Starting /dee2/code/volunteer_pipeline.sh SRR952891 current disk space = 3059109793792 free memory = 1210587428 SRR952891 SRAfilesize 999367aef3292df6efe78d6f123e91b3 SRR952891.sra SRR952891.sra file validated SRR952891 is single end SRR952891 is conventional basespace SRR952891 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR952891_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.594 36.0 33.0 38.0 28.0 39.0 2 33.77725 36.0 32.0 38.0 25.0 39.0 3 33.76925 36.0 31.0 38.0 25.0 39.0 4 33.96075 36.0 32.0 38.0 25.0 39.0 5 33.93 36.0 32.0 39.0 25.0 39.0 6 34.6215 37.0 33.0 39.0 27.0 39.0 7 34.71475 37.0 33.0 39.0 27.0 40.0 8 34.351 36.0 33.0 38.0 26.0 40.0 9 34.4565 37.0 33.0 39.0 26.0 40.0 10 34.43975 36.0 33.0 38.0 27.0 40.0 11 34.5795 37.0 33.0 39.0 27.0 40.0 12 34.379 36.0 33.0 38.0 26.0 39.0 13 34.057 36.0 32.0 38.0 26.0 39.0 14 34.28775 36.0 33.0 38.0 26.0 39.0 15 34.40375 36.0 33.0 38.0 27.0 39.0 16 34.188 36.0 33.0 38.0 26.0 39.0 17 33.75475 36.0 31.0 38.0 25.0 39.0 18 33.97675 36.0 31.0 38.0 25.0 39.0 19 33.679 36.0 31.0 38.0 25.0 39.0 20 33.83025 36.0 32.0 38.0 25.0 39.0 21 34.17 36.0 33.0 39.0 26.0 39.0 22 33.9195 36.0 32.0 38.0 26.0 39.0 23 33.7975 36.0 32.0 38.0 25.0 39.0 24 33.79025 36.0 32.0 38.0 25.0 39.0 25 33.5055 36.0 31.0 38.0 25.0 39.0 26 33.4785 36.0 32.0 38.0 23.0 39.0 27 33.10175 36.0 31.0 38.0 23.0 39.0 28 33.054 36.0 31.0 38.0 23.0 39.0 29 32.9745 36.0 31.0 38.0 23.0 39.0 30 32.69775 35.0 30.0 38.0 23.0 39.0 31 32.71925 36.0 31.0 38.0 22.0 39.0 32 32.09625 35.0 30.0 38.0 20.0 39.0 33 31.98275 35.0 29.0 38.0 20.0 39.0 34 31.8615 35.0 29.0 38.0 20.0 39.0 35 31.4955 35.0 29.0 38.0 19.0 39.0 36 31.91325 35.0 30.0 38.0 20.0 39.0 37 31.703 35.0 30.0 38.0 19.0 39.0 38 30.836 34.0 28.0 38.0 17.0 39.0 39 30.4425 33.0 27.0 38.0 17.0 39.0 40 30.727 34.0 29.0 38.0 17.0 39.0 41 30.694 35.0 29.0 38.0 15.0 39.0 42 30.55575 35.0 28.0 38.0 15.0 39.0 43 30.21975 34.0 27.0 38.0 14.0 39.0 44 30.4585 34.0 28.0 38.0 16.0 39.0 45 30.08 33.0 28.0 38.0 13.0 39.0 46 30.02825 34.0 27.0 38.0 10.0 39.0 47 29.90675 34.0 28.0 38.0 9.0 39.0 48 29.77125 33.0 27.0 38.0 10.0 39.0 49 29.56475 33.0 27.0 38.0 9.0 39.0 50 29.32875 33.0 27.0 37.0 2.0 39.0 51 29.39175 34.0 27.0 38.0 2.0 39.0 52 28.97625 33.0 26.0 37.0 2.0 38.0 53 28.9865 33.0 27.0 37.0 2.0 38.0 54 27.99175 33.0 24.0 36.0 2.0 38.0 55 27.9515 33.0 25.0 36.0 2.0 38.0 56 27.7125 33.0 25.0 36.0 2.0 38.0 57 27.10175 32.0 23.0 36.0 2.0 38.0 58 27.11825 32.0 23.0 36.0 2.0 38.0 59 26.93075 32.0 23.0 36.0 2.0 38.0 60 26.37675 32.0 23.0 36.0 2.0 38.0 61 25.9275 32.0 19.0 36.0 2.0 38.0 62 25.27675 31.0 17.0 35.0 2.0 38.0 63 25.15775 31.0 17.0 35.0 2.0 38.0 64 24.14575 30.0 11.0 35.0 2.0 38.0 65 23.979 30.0 2.0 35.0 2.0 38.0 66 23.7775 30.0 2.0 35.0 2.0 38.0 67 23.32475 30.0 2.0 35.0 2.0 38.0 68 23.46175 30.0 2.0 35.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 2.0 4 1.0 5 7.0 6 2.0 7 9.0 8 13.0 9 11.0 10 14.0 11 35.0 12 21.0 13 28.0 14 27.0 15 31.0 16 36.0 17 24.0 18 40.0 19 45.0 20 43.0 21 42.0 22 67.0 23 68.0 24 74.0 25 83.0 26 117.0 27 121.0 28 163.0 29 165.0 30 190.0 31 232.0 32 254.0 33 271.0 34 336.0 35 365.0 36 430.0 37 340.0 38 239.0 39 40.