Starting /dee2/code/volunteer_pipeline.sh SRR952895 current disk space = 3058882043904 free memory = 1580410896 SRR952895 SRAfilesize 08327dc9443a16f07adc40669791a93a SRR952895.sra SRR952895.sra file validated SRR952895 is single end SRR952895 is conventional basespace SRR952895 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR952895_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.451 38.0 35.0 39.0 33.0 40.0 2 35.73325 38.0 35.0 39.0 30.0 40.0 3 35.2365 38.0 33.0 39.0 28.0 40.0 4 35.816 38.0 35.0 39.0 30.0 40.0 5 35.05375 38.0 33.0 39.0 28.0 40.0 6 35.33775 38.0 35.0 39.0 29.0 40.0 7 34.549 37.0 33.0 39.0 27.0 40.0 8 34.34225 37.0 33.0 39.0 26.0 40.0 9 33.82725 36.0 32.0 39.0 25.0 40.0 10 34.655 37.0 33.0 39.0 27.0 40.0 11 33.6435 36.0 32.0 38.0 25.0 39.0 12 33.35925 36.0 31.0 38.0 23.0 39.0 13 33.11825 35.0 30.0 38.0 23.0 39.0 14 32.8885 35.0 30.0 38.0 23.0 39.0 15 33.124 35.0 31.0 38.0 23.0 39.0 16 33.05375 36.0 31.0 38.0 23.0 39.0 17 33.15375 35.0 31.0 38.0 23.0 39.0 18 32.71725 35.0 30.0 38.0 23.0 39.0 19 32.84525 35.0 30.0 38.0 23.0 39.0 20 32.684 35.0 30.0 38.0 23.0 39.0 21 32.97025 36.0 31.0 38.0 23.0 39.0 22 32.64975 35.0 30.0 38.0 23.0 39.0 23 32.91525 35.0 31.0 38.0 23.0 39.0 24 32.59 35.0 30.0 38.0 23.0 39.0 25 32.6625 35.0 30.0 38.0 23.0 39.0 26 32.70875 36.0 31.0 38.0 23.0 39.0 27 31.94075 35.0 30.0 38.0 20.0 39.0 28 32.108 35.0 30.0 38.0 21.0 39.0 29 31.77775 35.0 30.0 38.0 20.0 39.0 30 31.06975 35.0 29.0 38.0 18.0 39.0 31 30.855 35.0 29.0 38.0 15.0 39.0 32 29.71925 33.0 27.0 37.0 12.0 39.0 33 29.54 33.0 26.0 37.0 13.0 39.0 34 29.09325 33.0 26.0 36.0 11.0 39.0 35 29.29375 33.0 27.0 37.0 11.0 39.0 36 29.15525 33.0 26.0 37.0 7.0 39.0 37 28.5215 33.0 25.0 36.0 6.0 39.0 38 28.4255 33.0 24.0 36.0 2.0 39.0 39 28.45775 33.0 25.0 36.0 2.0 38.0 40 28.1595 32.0 25.0 36.0 2.0 38.0 41 28.3475 33.0 25.0 36.0 2.0 39.0 42 28.1515 33.0 24.0 36.0 2.0 38.0 43 27.9405 32.0 24.0 36.0 2.0 38.0 44 28.146 33.0 25.0 36.0 2.0 38.0 45 27.98 32.0 25.0 36.0 2.0 38.0 46 27.976 33.0 25.0 36.0 2.0 38.0 47 28.49975 33.0 26.0 36.0 2.0 38.0 48 27.9365 33.0 25.0 36.0 2.0 38.0 49 27.959 33.0 25.0 36.0 2.0 38.0 50 27.9005 33.0 25.0 36.0 2.0 38.0 51 27.657 33.0 25.0 36.0 2.0 38.0 52 27.34325 33.0 24.0 36.0 2.0 38.0 53 27.41725 33.0 24.0 36.0 2.0 38.0 54 26.87375 32.0 23.0 36.0 2.0 38.0 55 26.77075 32.0 23.0 36.0 2.0 38.0 56 25.573 31.0 19.0 35.0 2.0 38.0 57 25.6445 31.0 20.0 35.0 2.0 38.0 58 24.89925 31.0 17.0 35.0 2.0 37.0 59 24.11475 30.0 15.0 34.0 2.0 36.0 60 24.0005 30.0 14.0 34.0 2.0 36.0 61 24.07275 30.0 9.0 35.0 2.0 37.0 62 24.07425 30.0 5.0 35.0 2.0 37.0 63 23.479 30.0 2.0 34.0 2.0 36.0 64 23.0215 29.0 2.0 34.0 2.0 36.0 65 22.76125 29.0 2.0 34.0 2.0 36.0 66 22.672 30.0 2.0 34.0 2.0 36.0 67 22.40075 30.0 2.0 34.0 2.0 36.0 68 21.7665 29.0 2.0 33.0 2.0 36.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 7.0 4 11.0 5 14.0 6 14.0 7 12.0 8 28.0 9 20.0 10 32.0 11 36.0 12 53.0 13 45.0 14 36.0 15 31.0 16 47.0 17 35.0 18 33.0 19 35.0 20 42.0 21 60.0 22 82.0 23 73.0 24 86.0 25 84.0 26 117.0 27 137.0 28 136.0 29 148.0 30 214.0 31 214.0 32 250.0 33 287.0 34 368.0 35 377.0 36 393.0 37 261.0 38 148.0 39 11.