Starting /dee2/code/volunteer_pipeline.sh SRR952898 current disk space = 3058890502144 free memory = 1146341736 SRR952898 SRAfilesize 9f1881e8c25532b493081258fb6589e5 SRR952898.sra SRR952898.sra file validated SRR952898 is single end SRR952898 is conventional basespace SRR952898 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR952898_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.37425 38.0 35.0 39.0 32.0 40.0 2 35.625 38.0 35.0 39.0 29.0 40.0 3 35.13325 38.0 33.0 39.0 28.0 40.0 4 35.71825 38.0 35.0 39.0 30.0 40.0 5 34.89875 38.0 33.0 39.0 27.0 40.0 6 35.2705 38.0 34.0 39.0 29.0 40.0 7 34.50375 36.0 33.0 39.0 27.0 40.0 8 34.4155 36.0 33.0 39.0 27.0 40.0 9 33.82525 36.0 32.0 38.0 25.0 39.0 10 34.59975 37.0 33.0 39.0 27.0 40.0 11 33.4265 36.0 31.0 38.0 24.0 39.0 12 33.17375 35.0 30.0 38.0 23.0 39.0 13 32.90725 35.0 30.0 38.0 23.0 39.0 14 32.785 35.0 30.0 38.0 23.0 39.0 15 32.853 35.0 30.0 38.0 23.0 39.0 16 32.95275 35.0 31.0 38.0 23.0 39.0 17 32.95075 35.0 30.0 38.0 23.0 39.0 18 32.66425 35.0 30.0 38.0 23.0 39.0 19 32.69 35.0 30.0 38.0 23.0 39.0 20 32.4805 35.0 30.0 38.0 23.0 39.0 21 32.70225 35.0 30.0 38.0 22.0 39.0 22 32.3885 35.0 30.0 38.0 22.0 39.0 23 32.77375 35.0 30.0 38.0 23.0 39.0 24 32.46525 35.0 30.0 38.0 23.0 39.0 25 32.497 35.0 30.0 38.0 23.0 39.0 26 32.555 36.0 31.0 38.0 22.0 39.0 27 31.8485 35.0 29.0 38.0 20.0 39.0 28 31.93725 35.0 30.0 38.0 20.0 39.0 29 31.70175 35.0 29.0 38.0 21.0 39.0 30 30.934 34.0 29.0 38.0 17.0 39.0 31 30.85275 35.0 29.0 38.0 15.0 39.0 32 29.867 33.0 27.0 37.0 14.0 39.0 33 29.52925 33.0 27.0 37.0 13.0 39.0 34 28.99325 33.0 26.0 36.0 11.0 39.0 35 29.21375 33.0 26.0 36.0 10.0 39.0 36 29.289 33.0 27.0 36.0 9.0 39.0 37 28.588 33.0 25.0 36.0 8.0 38.0 38 28.428 33.0 25.0 36.0 7.0 38.0 39 28.715 33.0 26.0 36.0 7.0 38.0 40 28.09975 32.0 24.0 36.0 2.0 38.0 41 28.537 33.0 25.0 36.0 2.0 39.0 42 28.33225 33.0 25.0 36.0 2.0 38.0 43 28.06375 32.0 24.0 36.0 2.0 38.0 44 28.15825 33.0 25.0 36.0 2.0 38.0 45 28.1305 33.0 25.0 36.0 2.0 38.0 46 27.84025 33.0 24.0 36.0 2.0 38.0 47 28.26225 33.0 26.0 36.0 2.0 38.0 48 27.89725 33.0 25.0 36.0 2.0 38.0 49 28.0015 33.0 25.0 36.0 2.0 38.0 50 27.5605 32.0 24.0 36.0 2.0 38.0 51 27.4855 33.0 23.0 36.0 2.0 38.0 52 27.24675 32.0 24.0 36.0 2.0 38.0 53 27.3405 33.0 24.0 36.0 2.0 38.0 54 26.67525 32.0 23.0 35.0 2.0 38.0 55 26.67775 32.0 23.0 35.0 2.0 38.0 56 25.241 31.0 18.0 35.0 2.0 37.0 57 25.49375 31.0 20.0 35.0 2.0 38.0 58 24.888 30.0 18.0 34.0 2.0 37.0 59 24.1025 30.0 16.0 34.0 2.0 36.0 60 24.0085 30.0 14.0 34.0 2.0 36.0 61 24.104 30.0 12.0 35.0 2.0 36.0 62 24.06925 30.0 10.0 34.0 2.0 37.0 63 23.55125 30.0 2.0 34.0 2.0 36.0 64 23.00275 29.0 2.0 33.0 2.0 36.0 65 22.7065 29.0 2.0 33.0 2.0 36.0 66 22.76425 30.0 2.0 34.0 2.0 36.0 67 22.53 30.0 2.0 34.0 2.0 36.0 68 21.8125 29.0 2.0 33.0 2.0 36.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 4.0 4 9.0 5 13.0 6 20.0 7 21.0 8 19.0 9 27.0 10 29.0 11 25.0 12 37.0 13 36.0 14 40.0 15 38.0 16 43.0 17 48.0 18 38.0 19 39.0 20 49.0 21 40.0 22 66.0 23 80.0 24 86.0 25 114.0 26 99.0 27 133.0 28 157.0 29 186.0 30 201.0 31 236.0 32 260.0 33 293.0 34 345.0 35 393.0 36 329.0 37 287.0 38 124.0 39 9.