Starting /dee2/code/volunteer_pipeline.sh SRR952889 current disk space = 3058832859136 free memory = 1514551680 SRR952889 SRAfilesize b5ed82519a15540b56a5d6686b5861a5 SRR952889.sra SRR952889.sra file validated SRR952889 is single end SRR952889 is conventional basespace SRR952889 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR952889_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3605 38.0 35.0 39.0 33.0 40.0 2 35.59325 38.0 35.0 39.0 30.0 40.0 3 35.0515 38.0 33.0 39.0 28.0 40.0 4 35.6805 38.0 35.0 39.0 30.0 40.0 5 34.93925 38.0 33.0 39.0 27.0 40.0 6 35.1265 38.0 34.0 39.0 28.0 40.0 7 34.2235 37.0 33.0 39.0 26.0 39.0 8 34.094 36.0 33.0 39.0 26.0 39.0 9 33.6825 36.0 32.0 38.0 24.0 39.0 10 34.45175 37.0 33.0 39.0 27.0 39.0 11 33.39675 36.0 31.0 38.0 23.0 39.0 12 33.0575 36.0 30.0 38.0 23.0 39.0 13 32.76575 35.0 30.0 38.0 23.0 39.0 14 32.618 35.0 30.0 38.0 23.0 39.0 15 32.6585 35.0 30.0 38.0 23.0 39.0 16 32.761 35.0 30.0 38.0 23.0 39.0 17 32.7745 35.0 30.0 38.0 23.0 39.0 18 32.48175 35.0 30.0 38.0 23.0 39.0 19 32.4435 35.0 30.0 38.0 23.0 39.0 20 32.33325 35.0 30.0 38.0 23.0 39.0 21 32.55525 35.0 31.0 38.0 22.0 39.0 22 32.3255 35.0 30.0 38.0 22.0 39.0 23 32.5645 35.0 30.0 38.0 23.0 39.0 24 32.202 35.0 30.0 38.0 22.0 39.0 25 32.1495 35.0 30.0 38.0 21.0 39.0 26 32.04075 35.0 30.0 38.0 19.0 39.0 27 31.55675 35.0 30.0 38.0 18.0 39.0 28 31.5605 35.0 29.0 38.0 18.0 39.0 29 31.16125 35.0 29.0 38.0 18.0 39.0 30 30.64825 34.0 29.0 38.0 15.0 39.0 31 30.28475 35.0 28.0 38.0 10.0 39.0 32 29.2815 33.0 26.0 37.0 9.0 39.0 33 29.15175 33.0 26.0 36.0 9.0 39.0 34 28.55725 33.0 25.0 36.0 8.0 39.0 35 28.87275 33.0 26.0 36.0 7.0 39.0 36 28.743 33.0 25.0 36.0 2.0 39.0 37 28.20775 33.0 24.0 36.0 2.0 38.0 38 28.08775 33.0 24.0 36.0 2.0 38.0 39 28.2365 33.0 25.0 36.0 2.0 38.0 40 27.837 32.0 24.0 36.0 2.0 38.0 41 28.037 33.0 25.0 36.0 2.0 38.0 42 27.804 32.0 24.0 36.0 2.0 38.0 43 27.57375 32.0 23.0 36.0 2.0 38.0 44 27.702 32.0 24.0 36.0 2.0 38.0 45 27.52175 32.0 24.0 36.0 2.0 38.0 46 27.33975 32.0 23.0 36.0 2.0 38.0 47 27.8685 33.0 25.0 36.0 2.0 38.0 48 27.39125 32.0 24.0 36.0 2.0 38.0 49 27.43325 32.0 24.0 36.0 2.0 38.0 50 27.20375 32.0 23.0 36.0 2.0 38.0 51 26.8275 32.0 23.0 36.0 2.0 38.0 52 26.43175 32.0 23.0 35.0 2.0 38.0 53 26.623 32.0 23.0 36.0 2.0 38.0 54 25.7945 31.0 21.0 35.0 2.0 38.0 55 26.00125 32.0 22.0 35.0 2.0 38.0 56 24.36475 31.0 13.0 35.0 2.0 37.0 57 24.49075 31.0 15.0 35.0 2.0 37.0 58 24.0665 30.0 13.0 34.0 2.0 36.0 59 23.319 29.0 9.0 33.0 2.0 36.0 60 23.16075 29.0 2.0 34.0 2.0 36.0 61 23.1135 30.0 2.0 34.0 2.0 36.0 62 23.03825 29.0 2.0 34.0 2.0 36.0 63 22.5265 29.0 2.0 33.0 2.0 36.0 64 22.03825 29.0 2.0 33.0 2.0 36.0 65 21.85325 29.0 2.0 33.0 2.0 36.0 66 21.44375 29.0 2.0 33.0 2.0 36.0 67 21.3015 29.0 2.0 33.0 2.0 36.0 68 20.55325 27.0 2.0 33.0 2.0 36.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 37.0 3 14.0 4 13.0 5 12.0 6 23.0 7 18.0 8 20.0 9 31.0 10 35.0 11 47.0 12 43.0 13 40.0 14 42.0 15 41.0 16 43.0 17 36.0 18 26.0 19 51.0 20 59.0 21 61.0 22 69.0 23 76.0 24 84.0 25 104.0 26 127.0 27 125.0 28 140.0 29 173.0 30 185.0 31 218.0 32 247.0 33 291.0 34 349.0 35 377.0 36 374.0 37 253.0 38 105.0 39 11.