Starting /dee2/code/volunteer_pipeline.sh SRR952899 current disk space = 3058889355264 free memory = 1525753872 SRR952899 SRAfilesize 5cbad1b409231901f82bc2079fa4eb0a SRR952899.sra SRR952899.sra file validated SRR952899 is single end SRR952899 is conventional basespace SRR952899 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR952899_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.83825 38.0 35.0 40.0 31.0 40.0 2 36.3455 38.0 35.0 40.0 30.0 40.0 3 36.411 38.0 35.0 40.0 30.0 40.0 4 36.183 38.0 35.0 39.0 30.0 40.0 5 36.402 38.0 35.0 40.0 30.0 40.0 6 36.493 38.0 35.0 40.0 30.0 40.0 7 36.458 38.0 35.0 40.0 30.0 40.0 8 36.44975 38.0 35.0 40.0 30.0 40.0 9 36.36575 38.0 35.0 40.0 30.0 40.0 10 36.2735 38.0 35.0 39.0 30.0 40.0 11 36.55275 38.0 35.0 40.0 31.0 40.0 12 36.373 38.0 35.0 40.0 30.0 40.0 13 36.1745 38.0 35.0 39.0 30.0 40.0 14 36.20175 38.0 35.0 39.0 29.0 40.0 15 36.105 38.0 35.0 39.0 30.0 40.0 16 36.06575 38.0 35.0 39.0 30.0 40.0 17 35.95125 38.0 35.0 39.0 29.0 40.0 18 36.0175 38.0 35.0 39.0 30.0 40.0 19 36.00025 38.0 35.0 39.0 29.0 40.0 20 35.86825 38.0 35.0 39.0 29.0 40.0 21 35.9605 38.0 35.0 39.0 29.0 40.0 22 35.9085 38.0 35.0 39.0 29.0 40.0 23 35.878 38.0 35.0 39.0 29.0 40.0 24 35.78975 38.0 35.0 39.0 29.0 40.0 25 35.709 38.0 35.0 39.0 29.0 40.0 26 35.73525 38.0 35.0 39.0 29.0 40.0 27 35.531 38.0 35.0 39.0 29.0 40.0 28 35.535 38.0 35.0 39.0 29.0 40.0 29 35.4165 38.0 35.0 39.0 28.0 40.0 30 35.31925 38.0 34.0 39.0 28.0 40.0 31 35.443 38.0 35.0 39.0 28.0 40.0 32 35.0875 38.0 33.0 39.0 28.0 40.0 33 34.981 38.0 33.0 39.0 27.0 40.0 34 34.96075 38.0 33.0 39.0 27.0 40.0 35 34.732 38.0 33.0 39.0 27.0 40.0 36 34.7605 38.0 33.0 39.0 27.0 40.0 37 34.69125 38.0 33.0 39.0 27.0 40.0 38 34.43025 38.0 33.0 39.0 26.0 40.0 39 34.52375 38.0 33.0 39.0 27.0 40.0 40 34.2435 37.0 33.0 39.0 26.0 40.0 41 34.376 38.0 33.0 39.0 26.0 40.0 42 34.17775 37.0 33.0 39.0 26.0 40.0 43 33.97675 37.0 33.0 39.0 25.0 40.0 44 33.7185 37.0 33.0 39.0 23.0 40.0 45 33.87075 37.0 33.0 39.0 25.0 40.0 46 33.80075 37.0 33.0 39.0 25.0 40.0 47 33.71425 37.0 33.0 39.0 25.0 40.0 48 33.399 36.0 32.0 39.0 24.0 40.0 49 33.385 36.0 32.0 39.0 23.0 40.0 50 33.14675 36.0 32.0 39.0 23.0 40.0 51 32.90275 36.0 32.0 39.0 22.0 40.0 52 32.65175 36.0 31.0 39.0 22.0 40.0 53 32.54975 36.0 31.0 39.0 22.0 40.0 54 32.28925 36.0 31.0 38.0 21.0 40.0 55 31.9705 35.0 31.0 38.0 18.0 40.0 56 31.9 36.0 31.0 38.0 17.0 40.0 57 31.788 35.0 30.0 38.0 18.0 40.0 58 31.47675 35.0 30.0 38.0 17.0 40.0 59 31.11475 35.0 30.0 38.0 14.0 39.0 60 31.0305 35.0 30.0 38.0 13.0 39.0 61 30.8595 35.0 30.0 38.0 2.0 39.0 62 30.462 35.0 29.0 38.0 2.0 39.0 63 30.46025 35.0 29.0 38.0 2.0 39.0 64 29.96325 34.0 29.0 38.0 2.0 39.0 65 29.6675 34.0 28.0 38.0 2.0 39.0 66 29.43125 35.0 28.0 38.0 2.0 39.0 67 29.0335 34.0 27.0 38.0 2.0 39.0 68 28.65625 33.0 27.0 37.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 1.0 4 3.0 5 3.0 6 4.0 7 6.0 8 5.0 9 7.0 10 7.0 11 7.0 12 12.0 13 8.0 14 10.0 15 17.0 16 21.0 17 14.0 18 17.0 19 24.0 20 26.0 21 25.0 22 28.0 23 28.0 24 34.0 25 49.0 26 46.0 27 81.0 28 66.0 29 102.0 30 109.0 31 142.0 32 168.0 33 177.0 34 263.0 35 386.0 36 413.0 37 585.0 38 645.0 39 453.