Starting /dee2/code/volunteer_pipeline.sh SRR952888 current disk space = 3058792730624 free memory = 1536413792 SRR952888 SRAfilesize 7a8fc6d4894c6a514be14bf90ea6e799 SRR952888.sra SRR952888.sra file validated SRR952888 is single end SRR952888 is conventional basespace SRR952888 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR952888_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.6575 36.0 33.0 38.0 28.0 39.0 2 34.01375 36.0 32.0 38.0 25.0 40.0 3 33.8145 36.0 31.0 38.0 25.0 39.0 4 34.03425 36.0 32.0 38.0 25.0 39.0 5 34.001 36.0 32.0 39.0 25.0 39.0 6 34.7165 37.0 33.0 39.0 28.0 40.0 7 34.79575 37.0 33.0 39.0 27.0 40.0 8 34.505 36.0 33.0 39.0 27.0 40.0 9 34.537 36.0 33.0 39.0 27.0 40.0 10 34.49225 36.0 33.0 38.0 27.0 40.0 11 34.462 36.0 33.0 39.0 26.0 40.0 12 34.56075 36.0 33.0 38.0 27.0 40.0 13 34.27425 36.0 33.0 38.0 26.0 39.0 14 34.6765 36.0 33.0 38.0 27.0 40.0 15 34.43175 36.0 33.0 38.0 27.0 39.0 16 34.4415 36.0 33.0 39.0 27.0 40.0 17 34.15425 36.0 33.0 38.0 26.0 39.0 18 34.1885 36.0 33.0 38.0 26.0 39.0 19 33.88125 36.0 32.0 38.0 26.0 39.0 20 34.1035 36.0 32.0 38.0 26.0 39.0 21 34.1315 36.0 33.0 38.0 26.0 40.0 22 33.81025 36.0 32.0 38.0 25.0 39.0 23 33.78475 36.0 32.0 38.0 25.0 39.0 24 33.7675 36.0 32.0 38.0 26.0 39.0 25 33.59675 36.0 32.0 38.0 25.0 39.0 26 33.68475 36.0 33.0 38.0 25.0 39.0 27 33.175 36.0 31.0 38.0 24.0 39.0 28 33.075 36.0 31.0 38.0 23.0 39.0 29 33.058 35.0 31.0 38.0 23.0 39.0 30 32.9005 35.0 31.0 38.0 23.0 39.0 31 32.745 36.0 31.0 38.0 22.0 39.0 32 32.05375 35.0 30.0 38.0 20.0 39.0 33 31.99875 35.0 30.0 38.0 20.0 39.0 34 31.83725 35.0 29.0 38.0 20.0 39.0 35 31.6295 35.0 29.0 38.0 19.0 39.0 36 31.97725 35.0 30.0 38.0 20.0 39.0 37 31.806 35.0 30.0 38.0 20.0 39.0 38 30.956 34.0 28.0 38.0 18.0 39.0 39 30.55725 34.0 28.0 38.0 17.0 39.0 40 30.89475 34.0 29.0 38.0 17.0 39.0 41 30.6775 35.0 29.0 38.0 15.0 39.0 42 30.584 34.0 29.0 38.0 15.0 39.0 43 30.32525 34.0 28.0 38.0 15.0 39.0 44 30.43975 34.0 28.0 38.0 15.0 39.0 45 30.1 33.0 28.0 38.0 13.0 39.0 46 30.0165 34.0 28.0 38.0 10.0 39.0 47 29.71025 33.0 27.0 38.0 9.0 39.0 48 29.64325 33.0 27.0 38.0 8.0 39.0 49 29.22 33.0 27.0 37.0 2.0 39.0 50 29.124 33.0 27.0 37.0 2.0 39.0 51 28.95025 33.0 27.0 37.0 2.0 39.0 52 28.3795 33.0 25.0 36.0 2.0 38.0 53 28.51175 33.0 26.0 36.0 2.0 38.0 54 27.697 33.0 23.0 36.0 2.0 38.0 55 27.433 33.0 23.0 36.0 2.0 38.0 56 27.3065 33.0 23.0 36.0 2.0 38.0 57 26.767 32.0 23.0 36.0 2.0 38.0 58 26.5495 32.0 23.0 36.0 2.0 38.0 59 26.44175 32.0 23.0 36.0 2.0 38.0 60 25.95775 31.0 20.0 35.0 2.0 38.0 61 25.38625 31.0 18.0 35.0 2.0 38.0 62 24.857 30.0 16.0 35.0 2.0 38.0 63 24.81225 31.0 16.0 35.0 2.0 38.0 64 23.74925 30.0 9.0 35.0 2.0 37.0 65 23.3105 30.0 2.0 35.0 2.0 37.0 66 23.42225 30.0 2.0 35.0 2.0 38.0 67 23.1295 30.0 2.0 35.0 2.0 38.0 68 23.051 30.0 2.0 35.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 5.0 5 3.0 6 3.0 7 8.0 8 12.0 9 17.0 10 16.0 11 29.0 12 21.0 13 23.0 14 33.0 15 27.0 16 25.0 17 36.0 18 33.0 19 37.0 20 55.0 21 62.0 22 67.0 23 85.0 24 78.0 25 85.0 26 113.0 27 123.0 28 149.0 29 187.0 30 166.0 31 219.0 32 262.0 33 319.0 34 337.0 35 367.0 36 389.0 37 348.0 38 225.0 39 28.