Starting /dee2/code/volunteer_pipeline.sh SRR952893 current disk space = 3059219697664 free memory = 1370305760 SRR952893 SRAfilesize ef834f1ab6eab2eb90b16c0b915879ec SRR952893.sra SRR952893.sra file validated SRR952893 is single end SRR952893 is conventional basespace SRR952893 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR952893_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.65075 38.0 35.0 39.0 31.0 40.0 2 36.1285 38.0 35.0 39.0 30.0 40.0 3 35.951 38.0 35.0 39.0 30.0 40.0 4 35.98075 38.0 35.0 39.0 29.0 40.0 5 35.88725 38.0 35.0 39.0 29.0 40.0 6 36.188 38.0 35.0 39.0 30.0 40.0 7 36.1185 38.0 35.0 39.0 30.0 40.0 8 35.84275 38.0 35.0 39.0 29.0 40.0 9 35.8335 38.0 35.0 39.0 29.0 40.0 10 35.7625 38.0 35.0 39.0 29.0 40.0 11 35.7895 38.0 35.0 39.0 29.0 40.0 12 35.4 38.0 33.0 39.0 28.0 40.0 13 35.67975 38.0 34.0 39.0 29.0 40.0 14 35.6435 38.0 34.0 39.0 29.0 40.0 15 35.2125 38.0 33.0 39.0 28.0 40.0 16 35.761 38.0 35.0 39.0 29.0 40.0 17 35.6895 38.0 35.0 39.0 29.0 40.0 18 35.11775 38.0 33.0 39.0 27.0 40.0 19 35.15475 38.0 33.0 39.0 27.0 40.0 20 35.37725 38.0 33.0 39.0 28.0 40.0 21 35.48025 38.0 35.0 39.0 28.0 40.0 22 35.46625 38.0 34.0 39.0 29.0 40.0 23 35.0755 38.0 33.0 39.0 28.0 40.0 24 35.415 38.0 33.0 39.0 29.0 40.0 25 35.28175 38.0 33.0 39.0 28.0 40.0 26 35.10275 38.0 34.0 39.0 28.0 40.0 27 34.969 38.0 33.0 39.0 27.0 40.0 28 34.7655 38.0 33.0 39.0 27.0 40.0 29 34.737 38.0 33.0 39.0 27.0 40.0 30 34.2455 37.0 33.0 39.0 26.0 40.0 31 34.20875 38.0 33.0 39.0 25.0 40.0 32 33.8655 37.0 32.0 39.0 25.0 40.0 33 33.39775 36.0 31.0 39.0 23.0 40.0 34 33.7905 36.0 32.0 39.0 25.0 40.0 35 33.6625 36.0 32.0 39.0 23.0 40.0 36 33.6875 36.0 33.0 39.0 24.0 40.0 37 33.53525 36.0 32.0 39.0 23.0 40.0 38 33.38925 36.0 32.0 39.0 23.0 40.0 39 33.017 36.0 31.0 39.0 23.0 40.0 40 33.10975 36.0 32.0 38.0 23.0 40.0 41 32.88825 36.0 31.0 39.0 22.0 40.0 42 32.921 36.0 31.0 38.0 23.0 40.0 43 32.67275 36.0 31.0 38.0 22.0 40.0 44 32.142 35.0 30.0 38.0 20.0 39.0 45 32.21575 35.0 30.0 38.0 20.0 39.0 46 32.5615 36.0 31.0 38.0 21.0 40.0 47 32.4355 36.0 31.0 38.0 22.0 39.0 48 32.43825 36.0 31.0 38.0 22.0 39.0 49 32.02675 35.0 30.0 38.0 19.0 39.0 50 31.92725 35.0 30.0 38.0 19.0 39.0 51 31.607 35.0 30.0 38.0 16.0 39.0 52 31.399 35.0 30.0 38.0 16.0 39.0 53 31.16275 35.0 30.0 38.0 16.0 39.0 54 30.958 35.0 29.0 38.0 15.0 39.0 55 30.4345 35.0 29.0 38.0 10.0 39.0 56 30.149 35.0 29.0 38.0 2.0 39.0 57 29.31675 33.0 27.0 37.0 2.0 39.0 58 29.55225 34.0 28.0 38.0 2.0 39.0 59 28.95975 33.0 27.0 37.0 2.0 39.0 60 28.4435 33.0 26.0 36.0 2.0 39.0 61 28.6965 34.0 27.0 37.0 2.0 39.0 62 28.16175 33.0 26.0 36.0 2.0 39.0 63 28.08375 33.0 26.0 36.0 2.0 38.0 64 27.75525 33.0 25.0 36.0 2.0 38.0 65 27.58875 33.0 25.0 36.0 2.0 38.0 66 27.579 33.0 25.0 37.0 2.0 39.0 67 27.29225 33.0 24.0 36.0 2.0 39.0 68 26.9375 33.0 23.