Starting /dee2/code/volunteer_pipeline.sh SRR952894 current disk space = 3059051606016 free memory = 1412120488 SRR952894 SRAfilesize 48f8e7c0e70d3e1e772bc4ffd4c26468 SRR952894.sra SRR952894.sra file validated SRR952894 is single end SRR952894 is conventional basespace SRR952894 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR952894_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.42525 38.0 35.0 39.0 31.0 40.0 2 35.95625 38.0 35.0 39.0 29.0 40.0 3 35.7375 38.0 35.0 39.0 29.0 40.0 4 35.86175 38.0 35.0 39.0 29.0 40.0 5 35.7355 38.0 35.0 39.0 29.0 40.0 6 35.9895 38.0 35.0 39.0 30.0 40.0 7 35.9795 38.0 35.0 39.0 29.0 40.0 8 35.80325 38.0 35.0 39.0 29.0 40.0 9 35.79525 38.0 35.0 39.0 29.0 40.0 10 35.696 38.0 35.0 39.0 29.0 40.0 11 35.828 38.0 35.0 39.0 29.0 40.0 12 35.4155 38.0 33.0 39.0 28.0 40.0 13 35.6365 38.0 34.0 39.0 29.0 40.0 14 35.60775 38.0 34.0 39.0 29.0 40.0 15 35.15925 38.0 33.0 39.0 27.0 40.0 16 35.63875 38.0 35.0 39.0 29.0 40.0 17 35.56125 38.0 34.0 39.0 29.0 40.0 18 34.964 38.0 33.0 39.0 27.0 40.0 19 35.097 38.0 33.0 39.0 28.0 40.0 20 35.21075 38.0 33.0 39.0 28.0 40.0 21 35.286 38.0 34.0 39.0 28.0 40.0 22 35.37275 38.0 33.0 39.0 29.0 40.0 23 35.00175 38.0 33.0 39.0 27.0 40.0 24 35.19525 38.0 33.0 39.0 28.0 40.0 25 34.9465 38.0 33.0 39.0 27.0 40.0 26 35.04075 38.0 33.0 39.0 28.0 40.0 27 34.9295 38.0 33.0 39.0 28.0 40.0 28 34.42075 37.0 33.0 39.0 27.0 40.0 29 34.65725 38.0 33.0 39.0 27.0 40.0 30 33.978 36.0 33.0 39.0 26.0 40.0 31 33.915 37.0 33.0 39.0 25.0 40.0 32 33.67325 36.0 32.0 39.0 24.0 40.0 33 32.96075 36.0 31.0 38.0 23.0 40.0 34 33.37825 36.0 32.0 39.0 24.0 40.0 35 33.25 36.0 32.0 38.0 23.0 40.0 36 33.22325 36.0 32.0 39.0 23.0 40.0 37 33.02525 36.0 31.0 38.0 23.0 40.0 38 32.7335 36.0 31.0 38.0 23.0 40.0 39 32.5195 35.0 31.0 38.0 22.0 39.0 40 32.41975 35.0 30.0 38.0 23.0 39.0 41 32.47525 35.0 31.0 38.0 22.0 39.0 42 32.36725 35.0 31.0 38.0 22.0 39.0 43 32.0485 35.0 30.0 38.0 21.0 39.0 44 31.7 35.0 30.0 38.0 19.0 39.0 45 31.48 35.0 30.0 38.0 18.0 39.0 46 31.6925 35.0 30.0 38.0 18.0 39.0 47 31.50225 35.0 30.0 38.0 19.0 39.0 48 31.2605 35.0 29.0 38.0 18.0 39.0 49 31.06025 35.0 29.0 38.0 16.0 39.0 50 30.96575 35.0 29.0 38.0 17.0 39.0 51 30.64 35.0 29.0 38.0 12.0 39.0 52 30.31875 34.0 29.0 38.0 9.0 39.0 53 30.051 34.0 29.0 37.0 2.0 39.0 54 29.606 33.0 28.0 37.0 2.0 39.0 55 28.93425 33.0 27.0 36.0 2.0 39.0 56 28.677 33.0 27.0 36.0 2.0 39.0 57 27.87075 33.0 25.0 36.0 2.0 38.0 58 28.05875 33.0 26.0 36.0 2.0 38.0 59 27.38675 32.0 23.0 36.0 2.0 38.0 60 26.7065 32.0 23.0 35.0 2.0 38.0 61 26.76275 32.0 23.0 36.0 2.0 38.0 62 26.217 32.0 23.0 35.0 2.0 38.0 63 25.96775 31.0 22.0 35.0 2.0 38.0 64 25.6995 31.0 21.0 35.0 2.0 38.0 65 25.60425 31.0 21.0 35.0 2.0 38.0 66 25.35525 32.0 18.0 35.0 2.0 38.0 67 24.9025 31.0 17.0 35.0 2.0 38.0 68 24.572 31.0 15.0 35.0 2.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 0.0 5 4.0 6 3.0 7 4.0 8 7.0 9 10.0 10 11.0 11 20.0 12 23.0 13 21.0 14 18.0 15 18.0 16 21.0 17 26.0 18 31.0 19 21.0 20 37.0 21 43.0 22 60.0 23 50.0 24 64.0 25 73.0 26 82.0 27 88.0 28 113.0 29 128.0 30 148.0 31 166.0 32 227.0 33 293.0 34 315.0 35 411.0 36 470.0 37 543.0 38 366.0 39 73.