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.525 17.025000000000002 16.3 41.15 2 22.22501255650427 28.176795580110497 32.772476142641885 16.825715720743347 3 23.849999999999998 30.675 24.875 20.599999999999998 4 22.075 34.825 21.55 21.55 5 25.6 37.85 21.775 14.774999999999999 6 17.65 40.475 23.325000000000003 18.55 7 16.125 19.025 44.025 20.825 8 18.3 24.0 31.924999999999997 25.775 9 20.549999999999997 23.799999999999997 31.05 24.6 10 18.8 39.0 24.975 17.224999999999998 11 24.85 30.3 21.775 23.075000000000003 12 22.0 26.1 28.849999999999998 23.05 13 19.45 28.499999999999996 31.45 20.599999999999998 14 21.175 28.375 29.525000000000002 20.925 15 22.025 28.15 27.6 22.225 16 20.825 28.125 28.775000000000002 22.275 17 20.549999999999997 30.375000000000004 27.250000000000004 21.825 18 22.650000000000002 29.299999999999997 27.625 20.424999999999997 19 22.025 28.249999999999996 27.825 21.9 20 22.1 29.9 27.800000000000004 20.200000000000003 21 22.25 29.2 27.375 21.175 22 22.0 27.6 28.425 21.975 23 22.400000000000002 28.549999999999997 26.724999999999998 22.325 24 20.95 28.15 28.050000000000004 22.85 25 21.5 29.975 26.825 21.7 26 21.7 28.575 28.1 21.625 27 21.525 27.925 28.199999999999996 22.35 28 20.7 28.375 28.625 22.3 29 21.75 28.175 28.1 21.975 30 21.525 29.175 27.325 21.975 31 21.45 28.549999999999997 27.700000000000003 22.3 32 21.45 29.175 27.675 21.7 33 21.125 28.725 28.375 21.775 34 22.0 28.449999999999996 28.7 20.849999999999998 35 23.375 26.700000000000003 28.199999999999996 21.725 36 22.475 29.325000000000003 26.775 21.425 37 21.224999999999998 29.125 27.05 22.6 38 22.475 28.625 27.275 21.625 39 22.25 29.125 27.725 20.9 40 22.45 28.325 27.900000000000002 21.325 41 22.400000000000002 27.525 27.525 22.55 42 20.625 29.349999999999998 28.599999999999998 21.425 43 21.55 27.975 28.175 22.3 44 21.8 28.275 27.55 22.375 45 23.674999999999997 28.875 28.125 19.325 46 21.875 28.875 27.575 21.675 47 22.650000000000002 28.95 27.250000000000004 21.15 48 21.7 28.625 27.725 21.95 49 21.5 27.575 29.099999999999998 21.825 50 21.9 28.1 28.425 21.575 51 22.325 29.825000000000003 27.1 20.75 52 21.875 28.475 28.349999999999998 21.3 53 22.55 28.000000000000004 28.499999999999996 20.95 54 22.05 28.449999999999996 28.849999999999998 20.65 55 20.95 30.175 27.474999999999998 21.4 56 22.625 28.95 29.525000000000002 18.9 57 22.8 28.549999999999997 27.474999999999998 21.175 58 22.275 27.750000000000004 28.475 21.5 59 22.475 27.474999999999998 28.249999999999996 21.8 60 21.6 27.950000000000003 28.599999999999998 21.85 61 22.125 27.575 27.900000000000002 22.400000000000002 62 22.175 29.099999999999998 27.825 20.9 63 22.1 27.950000000000003 27.775 22.175 64 20.974999999999998 29.175 28.249999999999996 21.6 65 21.975 28.525 28.449999999999996 21.05 66 22.55 28.975 26.325 22.15 67 22.125 29.025000000000002 27.474999999999998 21.375 68 22.55 30.25 26.700000000000003 20.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 2.0 22 3.0 23 3.5 24 3.0 25 2.0 26 7.5 27 14.0 28 15.0 29 24.5 30 50.5 31 67.0 32 74.5 33 95.0 34 108.0 35 142.0 36 197.0 37 218.0 38 253.5 39 312.0 40 345.0 41 355.0 42 368.0 43 360.0 44 339.0 45 320.5 46 299.0 47 296.0 48 277.5 49 227.0 50 195.0 51 159.0 52 119.5 53 116.0 54 107.0 55 71.0 56 44.0 57 39.5 58 35.0 59 35.0 60 24.0 61 12.0 62 11.0 63 10.0 64 8.0 65 6.5 66 6.0 67 6.5 68 5.0 69 3.0 70 5.5 71 6.5 72 5.0 73 2.5 74 1.5 75 3.0 76 1.