Starting /dee2/code/volunteer_pipeline.sh SRR952890 current disk space = 3058855444480 free memory = 1530774148 SRR952890 SRAfilesize 5d7aaa365476141c59e8033bf499c05f SRR952890.sra SRR952890.sra file validated SRR952890 is single end SRR952890 is conventional basespace SRR952890 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR952890_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.85075 38.0 35.0 40.0 31.0 40.0 2 36.213 38.0 35.0 39.0 30.0 40.0 3 36.3185 38.0 35.0 39.0 30.0 40.0 4 36.1205 38.0 35.0 39.0 29.0 40.0 5 36.35875 38.0 35.0 40.0 30.0 40.0 6 36.502 38.0 35.0 40.0 31.0 40.0 7 36.48925 38.0 35.0 40.0 31.0 40.0 8 36.38975 38.0 35.0 40.0 30.0 40.0 9 36.199 38.0 35.0 39.0 30.0 40.0 10 36.29325 38.0 35.0 39.0 30.0 40.0 11 36.401 38.0 35.0 39.0 30.0 40.0 12 36.28375 38.0 35.0 39.0 30.0 40.0 13 36.127 38.0 35.0 39.0 30.0 40.0 14 36.203 38.0 35.0 39.0 30.0 40.0 15 36.0885 38.0 35.0 39.0 30.0 40.0 16 36.16175 38.0 35.0 40.0 30.0 40.0 17 35.98675 38.0 35.0 39.0 30.0 40.0 18 35.91725 38.0 35.0 39.0 29.0 40.0 19 35.845 38.0 35.0 39.0 29.0 40.0 20 35.84225 38.0 35.0 39.0 29.0 40.0 21 35.8755 38.0 35.0 39.0 29.0 40.0 22 35.7455 38.0 35.0 39.0 29.0 40.0 23 35.65 38.0 35.0 39.0 29.0 40.0 24 35.7185 38.0 35.0 39.0 29.0 40.0 25 35.447 38.0 35.0 39.0 29.0 40.0 26 35.54575 38.0 35.0 39.0 29.0 40.0 27 35.2705 38.0 34.0 39.0 28.0 40.0 28 35.36175 38.0 35.0 39.0 28.0 40.0 29 35.0875 38.0 34.0 39.0 28.0 40.0 30 35.01675 38.0 33.0 39.0 27.0 40.0 31 34.94425 38.0 34.0 39.0 27.0 40.0 32 34.68875 38.0 33.0 39.0 27.0 40.0 33 34.615 38.0 33.0 39.0 26.0 40.0 34 34.479 38.0 33.0 39.0 27.0 40.0 35 34.2415 38.0 33.0 39.0 25.0 40.0 36 34.2335 38.0 33.0 39.0 26.0 40.0 37 34.14 38.0 33.0 39.0 26.0 40.0 38 34.07875 38.0 33.0 39.0 25.0 40.0 39 34.02725 37.0 33.0 39.0 26.0 40.0 40 33.7035 37.0 33.0 39.0 23.0 40.0 41 33.8205 37.0 33.0 39.0 25.0 40.0 42 33.51275 36.0 33.0 39.0 23.0 40.0 43 33.48625 36.0 33.0 39.0 24.0 40.0 44 33.213 36.0 32.0 39.0 23.0 40.0 45 33.10425 36.0 32.0 39.0 23.0 40.0 46 33.1195 36.0 32.0 39.0 23.0 40.0 47 32.864 36.0 32.0 39.0 22.0 40.0 48 32.60525 36.0 31.0 39.0 21.0 40.0 49 32.55475 36.0 31.0 39.0 21.0 40.0 50 32.17375 36.0 31.0 38.0 19.0 40.0 51 32.23175 36.0 31.0 39.0 18.0 40.0 52 32.017 35.0 30.0 38.0 19.0 40.0 53 31.7575 35.0 30.0 38.0 18.0 39.0 54 31.60775 35.0 30.0 38.0 18.0 39.0 55 31.16125 35.0 30.0 38.0 14.0 39.0 56 31.0395 35.0 30.0 38.0 10.0 39.0 57 30.8125 35.0 29.0 38.0 7.0 39.0 58 30.4365 35.0 29.0 38.0 2.0 39.0 59 30.26975 35.0 29.0 38.0 2.0 39.0 60 29.941 34.0 29.0 38.0 2.0 39.0 61 29.636 34.0 28.0 38.0 2.0 39.0 62 29.2455 34.0 28.0 38.0 2.0 39.0 63 29.15725 34.0 28.0 38.0 2.0 39.0 64 28.80775 33.0 27.0 37.0 2.0 39.0 65 28.33425 33.0 27.0 37.0 2.0 39.0 66 28.20875 33.0 26.0 37.0 2.0 39.0 67 27.67775 33.0 24.0 37.0 2.0 39.0 68 27.485 33.0 24.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 2.0 4 2.0 5 1.0 6 7.0 7 8.0 8 5.0 9 10.0 10 11.0 11 12.0 12 10.0 13 18.0 14 19.0 15 15.0 16 19.0 17 22.0 18 18.0 19 22.0 20 24.0 21 24.0 22 29.0 23 35.0 24 47.0 25 47.0 26 63.0 27 73.0 28 74.0 29 99.0 30 141.0 31 128.0 32 159.0 33 213.0 34 293.0 35 368.0 36 437.0 37 522.0 38 624.0 39 383.