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 3.0 5 2.0 6 4.0 7 5.0 8 5.0 9 8.0 10 13.0 11 16.0 12 19.0 13 16.0 14 22.0 15 16.0 16 17.0 17 24.0 18 18.0 19 24.0 20 33.0 21 41.0 22 34.0 23 45.0 24 55.0 25 78.0 26 70.0 27 79.0 28 103.0 29 92.0 30 143.0 31 165.0 32 185.0 33 232.0 34 316.0 35 387.0 36 493.0 37 528.0 38 532.0 39 169.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.837255883825737 17.300951427140713 16.90035052578868 40.96144216324487 2 21.8 25.2 35.475 17.525 3 22.125 28.925 26.924999999999997 22.025 4 23.625 32.95 22.35 21.075 5 27.275 34.425 22.05 16.25 6 17.7633224918689 39.05429071803853 24.043032274205654 19.139354515886914 7 17.0 18.95 44.7 19.35 8 20.1 24.175 29.675 26.05 9 20.349999999999998 23.65 31.5 24.5 10 20.325 38.95 23.75 16.975 11 25.4 28.749999999999996 21.125 24.725 12 21.15 25.775 28.075 25.0 13 20.1 30.049999999999997 30.875000000000004 18.975 14 20.849999999999998 28.050000000000004 29.349999999999998 21.75 15 21.05 27.55 27.775 23.625 16 21.0 28.875 27.325 22.8 17 22.2 28.125 28.050000000000004 21.625 18 20.775 28.675 29.025000000000002 21.525 19 22.275 28.225 26.450000000000003 23.05 20 22.225 28.599999999999998 27.275 21.9 21 21.425 29.9 27.200000000000003 21.475 22 20.95 30.925000000000004 26.825 21.3 23 22.05 28.575 27.075 22.3 24 21.425 28.95 27.675 21.95 25 21.9 28.199999999999996 28.9 21.0 26 22.5 28.425 27.375 21.7 27 20.724999999999998 28.000000000000004 29.349999999999998 21.925 28 21.475 28.299999999999997 27.900000000000002 22.325 29 21.85 29.25 26.974999999999998 21.925 30 21.85 28.999999999999996 27.725 21.425 31 21.675 27.725 27.075 23.525 32 21.025 29.175 28.050000000000004 21.75 33 20.175 29.075 28.475 22.275 34 21.349999999999998 29.875 28.175 20.599999999999998 35 22.35 28.125 27.0 22.525000000000002 36 22.1 30.025000000000002 27.200000000000003 20.674999999999997 37 22.175 28.9 26.924999999999997 22.0 38 22.125 28.549999999999997 27.775 21.55 39 21.375 30.049999999999997 26.875 21.7 40 21.95 29.049999999999997 27.525 21.475 41 21.780445111277817 28.507126781695426 28.582145536384097 21.13028257064266 42 22.225 28.275 26.325 23.175 43 22.525000000000002 28.125 28.125 21.224999999999998 44 22.05 28.9 25.900000000000002 23.150000000000002 45 22.25 28.125 27.725 21.9 46 22.266700025018764 28.696522391793845 26.920190142606952 22.116587440580435 47 21.905476369092273 27.45686421605401 29.732433108277068 20.905226306576644 48 22.291718789091817 27.145359019264447 28.946710032524393 21.61621215911934 49 20.875 28.025 28.375 22.725 50 21.885942971485743 28.58929464732366 28.064032016008007 21.46073036518259 51 21.930482620655166 28.907226806701676 27.231807951987996 21.930482620655166 52 23.0980980980981 28.128128128128125 27.127127127127125 21.646646646646648 53 21.56617463097323 28.246184638478862 28.49637227920941 21.691268451338505 54 21.660830415207606 28.76438219109555 