Starting /dee2/code/volunteer_pipeline.sh SRR952901 current disk space = 3058875367424 free memory = 1344256668 SRR952901 SRAfilesize f497e27d58dad3421e30744046f393f5 SRR952901.sra SRR952901.sra file validated SRR952901 is single end SRR952901 is conventional basespace SRR952901 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR952901_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.55875 38.0 35.0 39.0 31.0 40.0 2 36.15625 38.0 35.0 39.0 30.0 40.0 3 35.951 38.0 35.0 39.0 30.0 40.0 4 35.94975 38.0 35.0 39.0 29.0 40.0 5 35.8915 38.0 35.0 39.0 29.0 40.0 6 36.159 38.0 35.0 39.0 30.0 40.0 7 36.0565 38.0 35.0 39.0 30.0 40.0 8 35.76725 38.0 35.0 39.0 29.0 40.0 9 35.69025 38.0 35.0 39.0 29.0 40.0 10 35.8025 38.0 35.0 39.0 29.0 40.0 11 35.859 38.0 35.0 39.0 29.0 40.0 12 35.39825 38.0 33.0 39.0 28.0 40.0 13 35.7555 38.0 34.0 39.0 29.0 40.0 14 35.6945 38.0 34.0 39.0 29.0 40.0 15 35.2555 38.0 33.0 39.0 28.0 40.0 16 35.711 38.0 35.0 39.0 29.0 40.0 17 35.67625 38.0 35.0 39.0 29.0 40.0 18 35.065 38.0 33.0 39.0 27.0 40.0 19 35.271 38.0 33.0 39.0 28.0 40.0 20 35.26275 38.0 33.0 39.0 28.0 40.0 21 35.385 38.0 34.0 39.0 28.0 40.0 22 35.37 38.0 34.0 39.0 28.0 40.0 23 35.011 38.0 33.0 39.0 27.0 40.0 24 35.49375 38.0 34.0 39.0 29.0 40.0 25 35.11775 38.0 33.0 39.0 28.0 40.0 26 35.107 38.0 34.0 39.0 28.0 40.0 27 35.071 38.0 34.0 39.0 28.0 40.0 28 34.67675 38.0 33.0 39.0 27.0 40.0 29 34.6065 38.0 33.0 39.0 27.0 40.0 30 34.19725 37.0 33.0 39.0 26.0 40.0 31 34.32625 37.0 33.0 39.0 26.0 40.0 32 33.947 37.0 33.0 39.0 25.0 40.0 33 33.2975 36.0 31.0 39.0 23.0 40.0 34 33.74925 36.0 32.0 39.0 25.0 40.0 35 33.6025 36.0 32.0 39.0 24.0 40.0 36 33.62325 37.0 33.0 39.0 24.0 40.0 37 33.186 36.0 31.0 39.0 23.0 40.0 38 33.15375 36.0 32.0 38.0 23.0 40.0 39 32.9765 36.0 31.0 38.0 23.0 40.0 40 32.769 36.0 31.0 38.0 23.0 40.0 41 32.91825 36.0 32.0 38.0 23.0 40.0 42 32.74975 36.0 31.0 38.0 22.0 40.0 43 32.52175 36.0 31.0 38.0 22.0 40.0 44 32.08775 35.0 30.0 38.0 20.0 39.0 45 32.1555 35.0 30.0 38.0 20.0 39.0 46 32.37425 36.0 31.0 38.0 21.0 39.0 47 32.084 35.0 31.0 38.0 20.0 39.0 48 31.99225 35.0 30.0 38.0 19.0 39.0 49 31.75825 35.0 30.0 38.0 19.0 39.0 50 31.4135 35.0 30.0 38.0 18.0 39.0 51 31.28525 35.0 30.0 38.0 15.0 39.0 52 30.8655 35.0 29.0 38.0 15.0 39.0 53 30.61025 35.0 29.0 38.0 11.0 39.0 54 30.30025 34.0 29.0 38.0 9.0 39.0 55 29.78275 33.0 28.0 37.0 2.0 39.0 56 29.34525 34.0 28.0 37.0 2.0 39.0 57 28.63125 33.0 26.0 36.0 2.0 39.0 58 28.9605 33.0 27.0 37.0 2.0 39.0 59 28.40675 33.0 27.0 36.0 2.0 38.0 60 27.594 33.0 24.0 36.0 2.0 38.0 61 27.77525 33.0 25.0 36.0 2.0 39.0 62 27.15075 33.0 23.0 36.0 2.0 38.0 63 26.9945 32.0 23.0 36.0 2.0 38.0 64 26.8355 32.0 23.0 36.0 2.0 38.0 65 26.556 32.0 23.0 36.0 2.0 38.0 66 26.29675 32.0 22.0 36.0 2.0 38.0 67 26.10225 32.0 21.0 36.0 2.0 38.0 68 25.8455 32.0 22.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 0.0 4 3.0 5 3.0 6 2.0 7 6.0 8 6.0 9 10.0 10 15.0 11 23.0 12 14.0 13 11.0 14 17.0 15 17.0 16 19.0 17 23.0 18 21.0 19 33.0 20 35.0 21 34.0 22 44.0 23 50.0 24 59.0 25 74.0 26 85.0 27 97.0 28 102.0 29 116.0 30 128.0 31 162.0 32 193.0 33 256.0 34 328.0 35 385.0 36 466.0 37 541.0 38 466.0 39 145.