Starting /dee2/code/volunteer_pipeline.sh SRR952892 current disk space = 3059227377664 free memory = 1411176340 SRR952892 SRAfilesize d784ca0d1cc66899eed040e707dca454 SRR952892.sra SRR952892.sra file validated SRR952892 is single end SRR952892 is conventional basespace SRR952892 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR952892_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.36425 38.0 35.0 39.0 31.0 40.0 2 35.86175 38.0 35.0 39.0 29.0 40.0 3 35.6325 38.0 35.0 39.0 29.0 40.0 4 35.7625 38.0 35.0 39.0 29.0 40.0 5 35.4925 38.0 35.0 39.0 28.0 40.0 6 35.9705 38.0 35.0 39.0 30.0 40.0 7 35.775 38.0 35.0 39.0 29.0 40.0 8 35.71275 38.0 35.0 39.0 29.0 40.0 9 35.52375 38.0 34.0 39.0 28.0 40.0 10 35.5935 38.0 35.0 39.0 29.0 40.0 11 35.81575 38.0 35.0 39.0 29.0 40.0 12 35.394 38.0 33.0 39.0 28.0 40.0 13 35.78525 38.0 35.0 39.0 29.0 40.0 14 35.562 38.0 34.0 39.0 29.0 40.0 15 35.1575 38.0 33.0 39.0 28.0 40.0 16 35.62825 38.0 35.0 39.0 29.0 40.0 17 35.44325 38.0 34.0 39.0 28.0 40.0 18 34.94625 38.0 33.0 39.0 27.0 40.0 19 34.99525 38.0 33.0 39.0 27.0 40.0 20 35.04275 38.0 33.0 39.0 28.0 40.0 21 35.31775 38.0 34.0 39.0 28.0 40.0 22 35.2505 38.0 33.0 39.0 28.0 40.0 23 34.80875 38.0 33.0 39.0 27.0 40.0 24 35.1295 38.0 33.0 39.0 28.0 40.0 25 35.00775 38.0 33.0 39.0 27.0 40.0 26 34.84575 38.0 33.0 39.0 27.0 40.0 27 34.72175 38.0 33.0 39.0 27.0 40.0 28 34.39975 38.0 33.0 39.0 26.0 40.0 29 34.236 37.0 33.0 39.0 26.0 40.0 30 33.7845 36.0 33.0 39.0 24.0 40.0 31 33.837 37.0 33.0 39.0 25.0 40.0 32 33.5295 36.0 32.0 39.0 23.0 40.0 33 32.8945 36.0 31.0 39.0 23.0 40.0 34 33.30025 36.0 32.0 39.0 23.0 40.0 35 33.08925 36.0 31.0 39.0 23.0 40.0 36 32.9685 36.0 32.0 39.0 22.0 40.0 37 32.61925 36.0 31.0 38.0 22.0 40.0 38 32.4915 36.0 31.0 38.0 22.0 40.0 39 32.301 35.0 30.0 38.0 21.0 39.0 40 32.06325 35.0 30.0 38.0 20.0 39.0 41 32.20875 36.0 31.0 38.0 20.0 40.0 42 32.07975 35.0 31.0 38.0 19.0 39.0 43 31.72825 35.0 30.0 38.0 18.0 39.0 44 31.249 35.0 29.0 38.0 18.0 39.0 45 31.27325 35.0 29.0 38.0 17.0 39.0 46 31.17225 35.0 30.0 38.0 15.0 39.0 47 31.06075 35.0 29.0 38.0 15.0 39.0 48 30.96 35.0 29.0 38.0 15.0 39.0 49 30.66275 35.0 29.0 38.0 13.0 39.0 50 30.33075 35.0 29.0 38.0 9.0 39.0 51 29.9925 35.0 29.0 38.0 2.0 39.0 52 29.524 34.0 28.0 37.0 2.0 39.0 53 29.3225 33.0 27.0 37.0 2.0 39.0 54 28.87775 33.0 27.0 36.0 2.0 39.0 55 28.304 33.0 25.0 36.0 2.0 39.0 56 27.968 33.0 25.0 36.0 2.0 39.0 57 27.2655 32.0 23.0 36.0 2.0 38.0 58 27.591 33.0 25.0 36.0 2.0 38.0 59 26.8425 32.0 23.0 36.0 2.0 38.0 60 26.178 32.0 22.0 35.0 2.0 38.0 61 26.37475 32.0 22.0 36.0 2.0 38.0 62 25.79175 32.0 21.0 35.0 2.0 38.0 63 25.5115 31.0 19.0 35.0 2.0 38.0 64 25.31375 31.0 18.0 35.0 2.0 38.0 65 25.04375 31.0 17.0 35.0 2.0 38.0 66 24.63425 31.0 2.0 35.0 2.0 38.0 67 24.24275 31.0 2.0 35.0 2.0 38.0 68 24.07375 31.0 2.0 35.0 2.