Starting /dee2/code/volunteer_pipeline.sh SRR952900 current disk space = 3058881835008 free memory = 1113545756 SRR952900 SRAfilesize 389edf052f91ee0ee48b11bbc8647acd SRR952900.sra SRR952900.sra file validated SRR952900 is single end SRR952900 is conventional basespace SRR952900 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR952900_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.582 36.0 33.0 38.0 28.0 39.0 2 34.09275 36.0 33.0 38.0 25.0 39.0 3 33.8085 36.0 31.0 38.0 25.0 39.0 4 33.98575 36.0 32.0 38.0 25.0 39.0 5 34.127 36.0 33.0 38.0 26.0 39.0 6 34.6615 37.0 33.0 39.0 27.0 39.0 7 34.8385 38.0 33.0 39.0 28.0 40.0 8 34.49225 37.0 33.0 38.0 27.0 40.0 9 34.492 36.0 33.0 38.0 27.0 39.0 10 34.40425 36.0 33.0 38.0 26.0 40.0 11 34.45975 36.0 33.0 39.0 26.0 39.0 12 34.254 36.0 33.0 38.0 26.0 39.0 13 34.073 36.0 32.0 38.0 26.0 39.0 14 34.26225 36.0 33.0 38.0 26.0 39.0 15 34.19725 36.0 33.0 38.0 26.0 39.0 16 34.1895 36.0 33.0 38.0 26.0 39.0 17 33.92875 36.0 32.0 38.0 26.0 39.0 18 34.04025 36.0 32.0 38.0 26.0 39.0 19 33.61925 36.0 31.0 38.0 25.0 39.0 20 33.7925 36.0 31.0 38.0 25.0 39.0 21 33.99425 36.0 33.0 38.0 26.0 39.0 22 33.55625 36.0 31.0 38.0 24.0 39.0 23 33.635 36.0 32.0 38.0 25.0 39.0 24 33.582 36.0 31.0 38.0 25.0 39.0 25 33.448 36.0 31.0 38.0 25.0 39.0 26 33.55525 36.0 32.0 38.0 25.0 39.0 27 33.03925 36.0 31.0 38.0 23.0 39.0 28 33.0475 36.0 31.0 38.0 23.0 39.0 29 32.947 36.0 31.0 38.0 23.0 39.0 30 32.76725 35.0 31.0 38.0 23.0 39.0 31 32.5895 36.0 31.0 38.0 21.0 39.0 32 32.04475 35.0 30.0 38.0 20.0 39.0 33 31.91925 35.0 30.0 38.0 20.0 39.0 34 31.6395 35.0 29.0 38.0 19.0 39.0 35 31.462 35.0 29.0 38.0 18.0 39.0 36 31.727 35.0 30.0 38.0 18.0 39.0 37 31.816 35.0 30.0 38.0 19.0 39.0 38 30.77475 35.0 28.0 38.0 17.0 39.0 39 30.33775 34.0 27.0 38.0 15.0 39.0 40 30.63825 34.0 28.0 38.0 16.0 39.0 41 30.5795 35.0 28.0 38.0 14.0 39.0 42 30.3905 35.0 28.0 38.0 15.0 39.0 43 30.046 34.0 27.0 38.0 12.0 39.0 44 30.16425 34.0 27.0 38.0 13.0 39.0 45 29.96425 34.0 27.0 38.0 12.0 39.0 46 29.89075 34.0 28.0 38.0 8.0 39.0 47 29.7315 34.0 27.0 38.0 9.0 39.0 48 29.70125 33.0 27.0 38.0 9.0 39.0 49 29.416 33.0 27.0 37.0 6.0 39.0 50 29.27175 33.0 27.0 37.0 2.0 39.0 51 29.23475 34.0 27.0 38.0 2.0 39.0 52 28.7345 33.0 26.0 37.0 2.0 38.0 53 28.9235 33.0 27.0 37.0 2.0 38.0 54 27.97275 33.0 24.0 36.0 2.0 38.0 55 27.64675 33.0 23.0 36.0 2.0 38.0 56 27.564 33.0 23.0 36.0 2.0 38.0 57 27.216 32.0 23.0 36.0 2.0 38.0 58 26.88975 32.0 23.0 36.0 2.0 38.0 59 26.7365 32.0 23.0 36.0 2.0 38.0 60 26.227 32.0 21.0 36.0 2.0 38.0 61 25.6545 32.0 18.0 36.0 2.0 38.0 62 25.307 31.0 18.0 35.0 2.0 38.0 63 25.20825 31.0 17.0 35.0 2.0 38.0 64 24.1595 30.0 12.0 35.0 2.0 38.0 65 23.89825 30.0 2.0 35.0 2.0 38.0 66 23.76925 30.0 2.0 35.0 2.0 38.0 67 23.39975 30.0 2.0 35.0 2.0 38.0 68 23.28025 30.0 2.0 35.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 1.0 4 2.0 5 5.0 6 7.0 7 11.0 8 15.0 9 9.0 10 23.0 11 18.0 12 18.0 13 35.0 14 35.0 15 19.0 16 33.0 17 40.0 18 40.0 19 37.0 20 36.0 21 63.0 22 47.0 23 67.0 24 87.0 25 90.0 26 107.0 27 121.0 28 143.0 29 175.0 30 195.0 31 210.0 32 235.0 33 297.0 34 349.0 35 400.0 36 394.0 37 329.0 38 251.0 39 35.