27.963981990995496 21.61080540270135 55 22.386193096548272 28.039019509754876 27.613806903451728 21.96098049024512 56 21.475 28.499999999999996 27.975 22.05 57 21.9 29.825000000000003 27.150000000000002 21.125 58 22.0 28.125 28.375 21.5 59 23.674999999999997 28.125 26.724999999999998 21.475 60 21.85 28.849999999999998 26.450000000000003 22.85 61 22.05 28.749999999999996 27.575 21.625 62 21.2 28.975 28.425 21.4 63 22.625 28.349999999999998 27.325 21.7 64 23.400000000000002 28.025 26.825 21.75 65 21.075 28.7 27.500000000000004 22.725 66 21.375 30.099999999999998 27.750000000000004 20.775 67 22.1 27.975 28.349999999999998 21.575 68 22.125 27.800000000000004 28.075 22.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 1.0 19 2.0 20 2.0 21 1.5 22 1.0 23 3.5 24 4.5 25 3.0 26 5.0 27 10.0 28 13.0 29 24.0 30 41.5 31 48.0 32 58.5 33 77.0 34 85.0 35 117.0 36 188.5 37 228.0 38 251.5 39 289.0 40 330.0 41 357.0 42 372.0 43 378.0 44 369.0 45 360.0 46 327.0 47 303.0 48 286.5 49 228.5 50 187.0 51 174.5 52 144.0 53 126.0 54 100.0 55 62.0 56 50.0 57 41.5 58 31.0 59 29.0 60 26.5 61 19.0 62 14.0 63 10.0 64 7.5 65 8.0 66 7.0 67 7.0 68 4.5 69 2.0 70 1.5 71 1.0 72 1.0 73 0.5 74 0.5 75 1.0 76 1.5 77 1.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.025 42 0.0 43 0.0 44 0.0 45 0.0 46 0.075 47 0.025 48 0.075 49 0.0 50 0.05 51 0.025 52 0.1 53 0.075 54 0.05 55 0.05 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8995983935743 99.5 2 0.0502008032128514 0.1 3 0.0 0.0 4 0.0251004016064257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0251004016064257 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAAAA 12 0.3 TruSeq Adapter, Index 7 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10 0.125 0.0 0.0 0.0 0.0 11 0.125 0.0 0.0 0.0 0.0 12 0.125 0.0 0.0 0.0 0.0 13 0.125 0.0 0.0 0.0 0.0 14 0.125 0.0 0.0 0.0 0.0 15 0.125 0.0 0.0 0.0 0.0 16 0.125 0.0 0.0 0.0 0.0 17 0.125 0.0 0.0 0.0 0.0 18 0.125 0.0 0.0 0.0 0.0 19 0.125 0.0 0.0 0.0 0.0 20 0.125 0.0 0.0 0.0 0.0 21 0.125 0.0 0.0 0.0 0.0 22 0.125 0.0 0.0 0.0 0.0 23 0.125 0.0 0.0 0.0 0.0 24 0.125 0.0 0.0 0.0 0.0 25 0.125 0.0 0.0 0.0 0.0 26 0.125 0.0 0.0 0.0 0.0 27 0.125 0.0 0.0 0.0 0.0 28 0.125 0.0 0.0 0.0 0.0 29 0.125 0.0 0.0 0.0 0.0 30 0.125 0.0 0.0 0.0 0.0 31 0.125 0.0 0.0 0.0 0.0 32 0.125 0.0 0.0 0.0 0.0 33 0.125 0.0 0.0 0.0 0.0 34 0.125 0.0 0.0 0.0 0.0 35 0.125 0.0 0.0 0.0 0.0 36 0.125 0.0 0.0 0.0 0.0 37 0.125 0.0 0.0 0.0 0.0 38 0.125 0.0 0.0 0.0 0.0 39 0.125 0.0 0.0 0.0 0.0 40 0.125 0.0 0.0 0.0 0.0 41 0.125 0.0 0.0 0.0 0.0 42 0.125 0.0 0.0 0.0 0.0 43 0.125 0.0 0.0 0.0 0.0 44 0.125 0.0 0.0 0.0 0.0 45 0.125 0.0 0.0 0.0 0.0 46 0.125 0.0 0.0 0.0 0.0 47 0.125 0.0 0.0 0.0 0.0 48 0.125 0.0 0.0 0.0 0.0 49 0.125 0.0 0.0 0.0 0.0 50 0.125 0.0 0.0 0.0 0.0 51 0.125 0.0 0.0 0.0 0.0 52 0.125 0.0 0.0 0.0 0.0 53 0.125 0.0 0.0 0.0 0.0 54 0.125 0.0 0.0 0.0 0.0 55 0.125 0.0 0.0 0.0 