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.375 15.875 16.725 41.025 2 21.59376571141277 25.188536953242835 34.01206636500754 19.205630970336856 3 23.674999999999997 26.85 26.424999999999997 23.05 4 25.025 32.7 21.275 21.0 5 26.8 33.275 23.425 16.5 6 20.0 36.725 24.4 18.875 7 17.025000000000002 18.224999999999998 44.025 20.724999999999998 8 18.25 24.15 29.675 27.925 9 20.025000000000002 23.775 31.175000000000004 25.025 10 19.1 39.975 23.825 17.1 11 25.2 28.425 21.0 25.374999999999996 12 21.8 25.124999999999996 27.950000000000003 25.124999999999996 13 19.3 28.975 30.925000000000004 20.8 14 21.7 28.7 27.925 21.675 15 21.475 28.15 28.875 21.5 16 20.474999999999998 29.15 28.000000000000004 22.375 17 21.325 28.65 27.650000000000002 22.375 18 22.15 28.7 28.4 20.75 19 22.1 27.55 27.425 22.925 20 22.05 28.475 27.275 22.2 21 22.425 27.3 28.325 21.95 22 21.7 27.875 28.375 22.05 23 21.6 27.925 27.975 22.5 24 22.625 28.775000000000002 27.025 21.575 25 22.075 27.800000000000004 27.700000000000003 22.425 26 21.875 29.2 27.200000000000003 21.725 27 22.225 27.750000000000004 28.299999999999997 21.725 28 21.65 26.974999999999998 29.825000000000003 21.55 29 22.35 28.000000000000004 28.349999999999998 21.3 30 21.725 28.225 27.875 22.175 31 22.075 28.125 27.3 22.5 32 22.025 28.575 28.125 21.275 33 21.325 28.000000000000004 28.525 22.15 34 22.1 27.900000000000002 28.225 21.775 35 21.675 27.425 28.875 22.025 36 22.225 28.225 27.700000000000003 21.85 37 23.474999999999998 27.375 27.3 21.85 38 22.175 28.775000000000002 28.125 20.925 39 21.9 28.925 28.299999999999997 20.875 40 20.7 28.1 29.475 21.725 41 22.8 27.85 27.425 21.925 42 22.1 27.400000000000002 27.650000000000002 22.85 43 21.65 28.9 26.424999999999997 23.025000000000002 44 22.900000000000002 27.450000000000003 28.299999999999997 21.349999999999998 45 21.349999999999998 28.050000000000004 28.299999999999997 22.3 46 22.875 27.500000000000004 28.675 20.95 47 23.5 28.175 27.075 21.25 48 22.325 27.825 28.175 21.675 49 23.525 27.575 27.125 21.775 50 22.775000000000002 28.975 26.724999999999998 21.525 51 22.625 29.525000000000002 26.875 20.974999999999998 52 23.0 28.4 26.625 21.975 53 22.650000000000002 27.775 27.875 21.7 54 22.275 26.025 29.325000000000003 22.375 55 22.375 27.224999999999998 27.474999999999998 22.925 56 21.05 27.725 28.9 22.325 57 22.45 27.900000000000002 27.200000000000003 22.45 58 21.0 27.525 27.900000000000002 23.575 59 22.325 28.1 27.875 21.7 60 22.275 28.249999999999996 26.924999999999997 22.55 61 20.925 27.975 27.825 23.275000000000002 62 21.625 27.925 28.7 21.75 63 22.225 27.950000000000003 27.1 22.725 64 22.625 27.3 27.575 22.5 65 20.849999999999998 29.4 28.299999999999997 21.45 66 22.8 28.025 27.875 21.3 67 23.025000000000002 28.875 26.275 21.825 68 21.175 29.5 27.925 21.4 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 1.5 22 1.0 23 5.0 24 9.5 25 10.0 26 9.5 27 11.5 28 14.0 29 20.0 30 35.0 31 44.0 32 60.0 33 83.0 34 90.0 35 115.0 36 162.5 37 185.0 38 207.5 39 275.0 40 342.0 41 364.0 42 361.0 43 362.5 44 367.0 45 355.5 46 324.5 47 305.0 48 299.5 49 247.5 50 201.0 51 176.0 52 139.5 53 128.0 54 104.5 55 70.5 56 60.0 57 48.5 58 33.5 59 30.0 60 29.0 61 24.5 62 21.0 63 19.0 64 16.0 65 13.5 66 12.0 67 10.0 68 8.0 69 8.0 70 6.0 71 2.5 72 1.0 73 1.0 74 1.5 75 2.0 76 1.0 77 0.0 78 0.0 79 0.5 80 1.5 81 2.0 82 1.