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.44544997486174 16.013071895424837 15.912518853695323 41.6289592760181 2 21.15 24.575 34.4 19.875 3 21.625 27.775 27.6 23.0 4 24.25 32.225 21.95 21.575 5 25.525 34.875 22.575 17.025000000000002 6 18.975 38.324999999999996 22.625 20.075000000000003 7 14.924999999999999 19.15 46.875 19.05 8 18.975 22.5 30.625000000000004 27.900000000000002 9 20.474999999999998 23.125 31.2 25.2 10 19.75 39.525 23.95 16.775000000000002 11 25.650000000000002 28.4 22.025 23.925 12 22.2 24.075 28.799999999999997 24.925 13 19.55 29.525000000000002 29.9 21.025 14 20.849999999999998 28.15 29.349999999999998 21.65 15 20.674999999999997 28.875 27.650000000000002 22.8 16 21.25 28.349999999999998 28.050000000000004 22.35 17 21.625 28.749999999999996 28.475 21.15 18 20.925 28.15 28.625 22.3 19 21.025 28.9 28.15 21.925 20 20.775 28.599999999999998 28.799999999999997 21.825 21 21.325 27.450000000000003 29.2 22.025 22 22.400000000000002 28.9 26.650000000000002 22.05 23 22.0 28.9 27.375 21.725 24 21.349999999999998 28.125 28.225 22.3 25 20.95 29.475 27.425 22.15 26 21.625 27.55 28.675 22.15 27 20.65 28.499999999999996 27.675 23.175 28 21.6 28.275 28.275 21.85 29 22.825 27.925 26.825 22.425 30 20.1 28.975 28.225 22.7 31 21.85 28.749999999999996 27.650000000000002 21.75 32 22.325 28.225 26.775 22.675 33 21.375 28.475 27.575 22.575 34 21.425 28.1 28.9 21.575 35 20.775 29.175 27.375 22.675 36 21.325 28.299999999999997 28.65 21.725 37 22.075 27.474999999999998 29.099999999999998 21.349999999999998 38 22.25 28.249999999999996 27.150000000000002 22.35 39 21.675 27.375 28.625 22.325 40 22.125 28.675 27.750000000000004 21.45 41 21.525 28.199999999999996 27.6 22.675 42 22.125 27.750000000000004 28.225 21.9 43 22.225 27.650000000000002 29.65 20.474999999999998 44 22.85 25.974999999999998 29.025000000000002 22.15 45 22.325 27.650000000000002 28.7 21.325 46 23.375 27.375 27.800000000000004 21.45 47 22.925 29.175 26.224999999999998 21.675 48 21.224999999999998 29.225 27.875 21.675 49 21.25 26.875 28.199999999999996 23.674999999999997 50 21.6 28.125 28.4 21.875 51 21.15 28.799999999999997 28.625 21.425 52 22.6 28.225 27.1 22.075 53 21.45 28.599999999999998 28.075 21.875 54 21.55 27.650000000000002 27.900000000000002 22.900000000000002 55 23.0 26.924999999999997 28.675 21.4 56 22.650000000000002 26.974999999999998 27.825 22.55 57 20.974999999999998 26.950000000000003 29.775000000000002 22.3 58 22.225 27.025 29.375 21.375 59 23.25 27.625 27.425 21.7 60 21.8 29.15 27.35 21.7 61 21.775 27.275 29.925 21.025 62 22.6 28.275 27.375 21.75 63 22.025 27.250000000000004 27.3 23.425 64 22.05 29.025000000000002 27.175 21.75 65 22.075 28.125 26.950000000000003 22.85 66 21.975 28.249999999999996 27.575 22.2 67 21.725 29.75 26.875 21.65 68 21.875 29.175 28.075 20.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 1.0 22 2.0 23 4.0 24 8.0 25 10.0 26 9.0 27 11.0 28 14.0 29 21.5 30 38.0 31 47.0 32 52.0 33 68.5 34 80.0 35 101.5 36 154.5 37 186.0 38 229.0 39 288.5 40 337.0 41 369.0 42 383.5 43 381.0 44 364.0 45 356.5 46 353.5 47 358.0 48 311.5 49 239.5 50 214.0 51 179.5 52 134.0 53 123.0 54 106.0 55 79.0 56 69.0 57 56.5 58 33.5 59 23.0 60 17.5 61 14.0 62 16.0 63 11.5 64 5.0 65 3.0 66 3.0 67 3.0 68 2.