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.01350675337669 19.43471735867934 16.18309154577289 37.368684342171086 2 22.839969947407965 25.219133483596295 34.109691960931634 17.831204608064112 3 23.599999999999998 28.4 25.6 22.400000000000002 4 22.75 34.375 21.4 21.475 5 26.75 36.925000000000004 20.349999999999998 15.975 6 17.75 38.875 24.0 19.375 7 15.299999999999999 18.175 46.7 19.825 8 19.025 22.5 31.3 27.175 9 19.975 22.95 31.025000000000002 26.05 10 18.975 39.324999999999996 25.0 16.7 11 26.0 29.849999999999998 20.9 23.25 12 20.674999999999997 25.275 28.725 25.324999999999996 13 19.3 29.25 30.65 20.8 14 21.45 28.599999999999998 28.599999999999998 21.349999999999998 15 21.675 27.675 28.625 22.025 16 20.0 29.525000000000002 27.975 22.5 17 22.075 29.599999999999998 27.325 21.0 18 21.8 28.95 28.050000000000004 21.2 19 22.325 27.525 27.950000000000003 22.2 20 21.075 29.525000000000002 27.175 22.225 21 21.575 28.599999999999998 28.4 21.425 22 21.475 29.525000000000002 26.924999999999997 22.075 23 22.225 30.55 27.150000000000002 20.075000000000003 24 20.825 30.049999999999997 27.975 21.15 25 23.400000000000002 27.950000000000003 26.900000000000002 21.75 26 22.7 29.825000000000003 26.400000000000002 21.075 27 21.85 29.225 27.325 21.6 28 21.349999999999998 29.625 26.325 22.7 29 22.275 28.849999999999998 27.875 21.0 30 20.65 27.925 27.825 23.599999999999998 31 19.875 27.425 29.7 23.0 32 20.875 29.175 28.575 21.375 33 23.0 27.525 27.700000000000003 21.775 34 22.225 29.849999999999998 27.150000000000002 20.775 35 23.0 28.349999999999998 27.35 21.3 36 22.25 28.849999999999998 27.224999999999998 21.675 37 21.25 28.525 28.775000000000002 21.45 38 22.1 28.775000000000002 27.950000000000003 21.175 39 21.925 28.299999999999997 27.85 21.925 40 22.2 28.375 27.875 21.55 41 21.425 29.075 27.400000000000002 22.1 42 22.825 28.025 27.775 21.375 43 20.625 29.625 28.499999999999996 21.25 44 22.05 27.85 27.400000000000002 22.7 45 20.974999999999998 28.425 28.825 21.775 46 22.650000000000002 26.450000000000003 29.725 21.175 47 23.9 25.650000000000002 28.125 22.325 48 21.25 28.325 28.625 21.8 49 21.3 27.075 28.999999999999996 22.625 50 21.6 29.25 28.15 21.0 51 22.175 27.875 28.499999999999996 21.45 52 21.8 28.375 27.575 22.25 53 21.2 29.2 28.9 20.7 54 23.025000000000002 27.275 27.625 22.075 55 21.75 29.4 27.025 21.825 56 22.1 27.900000000000002 28.675 21.325 57 23.25 28.999999999999996 26.5 21.25 58 21.925 27.625 27.675 22.775000000000002 59 22.825 28.449999999999996 28.125 20.599999999999998 60 21.5 28.925 27.800000000000004 21.775 61 21.825 28.65 27.950000000000003 21.575 62 21.175 29.975 27.35 21.5 63 21.15 28.975 27.700000000000003 22.175 64 22.400000000000002 29.299999999999997 27.075 21.224999999999998 65 23.45 27.950000000000003 28.349999999999998 20.25 66 22.45 28.025 27.6 21.925 67 21.0 29.5 27.85 21.65 68 22.5 28.599999999999998 26.950000000000003 21.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 2.5 21 2.5 22 2.0 23 5.0 24 8.0 25 8.0 26 9.5 27 16.5 28 22.0 29 23.5 30 31.5 31 38.0 32 58.0 33 96.0 34 114.0 35 121.5 36 174.0 37 219.0 38 221.0 39 277.0 40 346.0 41 361.0 42 384.0 43 405.0 44 403.0 45 360.0 46 306.0 47 295.0 48 286.0 49 238.0 50 199.0 51 177.5 52 139.0 53 122.0 54 106.5 55 66.5 56 42.0 57 41.0 58 31.0 59 22.0 60 18.5 61 16.0 62 17.0 63 11.0 64 6.5 65 4.5 66 1.0 67 1.0 68 1.5 69 2.0 70 2.0 71 1.5 72 1.0 73 0.5 74 1.0 75 2.0 76 1.