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.47786720321932 15.970824949698189 14.159959758551308 44.39134808853119 2 19.45 25.025 36.95 18.575 3 22.2 27.075 27.975 22.75 4 25.324999999999996 31.125000000000004 21.525 22.025 5 25.124999999999996 34.325 23.325000000000003 17.224999999999998 6 18.525 36.75 25.900000000000002 18.825 7 15.174999999999999 18.125 45.525 21.175 8 19.025 22.650000000000002 32.65 25.674999999999997 9 18.95 22.975 33.2 24.875 10 19.575 38.875 25.124999999999996 16.425 11 24.525 28.999999999999996 21.925 24.55 12 20.825 24.775 30.25 24.15 13 19.950000000000003 27.125 31.574999999999996 21.349999999999998 14 19.8 28.025 29.175 23.0 15 18.95 29.049999999999997 29.975 22.025 16 21.875 28.175 27.825 22.125 17 21.3 28.449999999999996 27.925 22.325 18 21.85 27.800000000000004 27.750000000000004 22.6 19 22.45 28.075 26.924999999999997 22.55 20 21.475 28.000000000000004 27.400000000000002 23.125 21 21.275 29.475 28.1 21.15 22 21.25 28.525 28.125 22.1 23 20.724999999999998 30.375000000000004 27.375 21.525 24 22.225 28.075 27.05 22.650000000000002 25 20.95 28.599999999999998 27.975 22.475 26 21.575 28.4 28.65 21.375 27 21.675 28.349999999999998 28.050000000000004 21.925 28 21.875 28.65 27.900000000000002 21.575 29 21.65 28.799999999999997 27.150000000000002 22.400000000000002 30 22.525000000000002 28.725 27.35 21.4 31 21.675 29.475 26.825 22.025 32 21.725 27.875 26.775 23.625 33 21.625 27.575 28.575 22.225 34 21.25 28.825 27.3 22.625 35 22.375 28.875 27.575 21.175 36 21.25 28.7 27.975 22.075 37 22.025 28.225 27.750000000000004 22.0 38 22.275 27.35 27.825 22.55 39 21.925 27.700000000000003 28.4 21.975 40 21.475 28.525 28.199999999999996 21.8 41 22.675 28.175 28.050000000000004 21.099999999999998 42 22.025 27.075 28.775000000000002 22.125 43 22.125 27.05 29.9 20.925 44 22.575 28.249999999999996 28.225 20.95 45 21.9 27.425 28.599999999999998 22.075 46 22.675 25.775 27.925 23.625 47 21.9 28.175 28.299999999999997 21.625 48 21.099999999999998 27.625 29.625 21.65 49 21.4 27.700000000000003 28.375 22.525000000000002 50 21.775 28.349999999999998 27.474999999999998 22.400000000000002 51 21.325 26.85 28.775000000000002 23.05 52 22.625 27.700000000000003 27.825 21.85 53 22.475 27.525 27.05 22.95 54 22.15 28.725 27.400000000000002 21.725 55 24.05 26.75 27.85 21.349999999999998 56 21.975 28.349999999999998 26.724999999999998 22.95 57 21.625 26.650000000000002 29.45 22.275 58 22.525000000000002 27.150000000000002 28.475 21.85 59 22.925 27.025 27.800000000000004 22.25 60 22.7 28.575 27.075 21.65 61 21.7 29.125 27.725 21.45 62 22.75 27.675 27.1 22.475 63 22.725 27.925 26.775 22.575 64 21.7 28.125 28.025 22.15 65 22.175 28.925 27.525 21.375 66 22.125 27.925 27.224999999999998 22.725 67 23.150000000000002 27.400000000000002 27.224999999999998 22.225 68 23.175 28.575 27.125 21.125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 1.5 21 0.5 22 0.0 23 5.0 24 9.0 25 8.0 26 8.0 27 12.0 28 16.0 29 19.5 30 35.0 31 47.0 32 51.5 33 89.0 34 122.0 35 126.5 36 151.5 37 172.0 38 215.0 39 