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.690123146519223 16.737873837647648 16.964061321940186 39.60794169389294 2 22.2 24.8 33.75 19.25 3 24.625 27.224999999999998 25.4 22.75 4 24.925 33.125 21.375 20.575 5 26.375 34.075 21.975 17.575 6 18.0 38.7 23.549999999999997 19.75 7 17.2 18.575 44.925 19.3 8 19.8 23.549999999999997 30.099999999999998 26.55 9 21.2 22.475 32.025 24.3 10 19.125 38.550000000000004 24.175 18.15 11 24.75 28.775000000000002 22.975 23.5 12 22.15 25.0 28.025 24.825 13 20.175 28.000000000000004 31.374999999999996 20.45 14 20.7 29.175 29.75 20.375 15 20.75 27.450000000000003 27.474999999999998 24.325 16 22.15 27.400000000000002 28.575 21.875 17 22.475 28.075 26.85 22.6 18 21.8 29.025000000000002 26.700000000000003 22.475 19 21.8 28.549999999999997 26.900000000000002 22.75 20 22.725 27.725 27.575 21.975 21 21.65 28.15 28.549999999999997 21.65 22 21.75 29.275000000000002 26.950000000000003 22.025 23 21.2 28.225 28.199999999999996 22.375 24 21.9 28.299999999999997 27.200000000000003 22.6 25 20.599999999999998 29.099999999999998 28.475 21.825 26 21.625 28.249999999999996 28.299999999999997 21.825 27 21.725 28.549999999999997 27.950000000000003 21.775 28 21.625 28.050000000000004 27.800000000000004 22.525000000000002 29 22.0 28.9 27.825 21.275 30 22.325 28.525 28.249999999999996 20.9 31 22.475 28.325 27.625 21.575 32 21.45 28.075 28.599999999999998 21.875 33 22.925 28.325 27.450000000000003 21.3 34 22.325 28.050000000000004 27.450000000000003 22.175 35 21.875 26.6 28.65 22.875 36 21.325 27.875 28.15 22.650000000000002 37 22.325 28.299999999999997 28.599999999999998 20.775 38 21.875 28.9 28.075 21.15 39 23.125 27.3 27.474999999999998 22.1 40 21.725 29.075 27.800000000000004 21.4 41 22.275 28.225 28.449999999999996 21.05 42 21.275 28.249999999999996 28.025 22.45 43 21.825 27.6 27.800000000000004 22.775000000000002 44 21.75 27.85 27.950000000000003 22.45 45 22.375 27.675 28.225 21.725 46 23.05 27.725 27.825 21.4 47 23.25 27.750000000000004 27.275 21.725 48 23.05 26.974999999999998 27.775 22.2 49 22.275 27.525 27.0 23.200000000000003 50 22.225 28.599999999999998 27.425 21.75 51 22.275 28.475 27.05 22.2 52 23.025000000000002 29.099999999999998 26.650000000000002 21.224999999999998 53 21.95 29.775000000000002 26.775 21.5 54 22.5 28.725 26.8 21.975 55 21.725 29.849999999999998 26.625 21.8 56 22.825 27.35 28.749999999999996 21.075 57 22.15 28.225 27.150000000000002 22.475 58 23.325000000000003 27.875 27.474999999999998 21.325 59 22.05 27.700000000000003 27.525 22.725 60 21.975 28.15 27.800000000000004 22.075 61 22.875 28.775000000000002 26.650000000000002 21.7 62 22.25 27.875 27.325 22.55 63 22.025 27.250000000000004 28.199999999999996 22.525000000000002 64 23.025000000000002 28.075 27.250000000000004 21.65 65 22.1 27.775 27.325 22.8 66 22.2 28.875 27.450000000000003 21.475 67 23.025000000000002 27.525 26.525 22.925 68 22.75 27.500000000000004 27.800000000000004 21.95 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 2.0 22 4.0 23 4.0 24 3.5 25 3.0 26 8.0 27 13.0 