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 3.0 4 1.0 5 3.0 6 5.0 7 9.0 8 8.0 9 9.0 10 12.0 11 18.0 12 18.0 13 20.0 14 30.0 15 26.0 16 35.0 17 25.0 18 31.0 19 39.0 20 36.0 21 43.0 22 60.0 23 51.0 24 67.0 25 65.0 26 86.0 27 87.0 28 116.0 29 130.0 30 149.0 31 165.0 32 192.0 33 250.0 34 318.0 35 402.0 36 482.0 37 502.0 38 409.0 39 77.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.758097165991902 16.24493927125506 14.903846153846153 41.093117408906885 2 20.549999999999997 24.775 35.275 19.400000000000002 3 22.475 27.375 27.825 22.325 4 25.5 30.975 20.8 22.725 5 26.25 35.775 21.65 16.325 6 18.6046511627907 37.90947736934234 23.93098274568642 19.554888722180543 7 16.6 19.375 43.824999999999996 20.200000000000003 8 18.275 23.375 31.900000000000002 26.450000000000003 9 21.675 22.900000000000002 31.025000000000002 24.4 10 19.0 39.6 24.6 16.8 11 25.224999999999998 29.25 21.6 23.925 12 21.575 24.625 28.249999999999996 25.55 13 20.3 28.65 30.775000000000002 20.275000000000002 14 20.724999999999998 28.175 28.449999999999996 22.650000000000002 15 20.775 29.599999999999998 27.250000000000004 22.375 16 21.125 28.249999999999996 28.125 22.5 17 24.425 27.875 26.724999999999998 20.974999999999998 18 21.95 27.224999999999998 27.750000000000004 23.075000000000003 19 21.725 27.875 28.000000000000004 22.400000000000002 20 22.7 27.425 27.800000000000004 22.075 21 23.225 27.450000000000003 28.249999999999996 21.075 22 21.275 29.125 27.224999999999998 22.375 23 22.125 28.999999999999996 27.825 21.05 24 19.650000000000002 29.25 28.625 22.475 25 21.0 28.225 28.575 22.2 26 21.4 28.525 28.175 21.9 27 21.45 28.799999999999997 26.375 23.375 28 21.25 28.799999999999997 28.625 21.325 29 24.175 27.150000000000002 28.175 20.5 30 22.900000000000002 27.800000000000004 28.225 21.075 31 21.0 28.499999999999996 27.250000000000004 23.25 32 22.25 29.375 27.425 20.95 33 22.5 29.275000000000002 25.7 22.525000000000002 34 23.75 26.625 26.450000000000003 23.175 35 22.95 28.075 27.05 21.925 36 21.825 28.175 27.675 22.325 37 21.275 28.625 27.375 22.725 38 21.8 29.575000000000003 27.474999999999998 21.15 39 22.5 27.075 27.950000000000003 22.475 40 20.65 27.825 29.099999999999998 22.425 41 20.78019504876219 28.582145536384097 29.08227056764191 21.555388847211805 42 21.85 26.275 28.7 23.175 43 20.875 29.375 28.499999999999996 21.25 44 21.4 28.825 26.700000000000003 23.075000000000003 45 22.900000000000002 27.525 26.924999999999997 22.650000000000002 46 22.43060765191298 27.831957989497376 27.45686421605401 22.280570142535634 47 22.1055263815954 28.632158039509875 27.056764191047762 22.20555138784696 48 21.980495123780948 26.831707926981746 28.907226806701676 22.280570142535634 49 22.275 27.3 27.05 23.375 50 21.305326331582897 28.532133033258315 26.60665166291573 23.55588897224306 51 22.85571392848212 28.28207051762941 25.95648912228057 22.9057264316079 52 21.955488872218055 29.132283070767688 27.70692673168292 21.205301325331334 53 23.23080770192548 26.65666416604151 27.556889222305575 22.55563890972743 54 21.605401350337583 27.481870467616904 27.881970492623154 23.030757689422355 