Written 257220 spots for SRR952887.sra Read 257220 spots for SRR952887.sra Written 257220 spots for SRR952887.sra Read 257220 spots for SRR952887.sra Written 257220 spots for SRR952887.sra Read 257220 spots for SRR952887.sra Written 257220 spots for SRR952887.sra Read 257220 spots for SRR952887.sra Written 257220 spots for SRR952887.sra Read 257220 spots for SRR952887.sra Written 257220 spots for SRR952887.sra Read 257220 spots for SRR952887.sra Written 257220 spots for SRR952887.sra Read 257220 spots for SRR952887.sra Written 257220 spots for SRR952887.sra Read 257220 spots for SRR952887.sra Written 257220 spots for SRR952887.sra Read 257220 spots for SRR952887.sra Written 257220 spots for SRR952887.sra Read 257220 spots for SRR952887.sra Written 257220 spots for SRR952887.sra Read 257220 spots for SRR952887.sra Written 257220 spots for SRR952887.sra Read 257237 spots for SRR952887.sra Written 257237 spots for SRR952887.sra Read 257220 spots for SRR952887.sra Written 257220 spots for SRR952887.sra Read 257220 spots for SRR952887.sra Written 257220 spots for SRR952887.sra Read 257220 spots for SRR952887.sra Written 257220 spots for SRR952887.sra Read 257220 spots for SRR952887.sra Written 257220 spots for SRR952887.sra Read 257220 spots for SRR952887.sra Written 257220 spots for SRR952887.sra Read 257220 spots for SRR952887.sra Written 257220 spots for SRR952887.sra SRR ids: ['SRR952887.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4dp4wwdo SRR952887.sra spots: 5144417 blocks: [[1, 257220], [257221, 514440], [514441, 771660], [771661, 1028880], [1028881, 1286100], [1286101, 1543320], [1543321, 1800540], [1800541, 2057760], [2057761, 2314980], [2314981, 2572200], [2572201, 2829420], [2829421, 3086640], [3086641, 3343860], [3343861, 3601080], [3601081, 3858300], [3858301, 4115520], [4115521, 4372740], [4372741, 4629960], [4629961, 4887180], [4887181, 5144417]] SRR952887 file size 1074974 SRR952887 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR952887 SRR952887_1.fastq Input file: SRR952887_1.fastq trimmed: SRR952887-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 10:51:51 2025 >> started Mon Feb 10 10:51:54 2025 >> done (2.595s) 5144417 reads processed; of these: 30481 ( 0.59%) short reads filtered out after trimming by size control 58777 ( 1.14%) empty reads filtered out after trimming by size control 5055159 (98.26%) reads available; of these: 698015 (13.81%) trimmed reads available after processing 4357144 (86.19%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1951 0.04% 19 2952 0.06% 20 4903 0.10% 21 1527 0.03% 22 2180 0.04% 23 3333 0.07% 24 5297 0.10% 25 9055 0.18% 26 2262 0.04% 27 3063 0.06% 28 4337 0.09% 29 6610 0.13% 30 10060 0.20% 31 2530 0.05% 32 3411 0.07% 33 4976 0.10% 34 7711 0.15% 35 12181 0.24% 36 3014 0.06% 37 4425 0.09% 38 6084 0.12% 39 10112 0.20% 40 15766 0.31% 41 3929 0.08% 42 5233 0.10% 43 7830 0.15% 44 13176 0.26% 45 21547 0.43% 46 5106 0.10% 47 6816 0.13% 48 10424 0.21% 49 17491 0.35% 50 29541 0.58% 51 6502 0.13% 52 9116 0.18% 53 13767 0.27% 54 23999 0.47% 55 42276 0.84% 56 8404 0.17% 57 11980 0.24% 58 18327 0.36% 59 33611 0.66% 60 61171 1.21% 61 11656 0.23% 62 16041 0.32% 63 25959 0.51% 64 46616 0.92% 65 77403 1.53% 66 16050 0.32% 67 26304 0.52% 68 4357144 86.19% 5055159 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=36.81 fanout-score-rank=9 prefix-density=0.11 prefix-fanout=11.9 sequence=CAGCAGCAGCAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=17 fanout-score=310.85 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=24.6 sequence=AAGAAGAAGAGA Started job on | Feb 10 10:52:14 Started mapping on | Feb 10 10:52:14 Finished on | Feb 10 10:52:21 Mapping speed, Million of reads per hour | 2599.80 Number of input reads | 5055159 Average input read length | 65 UNIQUE READS: Uniquely mapped reads number | 4566004 Uniquely mapped reads % | 90.32% Average mapped length | 66.01 Number of splices: Total | 913616 Number of splices: Annotated (sjdb) | 895939 Number of splices: GT/AG | 899473 Number of splices: GC/AG | 12179 Number of splices: AT/AC | 889 Number of splices: Non-canonical | 1075 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.79 Insertion rate per base | 0.01% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 256522 % of reads mapped to multiple loci | 5.07% Number of reads mapped to too many loci | 54547 % of reads mapped to too many loci | 1.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.51% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 232633 232633 232633 N_multimapping 256522 256522 256522 N_noFeature 225962 2350458 2426884 N_ambiguous 27033 6293 6244 UnstrandedReadsAssigned:4313009 PositiveStrandReadsAssigned:2209253 NegativeStrandReadsAssigned:2132876 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR952887 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR952887-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,055,159 reads, 4,480,566 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52401 SRR952887.ke.tsv 34699 SRR952887.se.tsv 87100 total ==> SRR952887.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1051 177.72 Potri.005G024800.1.v4.1 1035 936 588 203.85 Potri.004G059700.1.v4.1 961 862 1 0.376444 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 149.207 17.0243 Potri.016G087400.1.v4.1 270 171 96 182.173 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 104.154 20.1896 Potri.012G127500.1.v4.1 977 878 1228 453.85 ==> SRR952887.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 9 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 97 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 6 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 5 Potri.001G452600.v4.1 0 SRR952887 completed mapping pipeline successfully