28 13.0 29 15.0 30 25.0 31 33.0 32 48.5 33 74.5 34 85.0 35 97.5 36 144.0 37 178.0 38 207.5 39 275.5 40 348.0 41 382.0 42 376.5 43 384.5 44 398.0 45 371.0 46 338.5 47 333.0 48 310.5 49 258.0 50 228.0 51 195.0 52 144.0 53 126.0 54 113.0 55 77.5 56 55.0 57 44.0 58 30.0 59 27.0 60 25.0 61 19.0 62 15.0 63 12.5 64 7.5 65 7.5 66 10.0 67 7.5 68 4.0 69 3.0 70 2.5 71 1.0 72 0.0 73 0.5 74 1.0 75 1.0 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 393629 spots for SRR952894.sra Written 393629 spots for SRR952894.sra Read 393629 spots for SRR952894.sra Written 393629 spots for SRR952894.sra Read 393629 spots for SRR952894.sra Written 393629 spots for SRR952894.sra Read 393629 spots for SRR952894.sra Written 393629 spots for SRR952894.sra Read 393629 spots for SRR952894.sra Written 393629 spots for SRR952894.sra Read 393629 spots for SRR952894.sra Written 393629 spots for SRR952894.sra Read 393629 spots for SRR952894.sra Written 393629 spots for SRR952894.sra Read 393629 spots for SRR952894.sra Written 393629 spots for SRR952894.sra Read 393629 spots for SRR952894.sra Written 393629 spots for SRR952894.sra Read 393629 spots for SRR952894.sra Written 393629 spots for SRR952894.sra Read 393629 spots for SRR952894.sra Written 393629 spots for SRR952894.sra Read 393629 spots for SRR952894.sra Written 393629 spots for SRR952894.sra Read 393629 spots for SRR952894.sra Written 393629 spots for SRR952894.sra Read 393629 spots for SRR952894.sra Written 393629 spots for SRR952894.sra Read 393629 spots for SRR952894.sra Written 393629 spots for SRR952894.sra Read 393629 spots for SRR952894.sra Written 393629 spots for SRR952894.sra Read 393633 spots for SRR952894.sra Written 393633 spots for SRR952894.sra Read 393629 spots for SRR952894.sra Written 393629 spots for SRR952894.sra Read 393629 spots for SRR952894.sra Written 393629 spots for SRR952894.sra Read 393629 spots for SRR952894.sra Written 393629 spots for SRR952894.sra SRR ids: ['SRR952894.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kou1tyh0 SRR952894.sra spots: 7872584 blocks: [[1, 393629], [393630, 787258], [787259, 1180887], [1180888, 1574516], [1574517, 1968145], [1968146, 2361774], [2361775, 2755403], [2755404, 3149032], [3149033, 3542661], [3542662, 3936290], [3936291, 4329919], [4329920, 4723548], [4723549, 5117177], [5117178, 5510806], [5510807, 5904435], [5904436, 6298064], [6298065, 6691693], [6691694, 7085322], [7085323, 7478951], [7478952, 7872584]] SRR952894 file size 1645507 SRR952894 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR952894 SRR952894_1.fastq Input file: SRR952894_1.fastq trimmed: SRR952894-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 10:45:47 2025 >> started Mon Feb 10 10:45:51 2025 >> done (3.504s) 7872584 reads processed; of these: 23180 ( 0.29%) short reads filtered out after trimming by size control 11508 ( 0.15%) empty reads filtered out after trimming by size control 7837896 (99.56%) reads available; of these: 848430 (10.82%) trimmed reads available after processing 6989466 (89.18%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2660 0.03% 19 