Starting /dee2/code/volunteer_pipeline.sh SRR952897 current disk space = 3058895212544 free memory = 1202374620 SRR952897 SRAfilesize 0099bf21e3b132eb096259e1edb28510 SRR952897.sra SRR952897.sra file validated SRR952897 is single end SRR952897 is conventional basespace SRR952897 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR952897_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.6425 36.0 33.0 38.0 28.0 39.0 2 33.8825 36.0 32.0 39.0 25.0 40.0 3 33.7505 36.0 31.0 38.0 25.0 39.0 4 33.7785 36.0 31.0 38.0 25.0 40.0 5 33.901 36.0 32.0 38.0 25.0 39.0 6 34.61725 37.0 33.0 39.0 27.0 40.0 7 34.72475 37.0 33.0 39.0 27.0 40.0 8 34.299 36.0 33.0 38.0 26.0 40.0 9 34.4215 36.0 33.0 38.0 27.0 40.0 10 34.33075 36.0 33.0 38.0 26.0 40.0 11 34.276 36.0 33.0 39.0 26.0 40.0 12 34.17425 36.0 32.0 39.0 26.0 40.0 13 33.968 36.0 32.0 38.0 25.0 40.0 14 34.19775 36.0 33.0 38.0 26.0 40.0 15 34.116 36.0 33.0 38.0 26.0 40.0 16 34.1065 36.0 33.0 38.0 26.0 40.0 17 33.89275 36.0 31.0 38.0 25.0 40.0 18 34.14275 36.0 33.0 38.0 26.0 40.0 19 33.5635 36.0 31.0 38.0 25.0 39.0 20 33.8925 36.0 32.0 38.0 26.0 39.0 21 34.06525 36.0 33.0 38.0 26.0 40.0 22 33.65225 36.0 32.0 38.0 25.0 39.0 23 33.66975 36.0 31.0 38.0 25.0 39.0 24 33.651 36.0 31.0 38.0 25.0 39.0 25 33.44775 36.0 31.0 38.0 25.0 39.0 26 33.46825 36.0 32.0 38.0 25.0 39.0 27 32.9905 36.0 31.0 38.0 23.0 39.0 28 32.9055 35.0 31.0 38.0 23.0 39.0 29 32.73975 35.0 31.0 38.0 23.0 39.0 30 32.527 35.0 30.0 38.0 23.0 39.0 31 32.53325 35.0 31.0 38.0 22.0 39.0 32 31.822 35.0 29.0 38.0 19.0 39.0 33 31.69175 35.0 29.0 38.0 19.0 39.0 34 31.53125 35.0 29.0 38.0 18.0 39.0 35 31.3745 35.0 29.0 38.0 19.0 39.0 36 31.26275 35.0 29.0 38.0 17.0 39.0 37 31.17525 35.0 29.0 38.0 17.0 39.0 38 30.48175 34.0 28.0 38.0 16.0 39.0 39 29.995 33.0 27.0 38.0 14.0 39.0 40 30.3 34.0 27.0 38.0 15.0 39.0 41 30.3145 34.0 28.0 38.0 13.0 39.0 42 30.12775 34.0 27.0 38.0 12.0 39.0 43 29.9835 34.0 27.0 38.0 12.0 39.0 44 29.90675 33.0 27.0 38.0 10.0 39.0 45 29.4745 33.0 27.0 37.0 9.0 39.0 46 29.12975 33.0 26.0 37.0 2.0 39.0 47 29.02875 33.0 26.0 37.0 2.0 39.0 48 29.007 33.0 26.0 37.0 2.0 39.0 49 28.549 33.0 26.0 37.0 2.0 38.0 50 28.451 33.0 26.0 36.0 2.0 38.0 51 28.2765 33.0 26.0 36.0 2.0 39.0 52 27.85575 33.0 25.0 36.0 2.0 38.0 53 27.97625 33.0 25.0 36.0 2.0 38.0 54 26.97775 32.0 23.0 36.0 2.0 38.0 55 26.614 32.0 22.0 36.0 2.0 38.0 56 26.42025 32.0 21.0 36.0 2.0 38.0 57 25.98825 31.0 20.0 36.0 2.0 38.0 58 25.8185 32.0 19.0 35.0 2.0 38.0 59 25.56 31.0 18.0 35.0 2.0 38.0 60 24.977 31.0 16.0 35.0 2.0 38.0 61 24.276 30.0 7.0 35.0 2.0 38.0 62 23.91825 30.0 2.0 35.0 2.0 38.0 63 23.7035 30.0 2.0 35.0 2.0 38.0 64 22.74425 29.0 2.0 34.0 2.0 37.0 65 22.5685 29.0 2.0 34.0 2.0 37.0 66 22.31525 30.0 2.0 35.0 2.0 38.0 67 21.9775 29.0 2.0 34.0 2.0 37.0 68 21.8465 29.0 2.0 34.0 2.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 1.0 4 2.0 5 8.0 6 7.0 7 4.0 8 10.0 9 19.0 10 21.0 11 24.0 12 33.0 13 29.0 14 28.0 15 26.0 16 50.0 17 39.0 18 50.0 19 50.0 20 62.0 21 56.0 22 69.0 23 82.0 24 98.0 25 102.0 26 104.0 27 134.0 28 147.0 29 138.0 30 209.0 31 214.0 32 232.0 33 283.0 34 314.0 35 400.0 36 377.0 37 316.0 38 211.0 39 35.