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.474999999999998 17.775 16.6 40.150000000000006 2 22.330827067669173 26.691729323308273 33.1328320802005 17.844611528822053 3 22.875 29.5 25.55 22.075 4 22.3 34.525 21.475 21.7 5 27.075 35.725 22.1 15.1 6 18.525 38.875 23.275000000000002 19.325 7 16.325 19.575 43.25 20.849999999999998 8 18.15 24.349999999999998 31.075000000000003 26.424999999999997 9 19.55 23.525 32.05 24.875 10 18.6 40.625 24.425 16.35 11 25.8 29.349999999999998 20.65 24.2 12 21.2 25.124999999999996 28.625 25.05 13 19.1 28.549999999999997 31.0 21.349999999999998 14 20.724999999999998 28.675 28.725 21.875 15 19.950000000000003 28.575 29.349999999999998 22.125 16 21.975 28.125 29.125 20.775 17 22.725 28.4 27.400000000000002 21.475 18 22.05 28.299999999999997 27.700000000000003 21.95 19 21.6 28.299999999999997 26.974999999999998 23.125 20 21.45 28.599999999999998 27.325 22.625 21 21.099999999999998 28.449999999999996 27.950000000000003 22.5 22 20.45 30.175 28.175 21.2 23 21.875 29.725 26.775 21.625 24 20.05 30.3 27.950000000000003 21.7 25 21.925 29.575000000000003 27.025 21.475 26 22.35 28.375 28.549999999999997 20.724999999999998 27 20.225 28.575 29.25 21.95 28 21.575 28.075 28.825 21.525 29 21.95 28.549999999999997 28.249999999999996 21.25 30 20.45 28.599999999999998 27.975 22.975 31 21.85 29.7 27.400000000000002 21.05 32 23.674999999999997 28.325 27.700000000000003 20.3 33 21.575 29.275000000000002 28.025 21.125 34 22.8 28.625 27.474999999999998 21.099999999999998 35 22.5 27.950000000000003 28.375 21.175 36 21.2 28.775000000000002 28.425 21.6 37 21.45 29.45 28.175 20.925 38 23.425 28.549999999999997 27.200000000000003 20.825 39 21.575 30.15 26.724999999999998 21.55 40 21.349999999999998 30.099999999999998 27.675 20.875 41 22.325 27.975 27.975 21.725 42 22.475 29.225 27.400000000000002 20.9 43 21.425 28.275 29.175 21.125 44 23.1 28.199999999999996 27.375 21.325 45 22.525000000000002 28.925 27.325 21.224999999999998 46 22.475 29.425 26.6 21.5 47 21.95 28.225 27.500000000000004 22.325 48 21.6 29.075 28.075 21.25 49 21.475 29.875 27.325 21.325 50 22.475 28.575 27.500000000000004 21.45 51 21.55 28.425 27.450000000000003 22.575 52 22.6 27.800000000000004 27.400000000000002 22.2 53 21.425 28.849999999999998 27.35 22.375 54 22.2 29.125 28.575 20.1 55 22.25 29.099999999999998 26.400000000000002 22.25 56 21.825 29.4 27.575 21.2 57 22.45 27.55 27.775 22.225 58 21.625 28.349999999999998 27.325 22.7 59 21.725 28.225 28.000000000000004 22.05 60 21.275 28.425 28.849999999999998 21.45 61 22.2 27.025 29.549999999999997 21.224999999999998 62 22.650000000000002 27.474999999999998 28.349999999999998 21.525 63 22.650000000000002 27.875 27.975 21.5 64 22.625 28.95 27.1 21.325 65 22.5 28.799999999999997 26.75 21.95 66 22.225 28.65 26.825 22.3 67 22.375 27.825 28.275 21.525 68 22.975 28.499999999999996 26.224999999999998 22.