0.0 56 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 149654 spots for SRR952893.sra Written 149654 spots for SRR952893.sra Read 149654 spots for SRR952893.sra Written 149654 spots for SRR952893.sra Read 149654 spots for SRR952893.sra Written 149654 spots for SRR952893.sra Read 149654 spots for SRR952893.sra Written 149654 spots for SRR952893.sra Read 149654 spots for SRR952893.sra Written 149654 spots for SRR952893.sra Read 149654 spots for SRR952893.sra Written 149654 spots for SRR952893.sra Read 149654 spots for SRR952893.sra Written 149654 spots for SRR952893.sra Read 149654 spots for SRR952893.sra Written 149654 spots for SRR952893.sra Read 149654 spots for SRR952893.sra Written 149654 spots for SRR952893.sra Read 149654 spots for SRR952893.sra Written 149654 spots for SRR952893.sra Read 149654 spots for SRR952893.sra Written 149654 spots for SRR952893.sra Read 149654 spots for SRR952893.sra Written 149654 spots for SRR952893.sra Read 149654 spots for SRR952893.sra Written 149654 spots for SRR952893.sra Read 149654 spots for SRR952893.sra Written 149654 spots for SRR952893.sra Read 149654 spots for SRR952893.sra Written 149654 spots for SRR952893.sra Read 149654 spots for SRR952893.sra Written 149654 spots for SRR952893.sra Read 149654 spots for SRR952893.sra Written 149654 spots for SRR952893.sra Read 149654 spots for SRR952893.sra Written 149654 spots for SRR952893.sra Read 149665 spots for SRR952893.sra Written 149665 spots for SRR952893.sra Read 149654 spots for SRR952893.sra Written 149654 spots for SRR952893.sra SRR ids: ['SRR952893.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_03yzk1qp SRR952893.sra spots: 2993091 blocks: [[1, 149654], [149655, 299308], [299309, 448962], [448963, 598616], [598617, 748270], [748271, 897924], [897925, 1047578], [1047579, 1197232], [1197233, 1346886], [1346887, 1496540], [1496541, 1646194], [1646195, 1795848], [1795849, 1945502], [1945503, 2095156], [2095157, 2244810], [2244811, 2394464], [2394465, 2544118], [2544119, 2693772], [2693773, 2843426], [2843427, 2993091]] SRR952893 file size 624933 SRR952893 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR952893 SRR952893_1.fastq Input file: SRR952893_1.fastq trimmed: SRR952893-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 10:36:02 2025 >> started Mon Feb 10 10:36:04 2025 >> done (1.850s) 2993091 reads processed; of these: 8817 ( 0.29%) short reads filtered out after trimming by size control 23336 ( 0.78%) empty reads filtered out after trimming by size control 2960938 (98.93%) reads available; of these: 306679 (10.36%) trimmed reads available after processing 2654259 (89.64%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 957 0.03% 19 1436 0.05% 20 2074 0.07% 21 679 0.02% 22 1159 0.04% 23 1730 0.06% 24 2585 0.09% 25 4207 0.14% 26 1208 0.04% 27 1652 0.06% 28 2174 0.07% 29 3194 