Starting /dee2/code/volunteer_pipeline.sh SRR952896 current disk space = 3058886062080 free memory = 1133421148 SRR952896 SRAfilesize 2340e46df2e578019ab4c048647c1b11 SRR952896.sra SRR952896.sra file validated SRR952896 is single end SRR952896 is conventional basespace SRR952896 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR952896_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.791 38.0 35.0 40.0 31.0 40.0 2 36.09525 38.0 35.0 39.0 29.0 40.0 3 36.14475 38.0 35.0 39.0 29.0 40.0 4 36.031 38.0 35.0 39.0 29.0 40.0 5 36.18475 38.0 35.0 39.0 29.0 40.0 6 36.37775 38.0 35.0 39.0 30.0 40.0 7 36.35725 38.0 35.0 40.0 30.0 40.0 8 36.1875 38.0 35.0 39.0 30.0 40.0 9 36.10725 38.0 35.0 39.0 29.0 40.0 10 36.12375 38.0 35.0 39.0 30.0 40.0 11 36.35325 38.0 35.0 40.0 31.0 40.0 12 36.24475 38.0 35.0 39.0 30.0 40.0 13 36.125 38.0 35.0 39.0 30.0 40.0 14 36.1045 38.0 35.0 39.0 29.0 40.0 15 36.08225 38.0 35.0 39.0 29.0 40.0 16 36.141 38.0 35.0 39.0 30.0 40.0 17 35.993 38.0 35.0 39.0 29.0 40.0 18 35.944 38.0 35.0 39.0 29.0 40.0 19 35.8995 38.0 35.0 39.0 29.0 40.0 20 35.84125 38.0 35.0 39.0 29.0 40.0 21 35.902 38.0 35.0 39.0 29.0 40.0 22 35.764 38.0 35.0 39.0 29.0 40.0 23 35.707 38.0 35.0 39.0 29.0 40.0 24 35.588 38.0 35.0 39.0 28.0 40.0 25 35.43 38.0 34.0 39.0 28.0 40.0 26 35.42075 38.0 35.0 39.0 28.0 40.0 27 35.2235 38.0 34.0 39.0 28.0 40.0 28 35.06125 38.0 33.0 39.0 27.0 40.0 29 34.9895 38.0 33.0 39.0 27.0 40.0 30 35.04075 38.0 33.0 39.0 27.0 40.0 31 35.03125 38.0 33.0 39.0 27.0 40.0 32 34.749 38.0 33.0 39.0 26.0 40.0 33 34.623 38.0 33.0 39.0 26.0 40.0 34 34.55225 38.0 33.0 39.0 26.0 40.0 35 34.396 38.0 33.0 39.0 26.0 40.0 36 34.26175 38.0 33.0 39.0 25.0 40.0 37 34.33 38.0 33.0 39.0 26.0 40.0 38 34.11225 37.0 33.0 39.0 26.0 40.0 39 34.0365 37.0 33.0 39.0 26.0 40.0 40 33.73375 37.0 33.0 39.0 24.0 40.0 41 33.85725 37.0 33.0 39.0 24.0 40.0 42 33.583 37.0 32.0 39.0 23.0 40.0 43 33.4065 36.0 32.0 39.0 23.0 40.0 44 33.227 36.0 32.0 39.0 23.0 40.0 45 33.07425 36.0 32.0 39.0 23.0 40.0 46 33.10425 36.0 32.0 39.0 23.0 40.0 47 32.927 36.0 32.0 39.0 23.0 40.0 48 32.68025 36.0 31.0 39.0 22.0 40.0 49 32.45275 36.0 31.0 39.0 22.0 40.0 50 32.25675 36.0 31.0 39.0 20.0 40.0 51 32.14025 36.0 31.0 38.0 18.0 40.0 52 31.832 35.0 30.0 38.0 18.0 40.0 53 31.6085 35.0 30.0 38.0 17.0 39.0 54 31.4065 35.0 30.0 38.0 16.0 39.0 55 31.22725 35.0 30.0 38.0 14.0 39.0 56 30.9985 35.0 30.0 38.0 8.0 39.0 57 30.67775 35.0 29.0 38.0 6.0 39.0 58 30.25525 34.0 29.0 38.0 2.0 39.0 59 30.167 35.0 29.0 38.0 2.0 39.0 60 30.00675 34.0 29.0 38.0 2.0 39.0 61 29.65725 34.0 29.0 38.0 2.0 39.0 62 29.33125 34.0 28.0 38.0 2.0 39.0 63 29.20775 34.0 27.0 37.0 2.0 39.0 64 28.86225 33.0 27.0 37.0 2.0 39.0 65 28.559 33.0 27.0 37.0 2.0 39.0 66 28.341 33.0 27.0 37.0 2.0 39.0 67 27.955 33.0 26.0 37.0 2.0 39.0 68 27.627 33.0 25.