271.0 40 318.5 41 353.0 42 367.5 43 384.5 44 387.0 45 365.0 46 338.5 47 334.0 48 304.5 49 238.0 50 201.0 51 182.5 52 148.5 53 133.0 54 114.0 55 70.0 56 45.0 57 39.0 58 31.5 59 30.0 60 28.5 61 25.5 62 24.0 63 15.5 64 6.5 65 4.5 66 3.0 67 6.0 68 7.5 69 6.0 70 3.5 71 1.0 72 1.0 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 472869 spots for SRR952889.sra Written 472869 spots for SRR952889.sra Read 472869 spots for SRR952889.sra Written 472869 spots for SRR952889.sra Read 472869 spots for SRR952889.sra Written 472869 spots for SRR952889.sra Read 472869 spots for SRR952889.sra Written 472869 spots for SRR952889.sra Read 472869 spots for SRR952889.sra Written 472869 spots for SRR952889.sra Read 472869 spots for SRR952889.sra Written 472869 spots for SRR952889.sra Read 472869 spots for SRR952889.sra Written 472869 spots for SRR952889.sra Read 472869 spots for SRR952889.sra Written 472869 spots for SRR952889.sra Read 472869 spots for SRR952889.sra Written 472869 spots for SRR952889.sra Read 472869 spots for SRR952889.sra Written 472869 spots for SRR952889.sra Read 472869 spots for SRR952889.sra Written 472869 spots for SRR952889.sra Read 472869 spots for SRR952889.sra Written 472869 spots for SRR952889.sra Read 472869 spots for SRR952889.sra Written 472869 spots for SRR952889.sra Read 472869 spots for SRR952889.sra Written 472869 spots for SRR952889.sra Read 472869 spots for SRR952889.sra Written 472869 spots for SRR952889.sra Read 472869 spots for SRR952889.sra Written 472869 spots for SRR952889.sra Read 472869 spots for SRR952889.sra Written 472869 spots for SRR952889.sra Read 472869 spots for SRR952889.sra Written 472869 spots for SRR952889.sra Read 472874 spots for SRR952889.sra Written 472874 spots for SRR952889.sra Read 472869 spots for SRR952889.sra Written 472869 spots for SRR952889.sra SRR ids: ['SRR952889.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k1hdrald SRR952889.sra spots: 9457385 blocks: [[1, 472869], [472870, 945738], [945739, 1418607], [1418608, 1891476], [1891477, 2364345], [2364346, 2837214], [2837215, 3310083], [3310084, 3782952], [3782953, 4255821], [4255822, 4728690], [4728691, 5201559], [5201560, 5674428], [5674429, 6147297], [6147298, 6620166], [6620167, 7093035], [7093036, 7565904], [7565905, 8038773], [8038774, 8511642], [8511643, 8984511], [8984512, 9457385]] SRR952889 file size 1977071 SRR952889 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR952889 SRR952889_1.fastq Input file: SRR952889_1.fastq trimmed: SRR952889-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 11:05:57 2025 >> started Mon Feb 10 11:06:01 2025 >> done (4.692s) 9457385 reads processed; of these: 28268 ( 0.30%) short reads filtered out after trimming by size control 32504 ( 0.34%) empty reads filtered out after trimming by size control 9396613 (99.36%) reads available; of these: 1027099 (10.93%) trimmed reads available after processing 8369514 (89.07%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3190 0.03% 19 4771 0.05% 20 7709 0.08% 21 2356 0.03% 22 3464 0.04% 23 5482 0.06% 24 8636 0.09% 25 14294 0.15% 26 3828 0.04% 27 