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.5499999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.849359779061 99.425 2 0.10042681395932714 0.2 3 0.0 0.0 4 0.025106703489831784 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025106703489831784 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGAAAAA 11 0.27499999999999997 TruSeq Adapter, Index 5 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10 0.125 0.0 0.0 0.0 0.0 11 0.125 0.0 0.0 0.0 0.0 12 0.125 0.0 0.0 0.0 0.0 13 0.125 0.0 0.0 0.0 0.0 14 0.125 0.0 0.0 0.0 0.0 15 0.125 0.0 0.0 0.0 0.0 16 0.125 0.0 0.0 0.0 0.0 17 0.125 0.0 0.0 0.0 0.0 18 0.125 0.0 0.0 0.0 0.0 19 0.125 0.0 0.0 0.0 0.0 20 0.125 0.0 0.0 0.0 0.0 21 0.125 0.0 0.0 0.0 0.0 22 0.125 0.0 0.0 0.0 0.0 23 0.125 0.0 0.0 0.0 0.0 24 0.125 0.0 0.0 0.0 0.0 25 0.125 0.0 0.0 0.0 0.0 26 0.125 0.0 0.0 0.0 0.0 27 0.125 0.0 0.0 0.0 0.0 28 0.125 0.0 0.0 0.0 0.0 29 0.125 0.0 0.0 0.0 0.0 30 0.125 0.0 0.0 0.0 0.0 31 0.125 0.0 0.0 0.0 0.0 32 0.125 0.0 0.0 0.0 0.0 33 0.125 0.0 0.0 0.0 0.0 34 0.125 0.0 0.0 0.0 0.0 35 0.125 0.0 0.0 0.0 0.0 36 0.125 0.0 0.0 0.0 0.0 37 0.125 0.0 0.0 0.0 0.0 38 0.125 0.0 0.0 0.0 0.0 39 0.125 0.0 0.0 0.0 0.0 40 0.125 0.0 0.0 0.0 0.0 41 0.125 0.0 0.0 0.0 0.0 42 0.125 0.0 0.0 0.0 0.0 43 0.125 0.0 0.0 0.0 0.0 44 0.125 0.0 0.0 0.0 0.0 45 0.125 0.0 0.0 0.0 0.0 46 0.125 0.0 0.0 0.0 0.0 47 0.125 0.0 0.0 0.0 0.0 48 0.15 0.0 0.0 0.0 0.0 49 0.15 0.0 0.0 0.0 0.0 50 0.15 0.0 0.0 0.0 0.0 51 0.15 0.0 0.0 0.0 0.0 52 0.15 0.0 0.0 0.0 0.0 53 0.15 0.0 0.0 0.0 0.0 54 0.15 0.0 0.0 0.0 0.0 55 0.15 0.0 0.0 0.0 0.0 56 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 370815 spots for SRR952890.sra Written 370815 spots for SRR952890.sra Read 370815 spots for SRR952890.sra Written 370815 spots for SRR952890.sra Read 370815 spots for SRR952890.sra Written 370815 spots for SRR952890.sra Read 370815 spots for SRR952890.sra Written 370815 spots for SRR952890.sra Read 370815 spots for SRR952890.sra Written 370815 spots for SRR952890.sra Read 370815 spots for SRR952890.sra Written 370815 spots for SRR952890.sra Read 370815 spots for SRR952890.sra Written 370815 spots for SRR952890.sra Read 370815 spots for SRR952890.sra Written 370815 spots for SRR952890.sra Read 370815 spots for SRR952890.sra Written 370815 spots for SRR952890.sra Read 370815 spots for SRR952890.sra Written 370815 spots for SRR952890.sra Read 370815 spots for SRR952890.sra Written 370815 spots for SRR952890.sra Read 370815 spots for SRR952890.sra Written 370815 spots for SRR952890.sra Read 370815 spots for SRR952890.sra Written 370815 spots for SRR952890.sra Read 370815 spots for SRR952890.sra Written 370815 spots for SRR952890.sra Read 370821 spots for SRR952890.sra Written 370821 spots for SRR952890.sra Read 370815 spots for SRR952890.sra Written 370815 spots for SRR952890.sra Read 370815 spots for SRR952890.sra Written 370815 spots for SRR952890.sra Read 370815 spots for SRR952890.sra Written 370815 spots for SRR952890.sra Read 370815 spots for SRR952890.sra Written 370815 spots for SRR952890.sra Read 370815 spots for SRR952890.sra Written 370815 spots for SRR952890.sra SRR ids: ['SRR952890.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2fa6kn__ SRR952890.sra spots: 7416306 blocks: [[1, 370815], [370816, 741630], [741631, 1112445], [1112446, 1483260], [1483261, 1854075], [1854076, 2224890], [2224891, 2595705], [2595706, 2966520], [2966521, 3337335], [3337336, 3708150], [3708151, 4078965], [4078966, 4449780], [4449781, 4820595], [4820596, 5191410], [5191411, 5562225], [5562226, 5933040], [5933041, 6303855], [6303856, 6674670], [6674671, 7045485], [7045486, 7416306]] SRR952890 file size 1550178 SRR952890 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR952890 SRR952890_1.fastq Input file: SRR952890_1.fastq trimmed: SRR952890-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 11:14:03 2025 >> started Mon Feb 10 11:14:06 2025 >> done (3.465s) 7416306 reads processed; of these: 46469 ( 0.63%) short reads filtered out after trimming