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87481221832749 99.725 2 0.10015022533800699 0.2 3 0.025037556334501748 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10 0.075 0.0 0.0 0.0 0.0 11 0.075 0.0 0.0 0.0 0.0 12 0.075 0.0 0.0 0.0 0.0 13 0.075 0.0 0.0 0.0 0.0 14 0.075 0.0 0.0 0.0 0.0 15 0.075 0.0 0.0 0.0 0.0 16 0.075 0.0 0.0 0.0 0.0 17 0.075 0.0 0.0 0.0 0.0 18 0.075 0.0 0.0 0.0 0.0 19 0.075 0.0 0.0 0.0 0.0 20 0.075 0.0 0.0 0.0 0.0 21 0.075 0.0 0.0 0.0 0.0 22 0.075 0.0 0.0 0.0 0.0 23 0.075 0.0 0.0 0.0 0.0 24 0.075 0.0 0.0 0.0 0.0 25 0.075 0.0 0.0 0.0 0.0 26 0.075 0.0 0.0 0.0 0.0 27 0.075 0.0 0.0 0.0 0.0 28 0.075 0.0 0.0 0.0 0.0 29 0.075 0.0 0.0 0.0 0.0 30 0.075 0.0 0.0 0.0 0.0 31 0.075 0.0 0.0 0.0 0.0 32 0.075 0.0 0.0 0.0 0.0 33 0.075 0.0 0.0 0.0 0.0 34 0.075 0.0 0.0 0.0 0.0 35 0.075 0.0 0.0 0.0 0.0 36 0.075 0.0 0.0 0.0 0.0 37 0.075 0.0 0.0 0.0 0.0 38 0.075 0.0 0.0 0.0 0.0 39 0.075 0.0 0.0 0.0 0.0 40 0.075 0.0 0.0 0.0 0.0 41 0.075 0.0 0.0 0.0 0.0 42 0.075 0.0 0.0 0.0 0.0 43 0.075 0.0 0.0 0.0 0.0 44 0.075 0.0 0.0 0.0 0.0 45 0.075 0.0 0.0 0.0 0.0 46 0.075 0.0 0.0 0.0 0.0 47 0.075 0.0 0.0 0.0 0.0 48 0.075 0.0 0.0 0.0 0.0 49 0.075 0.0 0.0 0.0 0.0 50 0.075 0.0 0.0 0.0 0.0 51 0.075 0.0 0.0 0.0 0.0 52 0.075 0.0 0.0 0.0 0.0 53 0.075 0.0 0.0 0.0 0.0 54 0.075 0.0 0.0 0.0 0.0 55 0.075 0.0 0.0 0.0 0.0 56 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 307894 spots for SRR952888.sra Written 307894 spots for SRR952888.sra Read 307894 spots for SRR952888.sra Written 307894 spots for SRR952888.sra Read 307894 spots for SRR952888.sra Written 307894 spots for SRR952888.sra Read 307894 spots for SRR952888.sra Written 307894 spots for SRR952888.sra Read 307894 spots for SRR952888.sra Written 307894 spots for SRR952888.sra Read 307894 spots for SRR952888.sra Written 307894 spots for SRR952888.sra Read 307894 spots for SRR952888.sra Written 307894 spots for SRR952888.sra Read 307894 spots for SRR952888.sra Written 307894 spots for SRR952888.sra Read 307894 spots for SRR952888.sra Written 307894 spots for SRR952888.sra Read 307894 spots for SRR952888.sra Written 307894 spots for SRR952888.sra Read 307901 spots for SRR952888.sra Written 307901 spots for SRR952888.sra Read 307894 spots for SRR952888.sra Written 307894 spots for SRR952888.sra Read 307894 spots for SRR952888.sra Written 307894 spots for SRR952888.sra Read 307894 spots for SRR952888.sra Written 307894 spots for SRR952888.sra Read 307894 spots for SRR952888.sra Written 307894 spots for SRR952888.sra Read 307894 spots for SRR952888.sra Written 307894 spots for SRR952888.sra Read 307894 spots for SRR952888.sra Written 307894 spots for SRR952888.sra Read 307894 spots for SRR952888.sra Written 307894 spots for SRR952888.sra Read 307894 spots for SRR952888.sra Written 307894 spots for SRR952888.sra Read 307894 spots for SRR952888.sra Written 307894 spots for SRR952888.sra SRR ids: ['SRR952888.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ol4jp522 SRR952888.sra spots: 6157887 blocks: [[1, 307894], [307895, 615788], [615789, 923682], [923683, 1231576], [1231577, 1539470], [1539471, 1847364], [1847365, 2155258], [2155259, 2463152], [2463153, 2771046], [2771047, 3078940], [3078941, 3386834], [3386835, 3694728], [3694729, 4002622], [4002623, 4310516], [4310517, 4618410], [4618411, 4926304], [4926305, 5234198], [5234199, 5542092], [5542093, 5849986], [5849987, 6157887]] SRR952888 file size 1286915 SRR952888 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR952888 SRR952888_1.fastq Input file: SRR952888_1.fastq trimmed: SRR952888-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 10:57:06 2025 >> started Mon Feb 10 10:57:09 2025 >> done (3.143s) 6157887 reads processed; of these: 27925 ( 0.45%) short reads filtered out after trimming by size control 25769 ( 0.42%) empty reads