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.5 77 1.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77426636568849 99.45 2 0.200652119388011 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025081514923501375 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTGAAAAA 6 0.15 TruSeq Adapter, Index 10 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 263622 spots for SRR952901.sra Written 263622 spots for SRR952901.sra Read 263622 spots for SRR952901.sra Written 263622 spots for SRR952901.sra Read 263622 spots for SRR952901.sra Written 263622 spots for SRR952901.sra Read 263622 spots for SRR952901.sra Written 263622 spots for SRR952901.sra Read 263622 spots for SRR952901.sra Written 263622 spots for SRR952901.sra Read 263622 spots for SRR952901.sra Written 263622 spots for SRR952901.sra Read 263622 spots for SRR952901.sra Written 263622 spots for SRR952901.sra Read 263622 spots for SRR952901.sra Written 263622 spots for SRR952901.sra Read 263622 spots for SRR952901.sra Written 263622 spots for SRR952901.sra Read 263622 spots for SRR952901.sra Written 263622 spots for SRR952901.sra Read 263622 spots for SRR952901.sra Written 263622 spots for SRR952901.sra Read 263622 spots for SRR952901.sra Written 263622 spots for SRR952901.sra Read 263622 spots for SRR952901.sra Written 263622 spots for SRR952901.sra Read 263622 spots for SRR952901.sra Written 263622 spots for SRR952901.sra Read 263622 spots for SRR952901.sra Written 263622 spots for SRR952901.sra Read 263622 spots for SRR952901.sra Written 263622 spots for SRR952901.sra Read 263622 spots for SRR952901.sra Written 263622 spots for SRR952901.sra Read 263622 spots for SRR952901.sra Written 263622 spots for SRR952901.sra Read 263640 spots for SRR952901.sra Written 263640 spots for SRR952901.sra Read 263622 spots for SRR952901.sra Written 263622 spots for SRR952901.sra SRR ids: ['SRR952901.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n_2jhepx SRR952901.sra spots: 5272458 blocks: [[1, 263622], [263623, 527244], [527245, 790866], [790867, 1054488], [1054489, 1318110], [1318111, 1581732], [1581733, 1845354], [1845355, 2108976], [2108977, 2372598], [2372599, 2636220], [2636221, 2899842], [2899843, 3163464], [3163465, 3427086], [3427087, 3690708], [3690709, 3954330], [3954331, 4217952], [4217953, 4481574], [4481575, 4745196], [4745197, 5008818], [5008819, 5272458]] SRR952901 file size 1101696 SRR952901 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR952901 SRR952901_1.fastq Input file: SRR952901_1.fastq trimmed: SRR952901-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 11:59:42 2025 >> started Mon Feb 10 11:59:45 2025 >> done (2.614s) 5272458 reads processed; of these: 16658 ( 0.32%) short reads filtered out after trimming by size control 20329 ( 0.39%) empty reads filtered out after trimming by size control 5235471 (99.30%) reads available; of these: 538951 (10.29%) trimmed reads available after processing 4696520 (89.71%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1847 0.04% 19 2749 0.05% 20 3889 0.07% 21 1338 0.03% 22 2015 0.04% 23 2883 0.06% 24 4605 0.09% 25 7600 0.15% 26 