4034 0.05% 20 5752 0.07% 21 1975 0.03% 22 2991 0.04% 23 4349 0.06% 24 7354 0.09% 25 11421 0.15% 26 3107 0.04% 27 4531 0.06% 28 5748 0.07% 29 8751 0.11% 30 14009 0.18% 31 3882 0.05% 32 4772 0.06% 33 6368 0.08% 34 9715 0.12% 35 13869 0.18% 36 3951 0.05% 37 4889 0.06% 38 7578 0.10% 39 11167 0.14% 40 16795 0.21% 41 3962 0.05% 42 5662 0.07% 43 8137 0.10% 44 12940 0.17% 45 20411 0.26% 46 4910 0.06% 47 6958 0.09% 48 10744 0.14% 49 18377 0.23% 50 29419 0.38% 51 7477 0.10% 52 10980 0.14% 53 17965 0.23% 54 29058 0.37% 55 50854 0.65% 56 10656 0.14% 57 15336 0.20% 58 23660 0.30% 59 41548 0.53% 60 74818 0.95% 61 14519 0.19% 62 21949 0.28% 63 34488 0.44% 64 61191 0.78% 65 99263 1.27% 66 20736 0.26% 67 32744 0.42% 68 6989466 89.18% 7837896 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=28 prefix-density=0.13 prefix-fanout=2.0 sequence=CAAGGTAAGAGTTCATGGCCAGAGCT criterion=fanout-score sequence-density=0.04 sequence-density-rank=15 fanout-score=49.53 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=11.3 sequence=TGGTGGTGGAGG Started job on | Feb 10 10:46:04 Started mapping on | Feb 10 10:46:04 Finished on | Feb 10 10:46:12 Mapping speed, Million of reads per hour | 3527.05 Number of input reads | 7837896 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 7057307 Uniquely mapped reads % | 90.04% Average mapped length | 66.39 Number of splices: Total | 1480235 Number of splices: Annotated (sjdb) | 1460151 Number of splices: GT/AG | 1458522 Number of splices: GC/AG | 18928 Number of splices: AT/AC | 1160 Number of splices: Non-canonical | 1625 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 1.82 Insertion rate per base | 0.01% Insertion average length | 1.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 633390 % of reads mapped to multiple loci | 8.08% Number of reads mapped to too many loci | 54314 % of reads mapped to too many loci | 0.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.17% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 147199 147199 147199 N_multimapping 633390 633390 633390 N_noFeature 222915 3567506 3692144 N_ambiguous 37648 8689 8491 UnstrandedReadsAssigned:6796744 PositiveStrandReadsAssigned:3481112 NegativeStrandReadsAssigned:3356672 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR952894 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR952894-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,837,896 reads, 7,286,464 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52401 SRR952894.ke.tsv 34699 SRR952894.se.tsv 87100 total ==> SRR952894.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1358.49 130.775 Potri.005G024800.1.v4.1 1035 936 271 53.4855 Potri.004G059700.1.v4.1 961 862 4 0.857226 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 259.326 16.8445 Potri.016G087400.1.v4.1 270 171 203 219.302 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 288.059 31.7884 Potri.012G127500.1.v4.1 977 878 773 162.64 ==> SRR952894.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 95 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 3 SRR952894 completed mapping pipeline successfully