55 22.255563890972745 26.806701675418854 28.307076769192296 22.630657664416105 56 22.55 27.35 29.575000000000003 20.525 57 21.2 28.375 28.65 21.775 58 21.8 27.900000000000002 28.325 21.975 59 23.0 26.724999999999998 28.199999999999996 22.075 60 22.825 26.474999999999998 27.224999999999998 23.474999999999998 61 21.625 27.975 28.15 22.25 62 22.275 28.575 27.950000000000003 21.2 63 22.75 27.175 28.025 22.05 64 22.6 28.449999999999996 27.35 21.6 65 23.875 27.925 27.0 21.2 66 22.375 28.875 26.5 22.25 67 21.85 28.849999999999998 27.575 21.725 68 21.7 30.425 26.6 21.275 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 1.0 21 1.0 22 2.0 23 3.5 24 5.5 25 6.0 26 6.0 27 11.5 28 17.0 29 20.0 30 33.0 31 43.0 32 49.0 33 77.5 34 100.0 35 117.5 36 161.5 37 188.0 38 209.0 39 254.5 40 318.5 41 358.0 42 358.5 43 371.0 44 383.0 45 378.0 46 339.5 47 306.0 48 310.5 49 264.5 50 214.0 51 186.5 52 146.5 53 134.0 54 115.0 55 81.0 56 66.0 57 53.0 58 29.5 59 19.0 60 22.5 61 23.0 62 20.0 63 15.0 64 9.5 65 8.5 66 8.0 67 7.0 68 4.0 69 2.0 70 2.0 71 1.0 72 0.0 73 0.5 74 2.0 75 3.0 76 1.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.025 42 0.0 43 0.0 44 0.0 45 0.0 46 0.025 47 0.025 48 0.025 49 0.0 50 0.025 51 0.025 52 0.025 53 0.025 54 0.025 55 0.025 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69719909159728 98.775 2 0.22710068130204392 0.44999999999999996 3 0.05046681806712087 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025233409033560434 0.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTGAAAAA 25 0.625 TruSeq Adapter, Index 9 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.15 0.0 0.0 0.0 0.0 2 0.15 0.0 0.0 0.0 0.0 3 0.15 0.0 0.0 0.0 0.0 4 0.15 0.0 0.0 0.0 0.0 5 0.15 0.0 0.0 0.0 0.0 6 0.15 0.0 0.0 0.0 0.0 7 0.15 0.0 0.0 0.0 0.0 8 0.15 0.0 0.0 0.0 0.0 9 0.15 0.0 0.0 0.0 0.0 10 0.15 0.0 0.0 0.0 0.0 11 0.15 0.0 0.0 0.0 0.0 12 0.15 0.0 0.0 0.0 0.0 13 0.15 0.0 0.0 0.0 0.0 14 0.15 0.0 0.0 0.0 0.0 15 0.15 0.0 0.0 0.0 0.0 16 0.15 0.0 0.0 0.0 0.0 17 0.15 0.0 0.0 0.0 0.0 18 0.15 0.0 0.0 0.0 0.0 19 0.15 0.0 0.0 0.0 0.0 20 0.15 0.0 0.0 0.0 0.0 21 0.15 0.0 0.0 0.0 0.0 22 0.15 0.0 0.0 0.0 0.0 23 0.15 0.0 0.0 0.0 0.0 24 0.15 0.0 0.0 0.0 0.0 25 0.15 0.0 0.0 0.0 0.0 26 0.15 0.0 0.0 0.0 0.0 27 0.15 0.0 0.0 0.0 0.0 28 0.15 0.0 0.0 0.0 0.0 29 0.15 0.0 0.0 0.0 0.0 30 0.15 0.0 0.0 0.0 0.0 31 0.15 0.0 0.0 0.0 0.0 32 0.15 0.0 0.0 0.0 0.0 33 0.15 0.0 0.0 0.0 0.0 34 0.15 0.0 0.0 0.0 0.0 35 0.15 0.0 0.0 0.0 0.0 36 0.15 0.0 0.0 0.0 0.0 37 0.15 0.0 0.0 0.0 0.0 38 0.15 0.0 0.0 0.0 0.0 39 0.15 0.0 0.0 0.0 0.0 40 0.15 0.0 0.0 0.0 0.0 41 0.15 0.0 0.0 0.0 0.0 42 0.15 0.0 0.0 0.0 0.0 43 0.15 0.0 0.0 0.0 0.0 44 0.15 0.0 0.0 0.0 0.0 45 0.15 0.0 0.0 0.0 0.0 46 0.15 0.0 0.0 0.0 0.0 47 0.15 0.0 0.0 0.0 0.0 48 0.15 0.0 0.0 0.0 0.0 49 0.15 0.0 0.0 0.0 0.0 50 0.15 0.0 0.0 0.0 0.0 51 0.15 0.0 0.0 0.0 0.0 52 0.15 0.0 0.0 0.0 0.0 53 0.15 0.0 0.0 0.0 0.0 54 0.15 0.0 0.0 0.0 0.0 55 0.15 0.0 0.0 0.0 0.0 56 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 