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.0 23 6.0 24 7.0 25 3.0 26 8.5 27 16.5 28 19.0 29 21.5 30 34.5 31 45.0 32 52.0 33 86.5 34 114.0 35 129.0 36 169.5 37 195.0 38 224.0 39 300.0 40 357.5 41 368.0 42 371.0 43 388.5 44 403.0 45 397.5 46 352.0 47 312.0 48 271.5 49 218.0 50 205.0 51 173.5 52 116.0 53 90.0 54 83.5 55 63.5 56 50.0 57 40.0 58 28.0 59 26.0 60 22.5 61 18.0 62 17.0 63 12.5 64 8.0 65 6.0 66 4.0 67 5.5 68 5.0 69 3.0 70 2.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 261115 spots for SRR952891.sra Written 261115 spots for SRR952891.sra Read 261115 spots for SRR952891.sra Written 261115 spots for SRR952891.sra Read 261115 spots for SRR952891.sra Written 261115 spots for SRR952891.sra Read 261115 spots for SRR952891.sra Written 261115 spots for SRR952891.sra Read 261115 spots for SRR952891.sra Written 261115 spots for SRR952891.sra Read 261115 spots for SRR952891.sra Written 261115 spots for SRR952891.sra Read 261115 spots for SRR952891.sra Written 261115 spots for SRR952891.sra Read 261115 spots for SRR952891.sra Written 261115 spots for SRR952891.sra Read 261115 spots for SRR952891.sra Written 261115 spots for SRR952891.sra Read 261115 spots for SRR952891.sra Written 261115 spots for SRR952891.sra Read 261115 spots for SRR952891.sra Written 261115 spots for SRR952891.sra Read 261115 spots for SRR952891.sra Written 261115 spots for SRR952891.sra Read 261115 spots for SRR952891.sra Written 261115 spots for SRR952891.sra Read 261115 spots for SRR952891.sra Written 261115 spots for SRR952891.sra Read 261115 spots for SRR952891.sra Written 261115 spots for SRR952891.sra Read 261115 spots for SRR952891.sra Written 261115 spots for SRR952891.sra Read 261115 spots for SRR952891.sra Written 261115 spots for SRR952891.sra Read 261115 spots for SRR952891.sra Written 261115 spots for SRR952891.sra Read 261115 spots for SRR952891.sra Written 261115 spots for SRR952891.sra Read 261115 spots for SRR952891.sra Written 261115 spots for SRR952891.sra SRR ids: ['SRR952891.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4lccmern SRR952891.sra spots: 5222300 blocks: [[1, 261115], [261116, 522230], [522231, 783345], [783346, 1044460], [1044461, 1305575], [1305576, 1566690], [1566691, 1827805], [1827806, 2088920], [2088921, 2350035], [2350036, 2611150], [2611151, 2872265], [2872266, 3133380], [3133381, 3394495], [3394496, 3655610], [3655611, 3916725], [3916726, 4177840], [4177841, 4438955], [4438956, 4700070], [4700071, 4961185], [4961186, 5222300]] SRR952891 file size 1091220 SRR952891 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR952891 SRR952891_1.fastq Input file: SRR952891_1.fastq trimmed: SRR952891-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 10:41:25 2025 >> started Mon Feb 10 10:41:27 2025 >> done (2.499s) 5222300 reads processed; of these: 22900 ( 0.44%) short reads filtered out after trimming by size control 6739 ( 0.13%) empty reads filtered out after trimming by size control 5192661 (99.43%) reads available; of these: 830419 (15.99%) trimmed reads available after processing 4362242 (84.01%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2674 0.05% 19 4108 0.08% 20 6252 0.12% 21 1960 0.04% 22 3062 0.06% 23 4561 0.09% 24 7802 0.15% 25 12108 