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.224999999999998 18.099999999999998 15.024999999999999 41.65 2 21.40526976160602 26.097867001254706 33.82685069008783 18.670012547051442 3 23.525 29.525000000000002 25.3 21.65 4 24.15 34.225 20.65 20.974999999999998 5 25.8 36.175000000000004 21.3 16.725 6 18.025 40.65 23.225 18.099999999999998 7 17.45 17.875 43.675000000000004 21.0 8 19.825 23.025000000000002 30.175 26.974999999999998 9 21.075 22.775000000000002 31.324999999999996 24.825 10 18.8 39.45 24.675 17.075000000000003 11 24.325 28.825 21.6 25.25 12 21.05 25.724999999999998 28.275 24.95 13 19.725 27.825 32.2 20.25 14 22.225 27.375 29.799999999999997 20.599999999999998 15 21.425 27.125 29.175 22.275 16 21.349999999999998 28.199999999999996 28.675 21.775 17 22.375 27.825 27.500000000000004 22.3 18 22.525000000000002 27.825 27.825 21.825 19 21.025 28.875 28.249999999999996 21.85 20 22.925 28.675 27.6 20.8 21 21.075 28.475 27.6 22.85 22 20.9 29.325000000000003 28.575 21.2 23 21.925 29.425 27.05 21.6 24 21.575 28.575 27.500000000000004 22.35 25 21.7 28.499999999999996 28.925 20.875 26 22.2 27.175 28.15 22.475 27 21.3 30.075000000000003 27.200000000000003 21.425 28 21.125 28.025 28.775000000000002 22.075 29 22.125 27.700000000000003 27.3 22.875 30 21.15 28.999999999999996 28.15 21.7 31 20.625 28.799999999999997 28.499999999999996 22.075 32 21.975 28.7 27.625 21.7 33 22.025 28.349999999999998 27.575 22.05 34 20.974999999999998 29.325000000000003 26.924999999999997 22.775000000000002 35 22.5 27.950000000000003 27.474999999999998 22.075 36 22.425 28.575 26.450000000000003 22.55 37 21.75 29.2 27.725 21.325 38 22.125 29.125 27.025 21.725 39 20.9 29.425 28.025 21.65 40 22.45 27.750000000000004 28.675 21.125 41 20.375 28.825 28.499999999999996 22.3 42 21.475 28.000000000000004 27.675 22.85 43 22.5 27.925 28.125 21.45 44 22.025 28.849999999999998 27.700000000000003 21.425 45 21.8 27.35 28.95 21.9 46 21.575 26.950000000000003 29.075 22.400000000000002 47 22.55 27.375 28.599999999999998 21.475 48 21.224999999999998 27.700000000000003 28.95 22.125 49 22.7 27.35 27.775 22.175 50 20.875 29.299999999999997 27.150000000000002 22.675 51 22.0 27.474999999999998 28.549999999999997 21.975 52 21.925 28.125 27.575 22.375 53 22.725 27.6 27.975 21.7 54 22.175 27.825 27.650000000000002 22.35 55 21.375 28.15 29.225 21.25 56 22.0 28.725 27.85 21.425 57 22.825 29.45 28.000000000000004 19.725 58 23.125 28.425 27.55 20.9 59 22.85 28.7 26.825 21.625 60 20.849999999999998 29.675 28.825 20.65 61 22.05 27.1 28.799999999999997 22.05 62 22.05 28.15 28.65 21.15 63 22.35 28.375 28.449999999999996 20.825 64 23.45 27.3 27.3 21.95 65 23.125 28.9 27.125 20.849999999999998 66 21.475 30.45 26.825 21.25 67 21.275 28.849999999999998 28.425 21.45 68 22.875 27.575 27.625 21.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 2.5 22 2.0 23 4.0 24 5.0 25 4.0 26 9.5 27 14.5 28 14.0 29 23.0 30 36.0 31 40.0 32 47.5 33 79.5 34 104.0 35 124.0 36 169.0 37 194.0 38 239.5 39 302.0 40 331.5 41 344.0 42 366.0 43 369.0 44 350.0 45 353.5 46 335.0 47 313.0 48 276.5 49 229.5 50 219.0 51 206.5 52 160.0 53 126.0 54 108.5 55 72.0 56 53.0 57 40.5 58 28.0 59 28.0 60 22.0 61 13.0 62 10.0 63 8.5 64 6.0 65 4.5 66 4.0 67 4.0 68 3.5 69 3.0 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.075 0.0 0.0 0.0 0.0 30 0.075 0.0 0.0 0.0 0.0 31 0.075 