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 2.0 4 2.0 5 5.0 6 2.0 7 3.0 8 4.0 9 5.0 10 17.0 11 6.0 12 9.0 13 17.0 14 22.0 15 13.0 16 18.0 17 15.0 18 16.0 19 27.0 20 34.0 21 28.0 22 38.0 23 44.0 24 52.0 25 56.0 26 58.0 27 65.0 28 90.0 29 112.0 30 126.0 31 137.0 32 153.0 33 205.0 34 264.0 35 335.0 36 438.0 37 575.0 38 612.0 39 379.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.3 16.2 17.2 43.3 2 20.718232044198896 25.389251632345555 33.72677046710196 20.165745856353592 3 23.875 28.725 26.3 21.099999999999998 4 23.775 31.775 21.95 22.5 5 26.200000000000003 33.875 23.25 16.675 6 20.075000000000003 37.325 23.125 19.475 7 16.525000000000002 18.725 44.45 20.3 8 19.55 23.45 30.875000000000004 26.125 9 21.2 23.599999999999998 30.125 25.074999999999996 10 19.05 41.0 22.900000000000002 17.05 11 25.650000000000002 26.450000000000003 23.05 24.85 12 22.625 24.65 28.025 24.7 13 19.05 29.675 30.349999999999998 20.925 14 21.4 27.05 30.049999999999997 21.5 15 20.825 28.925 27.450000000000003 22.8 16 20.05 29.2 26.875 23.875 17 22.5 27.725 26.575 23.200000000000003 18 22.3 28.449999999999996 26.875 22.375 19 21.375 28.075 28.625 21.925 20 22.650000000000002 27.125 28.525 21.7 21 22.8 27.35 27.450000000000003 22.400000000000002 22 21.925 29.25 26.025 22.8 23 21.4 29.65 28.125 20.825 24 21.0 30.275000000000002 26.900000000000002 21.825 25 21.95 27.925 28.925 21.2 26 22.25 29.125 26.625 22.0 27 20.724999999999998 28.825 27.925 22.525000000000002 28 20.925 28.575 28.749999999999996 21.75 29 22.925 28.299999999999997 27.224999999999998 21.55 30 23.025000000000002 28.375 28.675 19.925 31 21.025 28.449999999999996 27.625 22.900000000000002 32 22.625 28.575 27.1 21.7 33 21.925 27.525 27.575 22.975 34 22.425 27.150000000000002 28.349999999999998 22.075 35 23.7 27.6 27.35 21.349999999999998 36 22.025 28.125 28.249999999999996 21.6 37 22.475 28.7 26.6 22.225 38 22.35 27.05 27.200000000000003 23.400000000000002 39 21.575 29.45 27.575 21.4 40 22.3 29.925 27.200000000000003 20.575 41 22.025 27.150000000000002 27.900000000000002 22.925 42 21.525 28.525 27.250000000000004 22.7 43 21.4 29.349999999999998 28.050000000000004 21.2 44 22.575 27.800000000000004 26.825 22.8 45 22.25 27.400000000000002 27.875 22.475 46 21.275 27.224999999999998 28.925 22.575 47 21.275 27.525 28.999999999999996 22.2 48 21.075 28.525 27.6 22.8 49 22.575 28.549999999999997 28.15 20.724999999999998 50 22.825 26.950000000000003 28.125 22.1 51 21.725 27.875 27.625 22.775000000000002 52 23.5 27.525 28.199999999999996 20.775 53 21.85 28.199999999999996 27.825 22.125 54 21.425 27.6 28.525 22.45 55 20.95 27.35 28.749999999999996 22.95 56 22.475 27.425 27.750000000000004 22.35 57 21.575 29.225 26.825 22.375 58 22.95 28.15 28.449999999999996 20.45 59 22.525000000000002 26.974999999999998 28.725 21.775 60 22.95 28.125 27.725 21.2 61 21.349999999999998 27.950000000000003 29.075 21.625 62 22.575 27.900000000000002 28.475 21.05 63 21.925 27.950000000000003 28.050000000000004 22.075 64 21.05 29.2 28.849999999999998 20.9 65 21.6 28.799999999999997 28.325 21.275 66 21.975 29.049999999999997 27.400000000000002 21.575 67 21.625 31.2 26.55 20.625 68 22.3 28.95 27.474999999999998 21.