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.967418546365913 15.714285714285714 17.017543859649123 40.30075187969925 2 22.400000000000002 24.4 34.4 18.8 3 24.125 26.974999999999998 25.85 23.05 4 25.025 32.45 21.375 21.15 5 26.924999999999997 34.025 22.650000000000002 16.400000000000002 6 18.775 37.65 24.625 18.95 7 16.575 18.325 45.025 20.075000000000003 8 19.25 23.125 30.9 26.724999999999998 9 19.225 23.125 33.175 24.474999999999998 10 19.900000000000002 37.025000000000006 25.900000000000002 17.175 11 24.375 28.375 21.575 25.674999999999997 12 20.925 24.425 29.349999999999998 25.3 13 19.725 28.799999999999997 31.25 20.225 14 21.05 27.525 29.4 22.025 15 21.6 27.400000000000002 27.675 23.325000000000003 16 22.825 27.925 27.150000000000002 22.1 17 21.975 28.275 28.65 21.099999999999998 18 21.175 28.975 26.924999999999997 22.925 19 21.875 29.325000000000003 26.974999999999998 21.825 20 22.675 27.775 28.125 21.425 21 22.875 27.900000000000002 26.474999999999998 22.75 22 20.775 29.15 27.875 22.2 23 21.2 28.825 27.1 22.875 24 21.0 29.349999999999998 27.450000000000003 22.2 25 22.55 28.125 27.05 22.275 26 21.75 28.375 27.950000000000003 21.925 27 21.05 28.4 28.65 21.9 28 21.725 27.925 28.925 21.425 29 22.925 27.825 27.55 21.7 30 20.9 28.199999999999996 29.125 21.775 31 21.9 28.449999999999996 27.825 21.825 32 21.675 28.175 28.225 21.925 33 22.725 28.275 26.674999999999997 22.325 34 22.3 27.500000000000004 27.700000000000003 22.5 35 22.75 28.349999999999998 27.200000000000003 21.7 36 22.025 28.050000000000004 26.224999999999998 23.7 37 22.05 28.449999999999996 27.775 21.725 38 23.05 27.825 27.025 22.1 39 22.225 28.075 26.900000000000002 22.8 40 22.975 27.35 28.1 21.575 41 21.45 28.225 28.000000000000004 22.325 42 22.525000000000002 27.750000000000004 27.250000000000004 22.475 43 22.525000000000002 28.65 27.075 21.75 44 21.7 27.775 27.375 23.150000000000002 45 21.7 28.4 28.599999999999998 21.3 46 21.95 28.15 26.700000000000003 23.200000000000003 47 23.175 28.725 26.825 21.275 48 21.7 28.249999999999996 28.249999999999996 21.8 49 22.6 28.050000000000004 27.6 21.75 50 22.625 27.975 27.85 21.55 51 21.875 27.800000000000004 28.675 21.65 52 21.224999999999998 27.750000000000004 29.15 21.875 53 22.525000000000002 28.7 27.825 20.95 54 21.8 27.85 27.675 22.675 55 21.75 28.925 27.325 22.0 56 22.1 27.450000000000003 28.225 22.225 57 21.95 28.449999999999996 26.55 23.05 58 22.400000000000002 28.199999999999996 27.500000000000004 21.9 59 22.45 30.125 25.724999999999998 21.7 60 22.325 27.275 27.450000000000003 22.95 61 21.475 28.549999999999997 28.175 21.8 62 22.775000000000002 27.224999999999998 27.650000000000002 22.35 63 22.75 28.025 27.625 21.6 64 23.3 28.999999999999996 25.650000000000002 22.05 65 22.225 28.275 27.224999999999998 22.275 66 22.125 27.775 26.775 23.325000000000003 67 22.8 27.800000000000004 27.55 21.85 68 23.474999999999998 28.325 27.224999999999998 20.