0.0 0.0 0.0 0.0 32 0.075 0.0 0.0 0.0 0.0 33 0.075 0.0 0.0 0.0 0.0 34 0.075 0.0 0.0 0.0 0.0 35 0.075 0.0 0.0 0.0 0.0 36 0.075 0.0 0.0 0.0 0.0 37 0.075 0.0 0.0 0.0 0.0 38 0.075 0.0 0.0 0.0 0.0 39 0.075 0.0 0.0 0.0 0.0 40 0.075 0.0 0.0 0.0 0.0 41 0.075 0.0 0.0 0.0 0.0 42 0.075 0.0 0.0 0.0 0.0 43 0.075 0.0 0.0 0.0 0.0 44 0.075 0.0 0.0 0.0 0.0 45 0.075 0.0 0.0 0.0 0.0 46 0.075 0.0 0.0 0.0 0.0 47 0.075 0.0 0.0 0.0 0.0 48 0.075 0.0 0.0 0.0 0.0 49 0.075 0.0 0.0 0.0 0.0 50 0.075 0.0 0.0 0.0 0.0 51 0.075 0.0 0.0 0.0 0.0 52 0.075 0.0 0.0 0.0 0.0 53 0.075 0.0 0.0 0.0 0.0 54 0.075 0.0 0.0 0.0 0.0 55 0.075 0.0 0.0 0.0 0.0 56 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 190957 spots for SRR952899.sra Written 190957 spots for SRR952899.sra Read 190957 spots for SRR952899.sra Written 190957 spots for SRR952899.sra Read 190957 spots for SRR952899.sra Written 190957 spots for SRR952899.sra Read 190957 spots for SRR952899.sra Written 190957 spots for SRR952899.sra Read 190957 spots for SRR952899.sra Written 190957 spots for SRR952899.sra Read 190957 spots for SRR952899.sra Written 190957 spots for SRR952899.sra Read 190957 spots for SRR952899.sra Written 190957 spots for SRR952899.sra Read 190957 spots for SRR952899.sra Written 190957 spots for SRR952899.sra Read 190957 spots for SRR952899.sra Written 190957 spots for SRR952899.sra Read 190957 spots for SRR952899.sra Written 190957 spots for SRR952899.sra Read 190957 spots for SRR952899.sra Written 190957 spots for SRR952899.sra Read 190957 spots for SRR952899.sra Written 190957 spots for SRR952899.sra Read 190957 spots for SRR952899.sra Written 190957 spots for SRR952899.sra Read 190957 spots for SRR952899.sra Written 190957 spots for SRR952899.sra Read 190957 spots for SRR952899.sra Written 190957 spots for SRR952899.sra Read 190957 spots for SRR952899.sra Written 190957 spots for SRR952899.sra Read 190968 spots for SRR952899.sra Written 190968 spots for SRR952899.sra Read 190957 spots for SRR952899.sra Written 190957 spots for SRR952899.sra Read 190957 spots for SRR952899.sra Written 190957 spots for SRR952899.sra Read 190957 spots for SRR952899.sra Written 190957 spots for SRR952899.sra SRR ids: ['SRR952899.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s5eqb17e SRR952899.sra spots: 3819151 blocks: [[1, 190957], [190958, 381914], [381915, 572871], [572872, 763828], [763829, 954785], [954786, 1145742], [1145743, 1336699], [1336700, 1527656], [1527657, 1718613], [1718614, 1909570], [1909571, 2100527], [2100528, 2291484], [2291485, 2482441], [2482442, 2673398], [2673399, 2864355], [2864356, 3055312], [3055313, 3246269], [3246270, 3437226], [3437227, 3628183], [3628184, 3819151]] SRR952899 file size 797770 SRR952899 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR952899 SRR952899_1.fastq Input file: SRR952899_1.fastq trimmed: SRR952899-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 11:08:38 2025 >> started Mon Feb 10 11:08:40 2025 >> done (1.967s) 3819151 reads processed; of these: 23605 ( 0.62%) short reads filtered out after trimming by size control 19982 ( 0.52%) empty reads filtered out after trimming by size control 3775564 (98.86%) reads available; of these: 507636 (13.45%) trimmed reads available after processing 3267928 (86.55%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1435 0.04% 19 2235 0.06% 20 3613 0.10% 21 1127 0.03% 22 1676 0.04% 23 2566 0.07% 24 3875 0.10% 25 6814 0.18% 26 1693 0.04% 27 2193 0.06% 28 3184 0.08% 29 4822 0.13% 30 7194 0.19% 31 1969 0.05% 32 2487 0.07% 33 3711 0.10% 34 5651 0.15% 35 9071 0.24% 36 2240 0.06% 37 3248 0.09% 38 4574 0.12% 39 7293 0.19% 40 11532 0.31% 41 2716 0.07% 42 3887 0.10% 43 5770 0.15% 44 9645 0.26% 45 15556 0.41% 46 3807 0.10% 47 5021 0.13% 48 7626 0.20% 49 12822 0.34% 50 21038 0.56% 51 4767 0.13% 52 6563 0.17% 53 10057 0.27% 54 17556 0.46% 55 30790 0.82% 56 6112 0.16% 57 8717 0.23% 58 13350 0.35% 59 24443 0.65% 60 44094 1.17% 61 8467 0.22% 62 11672 0.31% 63 19065 0.50% 64 33613 0.89% 65 55837 1.48% 66 11602 0.31% 67 18840 0.50% 68 3267928 86.55% 3775564 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=37.19 fanout-score-rank=9 prefix-density=0.13 prefix-fanout=11.8 sequence=CAGCAGCAGCAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=14 fanout-score=295.74 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=24.3 sequence=AAGAAGAAGAAG Started job on | Feb 10 11:08:56 Started mapping on | Feb 10 11:08:57 Finished on | Feb 10 11:09:02 Mapping speed, Million of reads per hour | 2718.41 Number of input reads | 3775564 Average input read length | 65 UNIQUE READS: Uniquely mapped reads number | 3500058 Uniquely mapped reads % | 92.70% Average mapped length | 65.96 Number of splices: Total | 730860 Number of splices: Annotated (sjdb) | 718561 Number of splices: GT/AG | 719771 Number of splices: GC/AG | 9645 Number of splices: AT/AC | 606 Number of splices: Non-canonical | 838 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.81 Insertion rate per base | 0.01% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 215531 % of reads mapped to multiple loci | 5.71% Number of reads mapped to too many loci | 33674 % of reads mapped to too many loci | 0.89% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.68% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 59975 59975 59975 N_multimapping 215531 215531 215531 N_noFeature 163902 1799896 1853344 N_ambiguous 19765 4615 4512 UnstrandedReadsAssigned:3316391 PositiveStrandReadsAssigned:1695547 NegativeStrandReadsAssigned:1642202 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR952899 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR952899-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,775,564 reads, 3,461,259 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,002 rounds 52401 SRR952899.ke.tsv 34699 SRR952899.se.tsv 87100 total ==> SRR952899.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 703 147.705 Potri.005G024800.1.v4.1 1035 936 377 162.398 Potri.004G059700.1.v4.1 961 862 2 0.935486 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 119.602 16.956 Potri.016G087400.1.v4.1 270 171 75 176.84 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 121.314 29.2193 Potri.012G127500.1.v4.1 977 878 1358 623.62 ==> SRR952899.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 9 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 38 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 11 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR952899 completed mapping pipeline successfully