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 3.0 20 2.5 21 4.5 22 7.0 23 6.0 24 6.5 25 8.0 26 10.0 27 15.5 28 19.0 29 20.0 30 32.0 31 43.0 32 54.0 33 77.0 34 89.0 35 111.5 36 169.5 37 205.0 38 223.5 39 268.0 40 336.5 41 379.0 42 348.5 43 344.5 44 371.0 45 367.5 46 342.5 47 321.0 48 308.5 49 254.0 50 212.0 51 183.5 52 146.0 53 137.0 54 113.0 55 73.5 56 58.0 57 52.0 58 36.0 59 26.0 60 24.5 61 21.0 62 19.0 63 15.5 64 9.5 65 4.5 66 2.0 67 2.0 68 2.0 69 2.0 70 2.0 71 2.5 72 3.0 73 3.0 74 2.5 75 2.0 76 1.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87399193548387 99.075 2 0.07560483870967742 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025201612903225805 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025201612903225805 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAA 24 0.6 TruSeq Adapter, Index 4 (100% over 63bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAA 7 0.17500000000000002 TruSeq Adapter, Index 4 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.175 0.0 0.0 0.0 0.0 2 0.175 0.0 0.0 0.0 0.0 3 0.175 0.0 0.0 0.0 0.0 4 0.175 0.0 0.0 0.0 0.0 5 0.175 0.0 0.0 0.0 0.0 6 0.175 0.0 0.0 0.0 0.0 7 0.175 0.0 0.0 0.0 0.0 8 0.175 0.0 0.0 0.0 0.0 9 0.175 0.0 0.0 0.0 0.0 10 0.175 0.0 0.0 0.0 0.0 11 0.175 0.0 0.0 0.0 0.0 12 0.175 0.0 0.0 0.0 0.0 13 0.175 0.0 0.0 0.0 0.0 14 0.175 0.0 0.0 0.0 0.0 15 0.175 0.0 0.0 0.0 0.0 16 0.175 0.0 0.0 0.0 0.0 17 0.175 0.0 0.0 0.0 0.0 18 0.175 0.0 0.0 0.0 0.0 19 0.175 0.0 0.0 0.0 0.0 20 0.175 0.0 0.0 0.0 0.0 21 0.175 0.0 0.0 0.0 0.0 22 0.175 0.0 0.0 0.0 0.0 23 0.175 0.0 0.0 0.0 0.0 24 0.175 0.0 0.0 0.0 0.0 25 0.175 0.0 0.0 0.0 0.0 26 0.175 0.0 0.0 0.0 0.0 27 0.175 0.0 0.0 0.0 0.0 28 0.175 0.0 0.0 0.0 0.0 29 0.175 0.0 0.0 0.0 0.0 30 0.175 0.0 0.0 0.0 0.0 31 0.175 0.0 0.0 0.0 0.0 32 0.175 0.0 0.0 0.0 0.0 33 0.175 0.0 0.0 0.0 0.0 34 0.175 0.0 0.0 0.0 0.0 35 0.175 0.0 0.0 0.0 0.0 36 0.175 0.0 0.0 0.0 0.0 37 0.175 0.0 0.0 0.0 0.0 38 0.175 0.0 0.0 0.0 0.0 39 0.175 0.0 0.0 0.0 0.0 40 0.175 0.0 0.0 0.0 0.0 41 0.175 0.0 0.0 0.0 0.0 42 0.175 0.0 0.0 0.0 0.0 43 0.175 0.0 0.0 0.0 0.0 44 0.175 0.0 0.0 0.0 0.0 45 0.175 0.0 0.0 0.0 0.0 46 0.175 0.0 0.0 0.0 0.0 47 0.175 0.0 0.0 0.0 0.0 48 0.175 0.0 0.0 0.0 0.0 49 0.175 0.0 0.0 0.0 0.0 50 0.175 0.0 0.0 0.0 0.0 51 0.175 0.0 0.0 0.0 0.0 52 0.175 0.0 0.0 0.0 0.0 53 0.175 0.0 0.0 0.0 0.0 54 0.175 0.0 0.0 0.0 0.0 55 0.175 0.0 0.0 0.0 0.0 56 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 316654 spots for SRR952896.sra Written 316654 spots for SRR952896.sra Read 316654 spots for SRR952896.sra Written 316654 spots for SRR952896.sra