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.224999999999998 17.974999999999998 16.900000000000002 37.9 2 22.63012320844858 26.10007543374403 31.908473723912493 19.361327633894895 3 24.575 28.95 24.575 21.9 4 23.225 33.925 21.7 21.15 5 28.599999999999998 33.6 21.9 15.9 6 18.675 39.15 23.474999999999998 18.7 7 16.75 19.725 43.95 19.575 8 19.025 24.675 30.7 25.6 9 20.325 23.825 33.050000000000004 22.8 10 20.674999999999997 36.8 25.900000000000002 16.625 11 25.7 29.349999999999998 21.45 23.5 12 20.5 26.3 28.799999999999997 24.4 13 21.224999999999998 27.900000000000002 30.325000000000003 20.549999999999997 14 20.825 29.25 28.299999999999997 21.625 15 21.7 28.65 27.975 21.675 16 21.15 28.9 27.900000000000002 22.05 17 22.675 28.15 27.925 21.25 18 20.45 28.375 28.925 22.25 19 22.625 28.050000000000004 27.450000000000003 21.875 20 22.575 26.875 27.500000000000004 23.05 21 21.5 29.349999999999998 28.4 20.75 22 21.95 30.349999999999998 27.0 20.7 23 23.3 28.325 26.200000000000003 22.175 24 20.5 28.775000000000002 28.15 22.575 25 22.575 29.025000000000002 28.225 20.175 26 22.025 28.575 27.800000000000004 21.6 27 20.625 28.925 28.9 21.55 28 21.675 28.025 27.425 22.875 29 21.85 27.85 27.500000000000004 22.8 30 20.375 28.65 29.15 21.825 31 22.525000000000002 27.900000000000002 28.7 20.875 32 22.0 27.775 28.000000000000004 22.225 33 22.625 28.7 26.674999999999997 22.0 34 21.05 28.175 28.1 22.675 35 22.025 29.299999999999997 27.125 21.55 36 21.75 28.925 28.525 20.8 37 22.475 27.900000000000002 27.825 21.8 38 21.625 28.499999999999996 28.199999999999996 21.675 39 21.349999999999998 29.075 27.425 22.15 40 21.25 28.975 27.725 22.05 41 23.1 27.85 27.250000000000004 21.8 42 21.175 27.825 29.375 21.625 43 21.575 28.249999999999996 28.349999999999998 21.825 44 21.575 28.4 28.050000000000004 21.975 45 21.7 29.099999999999998 27.375 21.825 46 23.325000000000003 27.875 27.05 21.75 47 22.15 28.95 28.625 20.275000000000002 48 21.05 28.525 27.775 22.650000000000002 49 21.15 28.525 27.950000000000003 22.375 50 21.825 28.95 27.900000000000002 21.325 51 22.825 27.825 27.725 21.625 52 22.425 28.000000000000004 28.225 21.349999999999998 53 21.9 29.275000000000002 28.325 20.5 54 22.15 27.474999999999998 27.400000000000002 22.975 55 22.225 27.900000000000002 27.900000000000002 21.975 56 22.6 28.675 26.924999999999997 21.8 57 22.55 28.799999999999997 27.625 21.025 58 23.075000000000003 27.125 28.425 21.375 59 22.875 27.250000000000004 27.700000000000003 22.175 60 22.775000000000002 27.900000000000002 28.1 21.224999999999998 61 22.55 27.500000000000004 27.800000000000004 22.15 62 22.375 28.275 28.15 21.2 63 22.35 27.975 27.474999999999998 22.2 64 22.425 27.425 28.299999999999997 21.85 65 22.775000000000002 29.025000000000002 26.6 21.6 66 22.25 29.4 27.075 21.275 67 22.45 27.975 28.425 21.15 68 22.650000000000002 27.250000000000004 26.974999999999998 23.125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 1.5 21 3.0 22 3.0 23 4.5 24 5.5 25 5.0 26 10.0 27 17.0 28 19.0 29 22.5 30 30.5 31 35.0 32 50.5 33 81.0 34 96.0 35 124.5 36 174.0 37 195.0 38 231.5 39 286.0 40 344.0 41 384.0 42 378.0 43 357.0 44 342.0 45 353.0 