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.156147850138296 15.740507920543124 17.073170731707318 40.030173497611266 2 21.425 22.475 37.3 18.8 3 22.275 26.825 28.075 22.825 4 24.425 32.275 21.75 21.55 5 25.35 34.699999999999996 23.200000000000003 16.75 6 18.825 37.85 24.775 18.55 7 16.275000000000002 18.25 44.675 20.8 8 17.974999999999998 24.175 31.874999999999996 25.974999999999998 9 20.775 22.625 32.2 24.4 10 19.85 40.625 23.125 16.400000000000002 11 25.45 28.000000000000004 22.225 24.325 12 21.275 25.275 29.25 24.2 13 20.25 27.525 31.85 20.375 14 21.45 27.975 29.125 21.45 15 20.9 29.675 27.950000000000003 21.475 16 21.55 28.299999999999997 27.35 22.8 17 21.675 28.325 26.825 23.175 18 20.724999999999998 30.125 27.925 21.224999999999998 19 22.7 27.275 27.725 22.3 20 22.975 28.299999999999997 27.175 21.55 21 20.175 29.349999999999998 28.575 21.9 22 21.65 28.749999999999996 27.950000000000003 21.65 23 20.4 30.325000000000003 28.249999999999996 21.025 24 21.525 29.125 27.925 21.425 25 21.55 28.849999999999998 26.474999999999998 23.125 26 20.95 29.175 28.95 20.925 27 22.175 28.225 27.175 22.425 28 22.075 29.225 28.199999999999996 20.5 29 22.325 28.9 27.700000000000003 21.075 30 20.8 28.225 28.1 22.875 31 20.974999999999998 29.5 28.325 21.2 32 21.55 28.675 27.474999999999998 22.3 33 21.224999999999998 29.099999999999998 28.075 21.6 34 21.925 29.5 26.400000000000002 22.175 35 22.475 28.849999999999998 27.150000000000002 21.525 36 21.85 29.125 27.025 22.0 37 21.25 28.050000000000004 29.125 21.575 38 22.075 27.950000000000003 27.400000000000002 22.575 39 20.775 28.925 28.375 21.925 40 21.65 28.225 29.25 20.875 41 22.7 28.675 26.8 21.825 42 21.75 27.525 29.25 21.475 43 20.724999999999998 28.349999999999998 28.65 22.275 44 22.525000000000002 29.475 27.275 20.724999999999998 45 21.675 28.749999999999996 28.225 21.349999999999998 46 22.35 26.900000000000002 28.499999999999996 22.25 47 21.65 29.7 27.125 21.525 48 21.825 28.425 28.1 21.65 49 22.0 27.925 28.050000000000004 22.025 50 21.375 28.625 28.925 21.075 51 21.675 28.599999999999998 28.15 21.575 52 22.925 26.900000000000002 27.3 22.875 53 21.05 29.2 28.025 21.725 54 21.375 29.25 26.85 22.525000000000002 55 21.95 27.150000000000002 29.025000000000002 21.875 56 22.225 28.349999999999998 27.800000000000004 21.625 57 23.1 27.6 27.700000000000003 21.6 58 21.525 28.15 28.4 21.925 59 21.349999999999998 29.725 27.500000000000004 21.425 60 23.25 28.15 27.275 21.325 61 21.7 29.049999999999997 27.275 21.975 62 23.225 27.025 27.200000000000003 22.55 63 22.05 28.7 27.800000000000004 21.45 64 22.400000000000002 27.025 28.449999999999996 22.125 65 22.2 27.950000000000003 28.125 21.725 66 22.650000000000002 28.249999999999996 27.3 21.8 67 20.925 27.500000000000004 29.049999999999997 22.525000000000002 68 22.475 27.700000000000003 27.775 22.