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94997498749375 99.9 2 0.05002501250625312 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.075 0.0 0.0 0.0 0.0 15 0.075 0.0 0.0 0.0 0.0 16 0.075 0.0 0.0 0.0 0.0 17 0.075 0.0 0.0 0.0 0.0 18 0.075 0.0 0.0 0.0 0.0 19 0.075 0.0 0.0 0.0 0.0 20 0.075 0.0 0.0 0.0 0.0 21 0.075 0.0 0.0 0.0 0.0 22 0.075 0.0 0.0 0.0 0.0 23 0.075 0.0 0.0 0.0 0.0 24 0.075 0.0 0.0 0.0 0.0 25 0.075 0.0 0.0 0.0 0.0 26 0.075 0.0 0.0 0.0 0.0 27 0.075 0.0 0.0 0.0 0.0 28 0.075 0.0 0.0 0.0 0.0 29 0.075 0.0 0.0 0.0 0.0 30 0.075 0.0 0.0 0.0 0.0 31 0.075 0.0 0.0 0.0 0.0 32 0.075 0.0 0.0 0.0 0.0 33 0.075 0.0 0.0 0.0 0.0 34 0.075 0.0 0.0 0.0 0.0 35 0.075 0.0 0.0 0.0 0.0 36 0.075 0.0 0.0 0.0 0.0 37 0.075 0.0 0.0 0.0 0.0 38 0.075 0.0 0.0 0.0 0.0 39 0.075 0.0 0.0 0.0 0.0 40 0.075 0.0 0.0 0.0 0.0 41 0.075 0.0 0.0 0.0 0.0 42 0.075 0.0 0.0 0.0 0.0 43 0.075 0.0 0.0 0.0 0.0 44 0.075 0.0 0.0 0.0 0.0 45 0.075 0.0 0.0 0.0 0.0 46 0.075 0.0 0.0 0.0 0.0 47 0.075 0.0 0.0 0.0 0.0 48 0.075 0.0 0.0 0.0 0.0 49 0.075 0.0 0.0 0.0 0.0 50 0.075 0.0 0.0 0.0 0.0 51 0.075 0.0 0.0 0.0 0.0 52 0.075 0.0 0.0 0.0 0.0 53 0.075 0.0 0.0 0.0 0.0 54 0.075 0.0 0.0 0.0 0.0 55 0.075 0.0 0.0 0.0 0.0 56 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 256556 spots for SRR952900.sra Written 256556 spots for SRR952900.sra Read 256556 spots for SRR952900.sra Written 256556 spots for SRR952900.sra Read 256556 spots for SRR952900.sra Written 256556 spots for SRR952900.sra Read 256556 spots for SRR952900.sra Written 256556 spots for SRR952900.sra Read 256556 spots for SRR952900.sra Written 256556 spots for SRR952900.sra Read 256556 spots for SRR952900.sra Written 256556 spots for SRR952900.sra Read 256556 spots for SRR952900.sra Written 256556 spots for SRR952900.sra Read 256556 spots for SRR952900.sra Written 256556 spots for SRR952900.sra Read 256556 spots for SRR952900.sra Written 256556 spots for SRR952900.sra Read 256556 spots for SRR952900.sra Written 256556 spots for SRR952900.sra Read 256556 spots for SRR952900.sra Written 256556 spots for SRR952900.sra Read 256556 spots for SRR952900.sra Written 256556 spots for SRR952900.sra Read 256556 spots for SRR952900.sra Written 256556 spots for SRR952900.sra Read 256556 spots for SRR952900.sra Written 256556 spots for SRR952900.sra Read 256556 spots for SRR952900.sra Written 256556 spots for SRR952900.sra Read 256556 spots for SRR952900.sra Written 256556 spots for SRR952900.sra Read 256556 spots for SRR952900.sra Written 256556 spots for SRR952900.sra Read 256556 spots for SRR952900.sra Written 256556 spots for SRR952900.sra Read 256568 spots for SRR952900.sra Written 256568 spots for SRR952900.sra Read 256556 spots for SRR952900.sra Written 256556 spots for SRR952900.sra SRR ids: ['SRR952900.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xz8enuhm SRR952900.sra spots: 5131132 blocks: [[1, 256556], [256557, 513112], [513113, 769668], [769669, 1026224], [1026225, 1282780], [1282781, 1539336], [1539337, 1795892], [1795893, 2052448], [2052449, 2309004], [2309005, 2565560], [2565561, 2822116], [2822117, 3078672], [3078673, 3335228], [3335229, 3591784], [3591785, 3848340], [3848341, 4104896], [4104897, 4361452], [4361453, 4618008], [4618009, 4874564], [4874565, 5131132]] SRR952900 file size 1072158 SRR952900 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR952900 SRR952900_1.fastq Input file: SRR952900_1.fastq trimmed: SRR952900-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 11:24:37 2025 >> started Mon Feb 10 11:24:39 2025 >> done (2.378s) 5131132 reads processed; of these: 23113 ( 0.45%) short reads filtered out after trimming by size control 