filtered out after trimming by size control 6104193 (99.13%) reads available; of these: 970565 (15.90%) trimmed reads available after processing 5133628 (84.10%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3161 0.05% 19 5211 0.09% 20 7850 0.13% 21 2433 0.04% 22 3663 0.06% 23 5555 0.09% 24 9273 0.15% 25 14869 0.24% 26 3812 0.06% 27 5291 0.09% 28 7058 0.12% 29 11096 0.18% 30 17123 0.28% 31 4693 0.08% 32 5669 0.09% 33 8239 0.13% 34 12006 0.20% 35 18349 0.30% 36 4596 0.08% 37 5970 0.10% 38 8566 0.14% 39 12482 0.20% 40 18954 0.31% 41 4788 0.08% 42 6562 0.11% 43 10101 0.17% 44 16141 0.26% 45 24390 0.40% 46 5932 0.10% 47 8959 0.15% 48 14113 0.23% 49 23428 0.38% 50 40093 0.66% 51 9086 0.15% 52 13353 0.22% 53 21311 0.35% 54 35274 0.58% 55 58692 0.96% 56 12447 0.20% 57 17516 0.29% 58 27174 0.45% 59 46295 0.76% 60 78517 1.29% 61 16536 0.27% 62 24102 0.39% 63 38171 0.63% 64 64287 1.05% 65 101210 1.66% 66 22905 0.38% 67 33263 0.54% 68 5133628 84.10% 6104193 reads passed initial QC criterion=sequence-density sequence-density=0.03 sequence-density-rank=1 fanout-score=35.55 fanout-score-rank=16 prefix-density=0.11 prefix-fanout=11.3 sequence=CAGCAGCAGCAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=19 fanout-score=279.18 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=22.4 sequence=AAGAAGAAGAGA Started job on | Feb 10 10:57:22 Started mapping on | Feb 10 10:57:22 Finished on | Feb 10 10:57:31 Mapping speed, Million of reads per hour | 2441.68 Number of input reads | 6104193 Average input read length | 65 UNIQUE READS: Uniquely mapped reads number | 5588618 Uniquely mapped reads % | 91.55% Average mapped length | 65.65 Number of splices: Total | 1123208 Number of splices: Annotated (sjdb) | 1103716 Number of splices: GT/AG | 1106053 Number of splices: GC/AG | 14902 Number of splices: AT/AC | 986 Number of splices: Non-canonical | 1267 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 1.78 Insertion rate per base | 0.01% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 318920 % of reads mapped to multiple loci | 5.22% Number of reads mapped to too many loci | 49115 % of reads mapped to too many loci | 0.80% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.41% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 196655 196655 196655 N_multimapping 318920 318920 318920 N_noFeature 264761 2836722 2998138 N_ambiguous 32782 7377 7018 UnstrandedReadsAssigned:5291075 PositiveStrandReadsAssigned:2744519 NegativeStrandReadsAssigned:2583462 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=65 echo kmer=61 SRR952888 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR952888-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,104,193 reads, 5,455,659 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,058 rounds 52401 SRR952888.ke.tsv 34699 SRR952888.se.tsv 87100 total ==> SRR952888.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1104 150.356 Potri.005G024800.1.v4.1 1035 936 554.221 154.751 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 207.029 19.0252 Potri.016G087400.1.v4.1 270 171 200 305.676 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 231.392 36.126 Potri.012G127500.1.v4.1 977 878 1047 311.659 ==> SRR952888.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 25 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 105 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 6 Potri.001G452600.v4.1 1 SRR952888 completed mapping pipeline successfully