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 3.0 20 1.5 21 3.0 22 6.0 23 4.5 24 4.0 25 5.0 26 9.5 27 18.5 28 23.0 29 21.0 30 34.5 31 50.0 32 57.0 33 74.0 34 84.0 35 107.0 36 146.5 37 163.0 38 197.5 39 256.0 40 326.5 41 373.0 42 374.0 43 367.0 44 359.0 45 375.0 46 351.0 47 311.0 48 291.5 49 243.0 50 214.0 51 186.5 52 146.0 53 133.0 54 112.0 55 87.5 56 84.0 57 64.0 58 37.5 59 31.0 60 24.5 61 18.5 62 19.0 63 16.0 64 13.0 65 9.0 66 5.0 67 6.5 68 4.0 69 0.0 70 2.0 71 3.5 72 3.0 73 2.5 74 1.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 250205 spots for SRR952895.sra Written 250205 spots for SRR952895.sra Read 250205 spots for SRR952895.sra Written 250205 spots for SRR952895.sra Read 250205 spots for SRR952895.sra Written 250205 spots for SRR952895.sra Read 250205 spots for SRR952895.sra Written 250205 spots for SRR952895.sra Read 250205 spots for SRR952895.sra Written 250205 spots for SRR952895.sra Read 250205 spots for SRR952895.sra Written 250205 spots for SRR952895.sra Read 250205 spots for SRR952895.sra Written 250205 spots for SRR952895.sra Read 250205 spots for SRR952895.sra Written 250205 spots for SRR952895.sra Read 250205 spots for SRR952895.sra Written 250205 spots for SRR952895.sra Read 250205 spots for SRR952895.sra Written 250205 spots for SRR952895.sra Read 250205 spots for SRR952895.sra Written 250205 spots for SRR952895.sra Read 250205 spots for SRR952895.sra Written 250205 spots for SRR952895.sra Read 250205 spots for SRR952895.sra Written 250205 spots for SRR952895.sra Read 250205 spots for SRR952895.sra Written 250205 spots for SRR952895.sra Read 250222 spots for SRR952895.sra Written 250222 spots for SRR952895.sra Read 250205 spots for SRR952895.sra Written 250205 spots for SRR952895.sra Read 250205 spots for SRR952895.sra Written 250205 spots for SRR952895.sra Read 250205 spots for SRR952895.sra Written 250205 spots for SRR952895.sra Read 250205 spots for SRR952895.sra Written 250205 spots for SRR952895.sra Read 250205 spots for SRR952895.sra Written 250205 spots for SRR952895.sra SRR ids: ['SRR952895.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b3j73ghw SRR952895.sra spots: 5004117 blocks: [[1, 250205], [250206, 500410], [500411, 750615], [750616, 1000820], [1000821, 1251025], [1251026, 1501230], [1501231, 1751435], [1751436, 2001640], [2001641, 2251845], [2251846, 2502050], [2502051, 2752255], [2752256, 3002460], [3002461, 3252665], [3252666, 3502870], [3502871, 3753075], [3753076, 4003280], [4003281, 4253485], [4253486, 4503690], [4503691, 4753895], [4753896, 5004117]] SRR952895 file size 1045598 SRR952895 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR952895 SRR952895_1.fastq Input file: SRR952895_1.fastq trimmed: SRR952895-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 11:24:43 2025 >> started Mon Feb 10 11:24:45 2025 >> done (2.386s) 5004117 reads processed; of these: 14584 ( 0.29%) short reads filtered out after trimming by size control 14387 ( 0.29%) empty reads filtered out after trimming by size control 4975146 (99.42%) reads available; of these: 542267 (10.90%) trimmed reads available after processing 4432879 (89.10%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1627 0.03% 19 2468 0.05% 20 4236 0.09% 21 1295 0.03% 