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 1.0 21 2.0 22 2.0 23 4.0 24 5.0 25 4.0 26 7.0 27 16.5 28 23.0 29 29.0 30 37.0 31 39.0 32 50.5 33 70.5 34 79.0 35 119.0 36 174.5 37 190.0 38 226.5 39 289.5 40 348.0 41 380.0 42 388.5 43 388.0 44 379.0 45 364.5 46 327.0 47 304.0 48 293.0 49 240.5 50 199.0 51 179.5 52 134.0 53 108.0 54 96.0 55 68.5 56 53.0 57 44.5 58 26.0 59 16.0 60 17.0 61 15.0 62 12.0 63 9.5 64 5.5 65 4.5 66 5.0 67 6.0 68 5.0 69 3.0 70 2.0 71 0.5 72 0.0 73 0.0 74 0.5 75 1.0 76 1.5 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 100.0 #Duplication Level Percentage of deduplicated Percentage of total 1 100.0 100.0 2 0.0 0.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCAGC 15 0.0033427728 62.0 34 >>END_MODULE Read 309318 spots for SRR952898.sra Written 309318 spots for SRR952898.sra Read 309318 spots for SRR952898.sra Written 309318 spots for SRR952898.sra Read 309318 spots for SRR952898.sra Written 309318 spots for SRR952898.sra Read 309318 spots for SRR952898.sra Written 309318 spots for SRR952898.sra Read 309318 spots for SRR952898.sra Written 309318 spots for SRR952898.sra Read 309318 spots for SRR952898.sra Written 309318 spots for SRR952898.sra Read 309318 spots for SRR952898.sra Written 309318 spots for SRR952898.sra Read 309318 spots for SRR952898.sra Written 309318 spots for SRR952898.sra Read 309318 spots for SRR952898.sra Written 309318 spots for SRR952898.sra Read 309318 spots for SRR952898.sra Written 309318 spots for SRR952898.sra Read 309318 spots for SRR952898.sra Written 309318 spots for SRR952898.sra Read 309318 spots for SRR952898.sra Written 309318 spots for SRR952898.sra Read 309318 spots for SRR952898.sra Written 309318 spots for SRR952898.sra Read 309318 spots for SRR952898.sra Written 309318 spots for SRR952898.sra Read 309318 spots for SRR952898.sra Written 309318 spots for SRR952898.sra Read 309318 spots for SRR952898.sra Written 309318 spots for SRR952898.sra Read 309318 spots for SRR952898.sra Written 309318 spots for SRR952898.sra Read 309318 spots for SRR952898.sra Written 309318 spots for SRR952898.sra Read 309318 spots for SRR952898.sra Written 309318 spots for SRR952898.sra Read 309332 spots for SRR952898.sra Written 309332 spots for SRR952898.sra SRR ids: ['SRR952898.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8q7zaqvo SRR952898.sra spots: 6186374 blocks: [[1, 309318], [309319, 618636], [618637, 927954], [927955, 1237272], [1237273, 1546590], [1546591, 1855908], [1855909, 2165226], [2165227, 2474544], [2474545, 2783862], [2783863, 3093180], [3093181, 3402498], [3402499, 3711816], [3711817, 4021134], [4021135, 4330452], [4330453, 4639770], [4639771, 4949088], [4949089, 5258406], [5258407, 5567724], [5567725, 5877042], [5877043, 6186374]] SRR952898 file size 1292897 SRR952898 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR952898 SRR952898_1.fastq Input file: SRR952898_1.fastq trimmed: SRR952898-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 11:24:13 2025 >> started Mon Feb 10 11:24:16 2025 >> done (2.834s) 6186374 reads processed; of these: 18012 ( 0.29%) short reads filtered out after trimming by size control 22028 ( 0.36%) empty reads filtered out after trimming by size control 6146334 (99.35%) reads available; of these: 651252 (10.60%) trimmed reads available after processing 5495082 (89.40%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1908 