0.23% 26 3247 0.06% 27 4412 0.08% 28 6030 0.12% 29 9156 0.18% 30 14275 0.27% 31 3993 0.08% 32 4855 0.09% 33 6853 0.13% 34 10130 0.20% 35 15348 0.30% 36 3897 0.08% 37 4954 0.10% 38 7221 0.14% 39 10625 0.20% 40 15625 0.30% 41 4021 0.08% 42 5647 0.11% 43 8558 0.16% 44 13554 0.26% 45 20268 0.39% 46 5099 0.10% 47 7551 0.15% 48 12090 0.23% 49 19834 0.38% 50 33813 0.65% 51 7806 0.15% 52 11483 0.22% 53 18089 0.35% 54 29946 0.58% 55 49300 0.95% 56 10712 0.21% 57 15241 0.29% 58 23799 0.46% 59 40538 0.78% 60 67790 1.31% 61 14586 0.28% 62 20637 0.40% 63 33483 0.64% 64 55790 1.07% 65 88293 1.70% 66 20056 0.39% 67 29287 0.56% 68 4362242 84.01% 5192661 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=4.58 fanout-score-rank=24 prefix-density=0.07 prefix-fanout=3.2 sequence=ATTGAGAAGCCACCAGTCTACAAGCCACCAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=6 fanout-score=254.08 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=22.8 sequence=AAGAAGAAGAAG Started job on | Feb 10 10:41:42 Started mapping on | Feb 10 10:41:42 Finished on | Feb 10 10:41:49 Mapping speed, Million of reads per hour | 2670.51 Number of input reads | 5192661 Average input read length | 65 UNIQUE READS: Uniquely mapped reads number | 4760701 Uniquely mapped reads % | 91.68% Average mapped length | 65.64 Number of splices: Total | 1003515 Number of splices: Annotated (sjdb) | 987935 Number of splices: GT/AG | 988320 Number of splices: GC/AG | 13172 Number of splices: AT/AC | 836 Number of splices: Non-canonical | 1187 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.77 Insertion rate per base | 0.01% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 298763 % of reads mapped to multiple loci | 5.75% Number of reads mapped to too many loci | 35618 % of reads mapped to too many loci | 0.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.87% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 133197 133197 133197 N_multimapping 298763 298763 298763 N_noFeature 184244 2396064 2534469 N_ambiguous 26438 6335 5770 UnstrandedReadsAssigned:4550019 PositiveStrandReadsAssigned:2358302 NegativeStrandReadsAssigned:2220462 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=65 echo kmer=61 SRR952891 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR952891-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,192,661 reads, 4,717,068 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,148 rounds 52401 SRR952891.ke.tsv 34699 SRR952891.se.tsv 87100 total ==> SRR952891.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 837 130.463 Potri.005G024800.1.v4.1 1035 936 363 116.002 Potri.004G059700.1.v4.1 961 862 1 0.346999 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 190.319 20.0165 Potri.016G087400.1.v4.1 270 171 144 251.885 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 222.667 39.7865 Potri.012G127500.1.v4.1 977 878 1259 428.911 ==> SRR952891.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 10 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 61 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR952891 completed mapping pipeline successfully