46 332.0 47 300.0 48 287.5 49 244.0 50 213.0 51 183.5 52 134.5 53 115.0 54 94.0 55 71.0 56 69.0 57 57.5 58 35.0 59 24.0 60 22.0 61 15.5 62 11.0 63 9.5 64 9.0 65 9.5 66 9.0 67 7.5 68 4.0 69 2.0 70 2.0 71 1.0 72 0.0 73 0.0 74 0.5 75 1.0 76 0.5 77 0.5 78 1.0 79 1.0 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94997498749375 99.9 2 0.05002501250625312 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 367122 spots for SRR952897.sra Written 367122 spots for SRR952897.sra Read 367122 spots for SRR952897.sra Written 367122 spots for SRR952897.sra Read 367122 spots for SRR952897.sra Written 367122 spots for SRR952897.sra Read 367122 spots for SRR952897.sra Written 367122 spots for SRR952897.sra Read 367122 spots for SRR952897.sra Written 367122 spots for SRR952897.sra Read 367122 spots for SRR952897.sra Written 367122 spots for SRR952897.sra Read 367122 spots for SRR952897.sra Written 367122 spots for SRR952897.sra Read 367122 spots for SRR952897.sra Written 367122 spots for SRR952897.sra Read 367122 spots for SRR952897.sra Written 367122 spots for SRR952897.sra Read 367122 spots for SRR952897.sra Written 367122 spots for SRR952897.sra Read 367122 spots for SRR952897.sra Written 367122 spots for SRR952897.sra Read 367122 spots for SRR952897.sra Written 367122 spots for SRR952897.sra Read 367122 spots for SRR952897.sra Written 367122 spots for SRR952897.sra Read 367122 spots for SRR952897.sra Written 367122 spots for SRR952897.sra Read 367122 spots for SRR952897.sra Written 367122 spots for SRR952897.sra Read 367122 spots for SRR952897.sra Written 367122 spots for SRR952897.sra Read 367122 spots for SRR952897.sra Written 367122 spots for SRR952897.sra Read 367133 spots for SRR952897.sra Written 367133 spots for SRR952897.sra Read 367122 spots for SRR952897.sra Written 367122 spots for SRR952897.sra Read 367122 spots for SRR952897.sra Written 367122 spots for SRR952897.sra SRR ids: ['SRR952897.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_twhpnlt5 SRR952897.sra spots: 7342451 blocks: [[1, 367122], [367123, 734244], [734245, 1101366], [1101367, 1468488], [1468489, 1835610], [1835611, 2202732], [2202733, 2569854], [2569855, 2936976], [2936977, 3304098], [3304099, 3671220], [3671221, 4038342], [4038343, 4405464], [4405465, 4772586], [4772587, 5139708], [5139709, 5506830], [5506831, 5873952], [5873953, 6241074], [6241075, 6608196], [6608197, 6975318], [6975319, 7342451]] SRR952897 file size 1534682 SRR952897 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR952897 SRR952897_1.fastq Input file: SRR952897_1.fastq trimmed: SRR952897-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 11:24:01 2025 >> started Mon Feb 10 11:24:04 2025 >> done (3.459s) 7342451 reads processed; of these: 34057 ( 0.46%) short reads filtered out after trimming by size control 11916 ( 0.16%) empty reads filtered out after trimming by size control 7296478 (99.37%) reads available; of these: 1143660 (15.67%) trimmed reads available after processing 6152818 (84.33%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3816 0.05% 19 6129 0.08% 20 9050 0.12% 21 2806 0.04% 22 4358 0.06% 23 6422 0.09% 24 10829 