5183 0.06% 28 6862 0.07% 29 10441 0.11% 30 17161 0.18% 31 4518 0.05% 32 5254 0.06% 33 7215 0.08% 34 11015 0.12% 35 16790 0.18% 36 4546 0.05% 37 5692 0.06% 38 8071 0.09% 39 12525 0.13% 40 19205 0.20% 41 4618 0.05% 42 6696 0.07% 43 9884 0.11% 44 15307 0.16% 45 25858 0.28% 46 5873 0.06% 47 8396 0.09% 48 12755 0.14% 49 21998 0.23% 50 37396 0.40% 51 8958 0.10% 52 13247 0.14% 53 20234 0.22% 54 33273 0.35% 55 59494 0.63% 56 12285 0.13% 57 17772 0.19% 58 28504 0.30% 59 50334 0.54% 60 94094 1.00% 61 18222 0.19% 62 26274 0.28% 63 41553 0.44% 64 74410 0.79% 65 127117 1.35% 66 24838 0.26% 67 39501 0.42% 68 8369514 89.07% 9396613 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=26 prefix-density=0.06 prefix-fanout=2.0 sequence=CAAGGTAAGAGTTCATGGCCAGAGCT criterion=fanout-score sequence-density=0.03 sequence-density-rank=11 fanout-score=204.69 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=23.1 sequence=TTCTTCTTCTTC Started job on | Feb 10 11:06:22 Started mapping on | Feb 10 11:06:23 Finished on | Feb 10 11:06:33 Mapping speed, Million of reads per hour | 3382.78 Number of input reads | 9396613 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 8431407 Uniquely mapped reads % | 89.73% Average mapped length | 66.44 Number of splices: Total | 1722560 Number of splices: Annotated (sjdb) | 1694640 Number of splices: GT/AG | 1697134 Number of splices: GC/AG | 22137 Number of splices: AT/AC | 1371 Number of splices: Non-canonical | 1918 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.83 Insertion rate per base | 0.01% Insertion average length | 1.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 659035 % of reads mapped to multiple loci | 7.01% Number of reads mapped to too many loci | 60413 % of reads mapped to too many loci | 0.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.60% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 306171 306171 306171 N_multimapping 659035 659035 659035 N_noFeature 335438 4305475 4436269 N_ambiguous 47047 11215 10937 UnstrandedReadsAssigned:8048922 PositiveStrandReadsAssigned:4114717 NegativeStrandReadsAssigned:3984201 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR952889 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR952889-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,396,613 reads, 8,520,063 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52401 SRR952889.ke.tsv 34699 SRR952889.se.tsv 87100 total ==> SRR952889.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2124 184.982 Potri.005G024800.1.v4.1 1035 936 723 129.096 Potri.004G059700.1.v4.1 961 862 3 0.581654 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 265.507 15.6026 Potri.016G087400.1.v4.1 270 171 190 185.698 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 250.859 25.0452 Potri.012G127500.1.v4.1 977 878 1129 214.907 ==> SRR952889.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 13 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 125 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 12 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 0 SRR952889 completed mapping pipeline successfully