22 1882 0.04% 23 2840 0.06% 24 4574 0.09% 25 7762 0.16% 26 2038 0.04% 27 2816 0.06% 28 3666 0.07% 29 5457 0.11% 30 9089 0.18% 31 2375 0.05% 32 2826 0.06% 33 3735 0.08% 34 5792 0.12% 35 8927 0.18% 36 2406 0.05% 37 3060 0.06% 38 4271 0.09% 39 6526 0.13% 40 9981 0.20% 41 2542 0.05% 42 3637 0.07% 43 5219 0.10% 44 8060 0.16% 45 13479 0.27% 46 3078 0.06% 47 4404 0.09% 48 6832 0.14% 49 11555 0.23% 50 19986 0.40% 51 4639 0.09% 52 6916 0.14% 53 10795 0.22% 54 17624 0.35% 55 31663 0.64% 56 6449 0.13% 57 9664 0.19% 58 15174 0.30% 59 26666 0.54% 60 49722 1.00% 61 9472 0.19% 62 13828 0.28% 63 21779 0.44% 64 39175 0.79% 65 66470 1.34% 66 12943 0.26% 67 20847 0.42% 68 4432879 89.10% 4975146 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=51.69 fanout-score-rank=7 prefix-density=0.15 prefix-fanout=13.8 sequence=CAGCAGCAGCAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=15 fanout-score=211.12 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=22.6 sequence=CTTCTTCTTCTC Started job on | Feb 10 11:25:06 Started mapping on | Feb 10 11:25:06 Finished on | Feb 10 11:25:12 Mapping speed, Million of reads per hour | 2985.09 Number of input reads | 4975146 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 4598730 Uniquely mapped reads % | 92.43% Average mapped length | 66.41 Number of splices: Total | 954156 Number of splices: Annotated (sjdb) | 938310 Number of splices: GT/AG | 939648 Number of splices: GC/AG | 12493 Number of splices: AT/AC | 919 Number of splices: Non-canonical | 1096 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.77 Insertion rate per base | 0.01% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 263061 % of reads mapped to multiple loci | 5.29% Number of reads mapped to too many loci | 42171 % of reads mapped to too many loci | 0.85% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.42% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 113355 113355 113355 N_multimapping 263061 263061 263061 N_noFeature 183209 2343175 2424086 N_ambiguous 26639 6233 5845 UnstrandedReadsAssigned:4388882 PositiveStrandReadsAssigned:2249322 NegativeStrandReadsAssigned:2168799 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR952895 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR952895-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,975,146 reads, 4,560,382 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52401 SRR952895.ke.tsv 34699 SRR952895.se.tsv 87100 total ==> SRR952895.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1137.5 185.189 Potri.005G024800.1.v4.1 1035 936 506 168.893 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 201.067 22.0876 Potri.016G087400.1.v4.1 270 171 144 263.09 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 138.575 25.8623 Potri.012G127500.1.v4.1 977 878 952 338.75 ==> SRR952895.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 10 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 68 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 3 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 6 Potri.001G452600.v4.1 1 SRR952895 completed mapping pipeline successfully