0.15% 25 17349 0.24% 26 4533 0.06% 27 6203 0.09% 28 8549 0.12% 29 13121 0.18% 30 20315 0.28% 31 5763 0.08% 32 6753 0.09% 33 9806 0.13% 34 14067 0.19% 35 21330 0.29% 36 5542 0.08% 37 6965 0.10% 38 9979 0.14% 39 14990 0.21% 40 21865 0.30% 41 5544 0.08% 42 7669 0.11% 43 11797 0.16% 44 18867 0.26% 45 27959 0.38% 46 7121 0.10% 47 10562 0.14% 48 16656 0.23% 49 27638 0.38% 50 47386 0.65% 51 10648 0.15% 52 15649 0.21% 53 24940 0.34% 54 40858 0.56% 55 68683 0.94% 56 14564 0.20% 57 20848 0.29% 58 32445 0.44% 59 54615 0.75% 60 92301 1.27% 61 19608 0.27% 62 28241 0.39% 63 45004 0.62% 64 76172 1.04% 65 120839 1.66% 66 27060 0.37% 67 39446 0.54% 68 6152818 84.33% 7296478 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=40.89 fanout-score-rank=11 prefix-density=0.13 prefix-fanout=12.6 sequence=CAGCAGCAGCAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=16 fanout-score=266.00 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=21.5 sequence=AAGAAGAAGAGA Started job on | Feb 10 11:24:21 Started mapping on | Feb 10 11:24:25 Finished on | Feb 10 11:24:32 Mapping speed, Million of reads per hour | 3752.47 Number of input reads | 7296478 Average input read length | 65 UNIQUE READS: Uniquely mapped reads number | 6809486 Uniquely mapped reads % | 93.33% Average mapped length | 65.60 Number of splices: Total | 1425859 Number of splices: Annotated (sjdb) | 1402369 Number of splices: GT/AG | 1404216 Number of splices: GC/AG | 18984 Number of splices: AT/AC | 1209 Number of splices: Non-canonical | 1450 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.76 Insertion rate per base | 0.01% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 381020 % of reads mapped to multiple loci | 5.22% Number of reads mapped to too many loci | 58390 % of reads mapped to too many loci | 0.80% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.64% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 105972 105972 105972 N_multimapping 381020 381020 381020 N_noFeature 279729 3423060 3643493 N_ambiguous 39435 8762 8176 UnstrandedReadsAssigned:6490322 PositiveStrandReadsAssigned:3377664 NegativeStrandReadsAssigned:3157817 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=64 echo kmer=59 SRR952897 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR952897-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,296,478 reads, 6,683,303 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR952897.ke.tsv 34699 SRR952897.se.tsv 87100 total ==> SRR952897.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1270.46 139.047 Potri.005G024800.1.v4.1 1035 936 714 160.213 Potri.004G059700.1.v4.1 961 862 1 0.243651 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 235.883 17.4198 Potri.016G087400.1.v4.1 270 171 247 303.372 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 338.591 42.481 Potri.012G127500.1.v4.1 977 878 1990 476.029 ==> SRR952897.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 30 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 118 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 5 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 1 SRR952897 completed mapping pipeline successfully