0.03% 19 3159 0.05% 20 5136 0.08% 21 1527 0.02% 22 2218 0.04% 23 3377 0.05% 24 5482 0.09% 25 9370 0.15% 26 2361 0.04% 27 3306 0.05% 28 4426 0.07% 29 6589 0.11% 30 10978 0.18% 31 2771 0.05% 32 3290 0.05% 33 4586 0.07% 34 6760 0.11% 35 10647 0.17% 36 2830 0.05% 37 3673 0.06% 38 4990 0.08% 39 7771 0.13% 40 11952 0.19% 41 2926 0.05% 42 4196 0.07% 43 6061 0.10% 44 9379 0.15% 45 15492 0.25% 46 3485 0.06% 47 5351 0.09% 48 7857 0.13% 49 13487 0.22% 50 23435 0.38% 51 5314 0.09% 52 8118 0.13% 53 13015 0.21% 54 21123 0.34% 55 37916 0.62% 56 7947 0.13% 57 11568 0.19% 58 18251 0.30% 59 31637 0.51% 60 59614 0.97% 61 11505 0.19% 62 16908 0.28% 63 26618 0.43% 64 47943 0.78% 65 81294 1.32% 66 15892 0.26% 67 25813 0.42% 68 5495082 89.40% 6146334 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=29 prefix-density=0.07 prefix-fanout=2.0 sequence=CAAGGTAAGAGTTCATGGCCAGAGCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=225.41 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=22.5 sequence=CTTCTTCTTCTC Started job on | Feb 10 11:24:33 Started mapping on | Feb 10 11:24:34 Finished on | Feb 10 11:24:40 Mapping speed, Million of reads per hour | 3687.80 Number of input reads | 6146334 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 5614351 Uniquely mapped reads % | 91.34% Average mapped length | 66.43 Number of splices: Total | 1146566 Number of splices: Annotated (sjdb) | 1127789 Number of splices: GT/AG | 1129592 Number of splices: GC/AG | 14667 Number of splices: AT/AC | 1018 Number of splices: Non-canonical | 1289 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.81 Insertion rate per base | 0.01% Insertion average length | 1.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 426247 % of reads mapped to multiple loci | 6.93% Number of reads mapped to too many loci | 43202 % of reads mapped to too many loci | 0.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.01% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 105736 105736 105736 N_multimapping 426247 426247 426247 N_noFeature 235114 2871549 2960248 N_ambiguous 32121 7393 7200 UnstrandedReadsAssigned:5347116 PositiveStrandReadsAssigned:2735409 NegativeStrandReadsAssigned:2646903 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR952898 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR952898-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,146,334 reads, 5,649,173 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,261 rounds 52401 SRR952898.ke.tsv 34699 SRR952898.se.tsv 87100 total ==> SRR952898.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1294 165.954 Potri.005G024800.1.v4.1 1035 936 513 134.887 Potri.004G059700.1.v4.1 961 862 1 0.28551 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 175.702 15.2046 Potri.016G087400.1.v4.1 270 171 162 233.157 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 187.524 27.5696 Potri.012G127500.1.v4.1 977 878 794 222.564 ==> SRR952898.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 92 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 7 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR952898 completed mapping pipeline successfully