Read 316654 spots for SRR952896.sra Written 316654 spots for SRR952896.sra Read 316654 spots for SRR952896.sra Written 316654 spots for SRR952896.sra Read 316654 spots for SRR952896.sra Written 316654 spots for SRR952896.sra Read 316654 spots for SRR952896.sra Written 316654 spots for SRR952896.sra Read 316654 spots for SRR952896.sra Written 316654 spots for SRR952896.sra Read 316654 spots for SRR952896.sra Written 316654 spots for SRR952896.sra Read 316654 spots for SRR952896.sra Written 316654 spots for SRR952896.sra Read 316654 spots for SRR952896.sra Written 316654 spots for SRR952896.sra Read 316654 spots for SRR952896.sra Written 316654 spots for SRR952896.sra Read 316654 spots for SRR952896.sra Written 316654 spots for SRR952896.sra Read 316654 spots for SRR952896.sra Written 316654 spots for SRR952896.sra Read 316654 spots for SRR952896.sra Written 316654 spots for SRR952896.sra Read 316654 spots for SRR952896.sra Written 316654 spots for SRR952896.sra Read 316654 spots for SRR952896.sra Written 316654 spots for SRR952896.sra Read 316654 spots for SRR952896.sra Written 316654 spots for SRR952896.sra Read 316654 spots for SRR952896.sra Written 316654 spots for SRR952896.sra Read 316654 spots for SRR952896.sra Written 316654 spots for SRR952896.sra Read 316659 spots for SRR952896.sra Written 316659 spots for SRR952896.sra SRR ids: ['SRR952896.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uyjj253e SRR952896.sra spots: 6333085 blocks: [[1, 316654], [316655, 633308], [633309, 949962], [949963, 1266616], [1266617, 1583270], [1583271, 1899924], [1899925, 2216578], [2216579, 2533232], [2533233, 2849886], [2849887, 3166540], [3166541, 3483194], [3483195, 3799848], [3799849, 4116502], [4116503, 4433156], [4433157, 4749810], [4749811, 5066464], [5066465, 5383118], [5383119, 5699772], [5699773, 6016426], [6016427, 6333085]] SRR952896 file size 1323612 SRR952896 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR952896 SRR952896_1.fastq Input file: SRR952896_1.fastq trimmed: SRR952896-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 11:24:36 2025 >> started Mon Feb 10 11:24:39 2025 >> done (3.165s) 6333085 reads processed; of these: 38313 ( 0.60%) short reads filtered out after trimming by size control 91362 ( 1.44%) empty reads filtered out after trimming by size control 6203410 (97.95%) reads available; of these: 835736 (13.47%) trimmed reads available after processing 5367674 (86.53%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2358 0.04% 19 3759 0.06% 20 5950 0.10% 21 1880 0.03% 22 2767 0.04% 23 4171 0.07% 24 6551 0.11% 25 11045 0.18% 26 2830 0.05% 27 3672 0.06% 28 5274 0.09% 29 7980 0.13% 30 12027 0.19% 31 3022 0.05% 32 4255 0.07% 33 5950 0.10% 34 9423 0.15% 35 15088 0.24% 36 3658 0.06% 37 5240 0.08% 38 7580 0.12% 39 12088 0.19% 40 18799 0.30% 41 4657 0.08% 42 6378 0.10% 