745540 spots for SRR952892.sra Written 745540 spots for SRR952892.sra Read 745540 spots for SRR952892.sra Written 745540 spots for SRR952892.sra Read 745540 spots for SRR952892.sra Written 745540 spots for SRR952892.sra Read 745540 spots for SRR952892.sra Written 745540 spots for SRR952892.sra Read 745540 spots for SRR952892.sra Written 745540 spots for SRR952892.sra Read 745540 spots for SRR952892.sra Written 745540 spots for SRR952892.sra Read 745540 spots for SRR952892.sra Written 745540 spots for SRR952892.sra Read 745540 spots for SRR952892.sra Written 745540 spots for SRR952892.sra Read 745540 spots for SRR952892.sra Written 745540 spots for SRR952892.sra Read 745540 spots for SRR952892.sra Written 745540 spots for SRR952892.sra Read 745540 spots for SRR952892.sra Written 745540 spots for SRR952892.sra Read 745540 spots for SRR952892.sra Written 745540 spots for SRR952892.sra Read 745540 spots for SRR952892.sra Written 745540 spots for SRR952892.sra Read 745540 spots for SRR952892.sra Written 745540 spots for SRR952892.sra Read 745540 spots for SRR952892.sra Written 745540 spots for SRR952892.sra Read 745540 spots for SRR952892.sra Written 745540 spots for SRR952892.sra Read 745540 spots for SRR952892.sra Written 745540 spots for SRR952892.sra Read 745540 spots for SRR952892.sra Written 745540 spots for SRR952892.sra Read 745540 spots for SRR952892.sra Written 745540 spots for SRR952892.sra Read 745540 spots for SRR952892.sra Written 745540 spots for SRR952892.sra SRR ids: ['SRR952892.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hdibpjym SRR952892.sra spots: 14910800 blocks: [[1, 745540], [745541, 1491080], [1491081, 2236620], [2236621, 2982160], [2982161, 3727700], [3727701, 4473240], [4473241, 5218780], [5218781, 5964320], [5964321, 6709860], [6709861, 7455400], [7455401, 8200940], [8200941, 8946480], [8946481, 9692020], [9692021, 10437560], [10437561, 11183100], [11183101, 11928640], [11928641, 12674180], [12674181, 13419720], [13419721, 14165260], [14165261, 14910800]] SRR952892 file size 3122415 SRR952892 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR952892 SRR952892_1.fastq Input file: SRR952892_1.fastq trimmed: SRR952892-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 10:36:44 2025 >> started Mon Feb 10 10:36:51 2025 >> done (6.881s) 14910800 reads processed; of these: 49063 ( 0.33%) short reads filtered out after trimming by size control 274302 ( 1.84%) empty reads filtered out after trimming by size control 14587435 (97.83%) reads available; of these: 1632465 (11.19%) trimmed reads available after processing 12954970 (88.81%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5511 0.04% 19 8606 0.06% 20 13332 0.09% 21 4154 0.03% 22 6035 0.04% 23 9120 0.06% 24 14399 0.10% 25 23245 0.16% 26 6162 0.04% 27 9118 0.06% 28 11611 0.08% 29 17328 0.12% 30 27915 0.19% 31 7764 0.05% 32 9485 0.07% 33 12894 0.09% 34 19062 0.13% 35 28277 0.19% 36 7666 0.05% 37 9624 