12971 ( 0.25%) empty reads filtered out after trimming by size control 5095048 (99.30%) reads available; of these: 783412 (15.38%) trimmed reads available after processing 4311636 (84.62%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2608 0.05% 19 4063 0.08% 20 6130 0.12% 21 1882 0.04% 22 2826 0.06% 23 4264 0.08% 24 7206 0.14% 25 11485 0.23% 26 2940 0.06% 27 4170 0.08% 28 5703 0.11% 29 8697 0.17% 30 13727 0.27% 31 3687 0.07% 32 4580 0.09% 33 6576 0.13% 34 9604 0.19% 35 14229 0.28% 36 3714 0.07% 37 4797 0.09% 38 6511 0.13% 39 10017 0.20% 40 14592 0.29% 41 3614 0.07% 42 5204 0.10% 43 7970 0.16% 44 12482 0.24% 45 19152 0.38% 46 4735 0.09% 47 7052 0.14% 48 11050 0.22% 49 18572 0.36% 50 32005 0.63% 51 7206 0.14% 52 10751 0.21% 53 17041 0.33% 54 28200 0.55% 55 47027 0.92% 56 9995 0.20% 57 14228 0.28% 58 22288 0.44% 59 37800 0.74% 60 64052 1.26% 61 13637 0.27% 62 19630 0.39% 63 31577 0.62% 64 53229 1.04% 65 84558 1.66% 66 18799 0.37% 67 27550 0.54% 68 4311636 84.62% 5095048 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=38.63 fanout-score-rank=17 prefix-density=0.13 prefix-fanout=11.9 sequence=CAGCAGCAGCAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=18 fanout-score=341.65 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=23.4 sequence=AAGAAGAAGAGA Started job on | Feb 10 11:24:51 Started mapping on | Feb 10 11:24:52 Finished on | Feb 10 11:24:58 Mapping speed, Million of reads per hour | 3057.03 Number of input reads | 5095048 Average input read length | 65 UNIQUE READS: Uniquely mapped reads number | 4743568 Uniquely mapped reads % | 93.10% Average mapped length | 65.67 Number of splices: Total | 1012597 Number of splices: Annotated (sjdb) | 996103 Number of splices: GT/AG | 997021 Number of splices: GC/AG | 13643 Number of splices: AT/AC | 797 Number of splices: Non-canonical | 1136 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.73 Insertion rate per base | 0.01% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 282037 % of reads mapped to multiple loci | 5.54% Number of reads mapped to too many loci | 36847 % of reads mapped to too many loci | 0.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.63% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 69443 69443 69443 N_multimapping 282037 282037 282037 N_noFeature 186552 2386572 2528297 N_ambiguous 27094 6116 5825 UnstrandedReadsAssigned:4529922 PositiveStrandReadsAssigned:2350880 NegativeStrandReadsAssigned:2209446 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=65 echo kmer=61 SRR952900 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR952900-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,095,048 reads, 4,680,785 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52401 SRR952900.ke.tsv 34699 SRR952900.se.tsv 87100 total ==> SRR952900.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 832 128.73 Potri.005G024800.1.v4.1 1035 936 376 119.274 Potri.004G059700.1.v4.1 961 862 1 0.344449 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 185.873 19.4052 Potri.016G087400.1.v4.1 270 171 159 276.079 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 226.041 40.0926 Potri.012G127500.1.v4.1 977 878 1850 625.619 ==> SRR952900.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 66 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 9 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 1 SRR952900 completed mapping pipeline successfully