by size control 49261 ( 0.66%) empty reads filtered out after trimming by size control 7320576 (98.71%) reads available; of these: 1016051 (13.88%) trimmed reads available after processing 6304525 (86.12%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3001 0.04% 19 4379 0.06% 20 7321 0.10% 21 2304 0.03% 22 3352 0.05% 23 4996 0.07% 24 8041 0.11% 25 13627 0.19% 26 3499 0.05% 27 4511 0.06% 28 6377 0.09% 29 9863 0.13% 30 14736 0.20% 31 3943 0.05% 32 5007 0.07% 33 7378 0.10% 34 11612 0.16% 35 18371 0.25% 36 4468 0.06% 37 6462 0.09% 38 9199 0.13% 39 14947 0.20% 40 23387 0.32% 41 5687 0.08% 42 7816 0.11% 43 11718 0.16% 44 19190 0.26% 45 31688 0.43% 46 7495 0.10% 47 10226 0.14% 48 15545 0.21% 49 25925 0.35% 50 43298 0.59% 51 9424 0.13% 52 13218 0.18% 53 20155 0.28% 54 35620 0.49% 55 62326 0.85% 56 12585 0.17% 57 17474 0.24% 58 26831 0.37% 59 48557 0.66% 60 88341 1.21% 61 16687 0.23% 62 22976 0.31% 63 37170 0.51% 64 66219 0.90% 65 109584 1.50% 66 22487 0.31% 67 37028 0.51% 68 6304525 86.12% 7320576 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=39.12 fanout-score-rank=10 prefix-density=0.12 prefix-fanout=11.8 sequence=CAGCAGCAGCAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=21 fanout-score=277.59 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=25.4 sequence=CTTCTTCTTCCT Started job on | Feb 10 11:14:21 Started mapping on | Feb 10 11:14:22 Finished on | Feb 10 11:14:29 Mapping speed, Million of reads per hour | 3764.87 Number of input reads | 7320576 Average input read length | 65 UNIQUE READS: Uniquely mapped reads number | 6657679 Uniquely mapped reads % | 90.94% Average mapped length | 65.94 Number of splices: Total | 1365055 Number of splices: Annotated (sjdb) | 1341900 Number of splices: GT/AG | 1344144 Number of splices: GC/AG | 18003 Number of splices: AT/AC | 1286 Number of splices: Non-canonical | 1622 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.81 Insertion rate per base | 0.01% Insertion average length | 1.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 416568 % of reads mapped to multiple loci | 5.69% Number of reads mapped to too many loci | 68433 % of reads mapped to too many loci | 0.93% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.41% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 246329 246329 246329 N_multimapping 416568 416568 416568 N_noFeature 323592 3437864 3522652 N_ambiguous 38069 8842 8615 UnstrandedReadsAssigned:6296018 PositiveStrandReadsAssigned:3210973 NegativeStrandReadsAssigned:3126412 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR952890 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR952890-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,320,576 reads, 6,581,688 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52401 SRR952890.ke.tsv 34699 SRR952890.se.tsv 87100 total ==> SRR952890.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1444 161.218 Potri.005G024800.1.v4.1 1035 936 713 163.206 Potri.004G059700.1.v4.1 961 862 1 0.248551 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 224.385 16.9039 Potri.016G087400.1.v4.1 270 171 172 215.504 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 186.666 23.8909 Potri.012G127500.1.v4.1 977 878 2140 522.205 ==> SRR952890.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 19 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 99 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 19 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR952890 completed mapping pipeline successfully