0.07% 38 14849 0.10% 39 22283 0.15% 40 36818 0.25% 41 8332 0.06% 42 11336 0.08% 43 15821 0.11% 44 26103 0.18% 45 41550 0.28% 46 9603 0.07% 47 13774 0.09% 48 22227 0.15% 49 36400 0.25% 50 59129 0.41% 51 14794 0.10% 52 21847 0.15% 53 34833 0.24% 54 55912 0.38% 55 99844 0.68% 56 21209 0.15% 57 29605 0.20% 58 45300 0.31% 59 77721 0.53% 60 141652 0.97% 61 27798 0.19% 62 41523 0.28% 63 62926 0.43% 64 110742 0.76% 65 181164 1.24% 66 37461 0.26% 67 58601 0.40% 68 12954970 88.81% 14587435 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=20 prefix-density=0.23 prefix-fanout=2.0 sequence=CAAGGTAAGAGTTCATGGCCAGAGCT criterion=fanout-score sequence-density=0.03 sequence-density-rank=18 fanout-score=11.95 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.6 sequence=GGAGGAGGTGGTGG Started job on | Feb 10 10:37:04 Started mapping on | Feb 10 10:37:04 Finished on | Feb 10 10:37:17 Mapping speed, Million of reads per hour | 4039.60 Number of input reads | 14587435 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 13084536 Uniquely mapped reads % | 89.70% Average mapped length | 66.38 Number of splices: Total | 2686213 Number of splices: Annotated (sjdb) | 2641688 Number of splices: GT/AG | 2645496 Number of splices: GC/AG | 35131 Number of splices: AT/AC | 2272 Number of splices: Non-canonical | 3314 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.82 Insertion rate per base | 0.01% Insertion average length | 1.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1027647 % of reads mapped to multiple loci | 7.04% Number of reads mapped to too many loci | 118450 % of reads mapped to too many loci | 0.81% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.43% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 475252 475252 475252 N_multimapping 1027647 1027647 1027647 N_noFeature 501271 6665793 6872053 N_ambiguous 79678 16063 15976 UnstrandedReadsAssigned:12503587 PositiveStrandReadsAssigned:6402680 NegativeStrandReadsAssigned:6196507 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR952892 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR952892-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,587,435 reads, 13,266,317 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR952892.ke.tsv 34699 SRR952892.se.tsv 87100 total ==> SRR952892.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2422.04 126.456 Potri.005G024800.1.v4.1 1035 936 663 70.9697 Potri.004G059700.1.v4.1 961 862 1 0.116233 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 542.932 19.1272 Potri.016G087400.1.v4.1 270 171 267 156.441 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 545.75 32.6643 Potri.012G127500.1.v4.1 977 878 2419 276.043 ==> SRR952892.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 9 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 265 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 6 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 4 SRR952892 completed mapping pipeline successfully