2109 0.04% 27 2884 0.06% 28 3771 0.07% 29 5697 0.11% 30 9050 0.17% 31 2560 0.05% 32 3089 0.06% 33 4176 0.08% 34 6086 0.12% 35 8780 0.17% 36 2512 0.05% 37 3018 0.06% 38 4813 0.09% 39 7128 0.14% 40 10537 0.20% 41 2472 0.05% 42 3639 0.07% 43 5149 0.10% 44 8035 0.15% 45 13108 0.25% 46 3101 0.06% 47 4570 0.09% 48 7065 0.13% 49 11562 0.22% 50 18662 0.36% 51 4833 0.09% 52 6944 0.13% 53 11199 0.21% 54 18599 0.36% 55 32933 0.63% 56 6752 0.13% 57 9654 0.18% 58 15146 0.29% 59 26058 0.50% 60 47723 0.91% 61 9268 0.18% 62 13630 0.26% 63 21395 0.41% 64 38521 0.74% 65 62858 1.20% 66 13007 0.25% 67 19932 0.38% 68 4696520 89.71% 5235471 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=1.90 fanout-score-rank=32 prefix-density=0.19 prefix-fanout=1.1 sequence=TGGCCAGAGCTCCTTGGAGCGCAAGCAAGGGTTGCGGTAGCCACTATTGAAACGGAGAATCCTTATGTGGACACTCAGGTTGTGTTAGAAGGAACGCCTGTGACTGGAGAGTTCTCTTGCACTAGGGTTCGTGTTTGGATTGACAGGAACAGAATTGTTACTCGGGTTCCTGTAATTGGTTGAAGGCTCATGCATGCTGATTATCATCCTGCTGGATCTTATGAAATAAGGAGTTTCTAGTTCTCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=19.09 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.9 sequence=GGTGGTGGTGGAG Started job on | Feb 10 11:59:59 Started mapping on | Feb 10 11:59:59 Finished on | Feb 10 12:00:05 Mapping speed, Million of reads per hour | 3141.28 Number of input reads | 5235471 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 4771864 Uniquely mapped reads % | 91.14% Average mapped length | 66.44 Number of splices: Total | 985604 Number of splices: Annotated (sjdb) | 969463 Number of splices: GT/AG | 970564 Number of splices: GC/AG | 12975 Number of splices: AT/AC | 876 Number of splices: Non-canonical | 1189 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.79 Insertion rate per base | 0.01% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 389039 % of reads mapped to multiple loci | 7.43% Number of reads mapped to too many loci | 32337 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.80% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 74568 74568 74568 N_multimapping 389039 389039 389039 N_noFeature 175703 2419158 2511293 N_ambiguous 28527 5851 5668 UnstrandedReadsAssigned:4567634 PositiveStrandReadsAssigned:2346855 NegativeStrandReadsAssigned:2254903 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR952901 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR952901-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,235,471 reads, 4,855,661 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52401 SRR952901.ke.tsv 34699 SRR952901.se.tsv 87100 total ==> SRR952901.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 880 126.321 Potri.005G024800.1.v4.1 1035 936 215 63.2746 Potri.004G059700.1.v4.1 961 862 1 0.319565 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 186.813 18.0944 Potri.016G087400.1.v4.1 270 171 100 161.091 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 252.07 41.4794 Potri.012G127500.1.v4.1 977 878 803 251.935 ==> SRR952901.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 96 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 2 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 0 SRR952901 completed mapping pipeline successfully