0.11% 30 5167 0.17% 31 1382 0.05% 32 1773 0.06% 33 2354 0.08% 34 3448 0.12% 35 5211 0.18% 36 1341 0.05% 37 1749 0.06% 38 2790 0.09% 39 3906 0.13% 40 6064 0.20% 41 1417 0.05% 42 2076 0.07% 43 2983 0.10% 44 4553 0.15% 45 7337 0.25% 46 1784 0.06% 47 2581 0.09% 48 3942 0.13% 49 6607 0.22% 50 10527 0.36% 51 2718 0.09% 52 3941 0.13% 53 6406 0.22% 54 10454 0.35% 55 18708 0.63% 56 3819 0.13% 57 5438 0.18% 58 8639 0.29% 59 14802 0.50% 60 27220 0.92% 61 5393 0.18% 62 8035 0.27% 63 12525 0.42% 64 21853 0.74% 65 35594 1.20% 66 7442 0.25% 67 11645 0.39% 68 2654259 89.64% 2960938 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=19 prefix-density=0.13 prefix-fanout=2.0 sequence=CAAGGTAAGAGTTCATGGCCAGAGCT criterion=fanout-score sequence-density=0.03 sequence-density-rank=16 fanout-score=172.82 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=21.6 sequence=TTCTTCTTCTTT Started job on | Feb 10 10:36:32 Started mapping on | Feb 10 10:36:32 Finished on | Feb 10 10:36:36 Mapping speed, Million of reads per hour | 2664.84 Number of input reads | 2960938 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 2713563 Uniquely mapped reads % | 91.65% Average mapped length | 66.47 Number of splices: Total | 560765 Number of splices: Annotated (sjdb) | 551556 Number of splices: GT/AG | 552211 Number of splices: GC/AG | 7426 Number of splices: AT/AC | 454 Number of splices: Non-canonical | 674 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.83 Insertion rate per base | 0.01% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 173576 % of reads mapped to multiple loci | 5.86% Number of reads mapped to too many loci | 23014 % of reads mapped to too many loci | 0.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.70% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 73799 73799 73799 N_multimapping 173576 173576 173576 N_noFeature 126847 1388499 1442706 N_ambiguous 15964 3447 3352 UnstrandedReadsAssigned:2570752 PositiveStrandReadsAssigned:1321617 NegativeStrandReadsAssigned:1267505 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR952893 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR952893-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,960,938 reads, 2,688,729 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,034 rounds 52401 SRR952893.ke.tsv 34699 SRR952893.se.tsv 87100 total ==> SRR952893.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 498 134.401 Potri.005G024800.1.v4.1 1035 936 131 72.4842 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 114.561 20.862 Potri.016G087400.1.v4.1 270 171 48 145.376 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 85.5819 26.4773 Potri.012G127500.1.v4.1 977 878 746 440.04 ==> SRR952893.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 47 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR952893 completed mapping pipeline successfully