43 9567 0.15% 44 15771 0.25% 45 25888 0.42% 46 6112 0.10% 47 8404 0.14% 48 12756 0.21% 49 21030 0.34% 50 35230 0.57% 51 7788 0.13% 52 10935 0.18% 53 16545 0.27% 54 28779 0.46% 55 50624 0.82% 56 10032 0.16% 57 14107 0.23% 58 21978 0.35% 59 40120 0.65% 60 72580 1.17% 61 13660 0.22% 62 19468 0.31% 63 30838 0.50% 64 55632 0.90% 65 91530 1.48% 66 18821 0.30% 67 31139 0.50% 68 5367674 86.53% 6203410 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=17 prefix-density=0.04 prefix-fanout=2.0 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.03 sequence-density-rank=4 fanout-score=205.83 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=24.1 sequence=AAGAAGAAGAAA Started job on | Feb 10 11:24:51 Started mapping on | Feb 10 11:24:52 Finished on | Feb 10 11:24:58 Mapping speed, Million of reads per hour | 3722.05 Number of input reads | 6203410 Average input read length | 65 UNIQUE READS: Uniquely mapped reads number | 5748101 Uniquely mapped reads % | 92.66% Average mapped length | 65.97 Number of splices: Total | 1156492 Number of splices: Annotated (sjdb) | 1135284 Number of splices: GT/AG | 1138900 Number of splices: GC/AG | 15073 Number of splices: AT/AC | 1134 Number of splices: Non-canonical | 1385 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.79 Insertion rate per base | 0.01% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 315433 % of reads mapped to multiple loci | 5.08% Number of reads mapped to too many loci | 72582 % of reads mapped to too many loci | 1.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.07% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 139876 139876 139876 N_multimapping 315433 315433 315433 N_noFeature 286682 2963877 3052164 N_ambiguous 34221 7952 7677 UnstrandedReadsAssigned:5427198 PositiveStrandReadsAssigned:2776272 NegativeStrandReadsAssigned:2688260 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR952896 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR952896-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,203,410 reads, 5,635,617 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,039 rounds 52401 SRR952896.ke.tsv 34699 SRR952896.se.tsv 87100 total ==> SRR952896.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1266 166.596 Potri.005G024800.1.v4.1 1035 936 846 228.245 Potri.004G059700.1.v4.1 961 862 1 0.292954 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 179.827 15.9673 Potri.016G087400.1.v4.1 270 171 138 203.793 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 152.661 23.0292 Potri.012G127500.1.v4.1 977 878 2005 576.668 ==> SRR952896.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 23 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 100 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 15 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 0 SRR952896 completed mapping pipeline successfully