Starting /dee2/code/volunteer_pipeline.sh SRR952902 current disk space = 3058832052224 free memory = 1414157600 SRR952902 SRAfilesize 40775348733a6e0a4f460136d8ad8865 SRR952902.sra SRR952902.sra file validated SRR952902 is single end SRR952902 is conventional basespace SRR952902 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR952902_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.73575 38.0 35.0 39.0 32.0 40.0 2 36.278 38.0 35.0 39.0 30.0 40.0 3 36.13475 38.0 35.0 39.0 30.0 40.0 4 36.134 38.0 35.0 39.0 30.0 40.0 5 36.005 38.0 35.0 39.0 29.0 40.0 6 36.3125 38.0 35.0 39.0 30.0 40.0 7 36.25625 38.0 35.0 39.0 30.0 40.0 8 36.03525 38.0 35.0 39.0 29.0 40.0 9 35.97075 38.0 35.0 39.0 29.0 40.0 10 36.00325 38.0 35.0 39.0 29.0 40.0 11 36.0715 38.0 35.0 39.0 30.0 40.0 12 35.6865 38.0 35.0 39.0 28.0 40.0 13 35.98775 38.0 35.0 39.0 29.0 40.0 14 35.7895 38.0 35.0 39.0 29.0 40.0 15 35.433 38.0 33.0 39.0 28.0 40.0 16 35.956 38.0 35.0 39.0 30.0 40.0 17 35.95125 38.0 35.0 39.0 30.0 40.0 18 35.34775 38.0 33.0 39.0 28.0 40.0 19 35.39975 38.0 33.0 39.0 28.0 40.0 20 35.57025 38.0 34.0 39.0 29.0 40.0 21 35.66025 38.0 35.0 39.0 29.0 40.0 22 35.62675 38.0 35.0 39.0 29.0 40.0 23 35.264 38.0 33.0 39.0 28.0 40.0 24 35.65175 38.0 35.0 39.0 29.0 40.0 25 35.3615 38.0 33.0 39.0 28.0 40.0 26 35.313 38.0 35.0 39.0 28.0 40.0 27 35.27875 38.0 34.0 39.0 28.0 40.0 28 34.93775 38.0 33.0 39.0 28.0 40.0 29 34.94325 38.0 33.0 39.0 28.0 40.0 30 34.411 38.0 33.0 39.0 26.0 40.0 31 34.59925 38.0 33.0 39.0 27.0 40.0 32 34.26125 37.0 33.0 39.0 26.0 40.0 33 33.6185 36.0 32.0 39.0 24.0 40.0 34 34.113 37.0 33.0 39.0 26.0 40.0 35 33.9945 37.0 33.0 39.0 25.0 40.0 36 33.9255 37.0 33.0 39.0 25.0 40.0 37 33.7265 36.0 32.0 39.0 25.0 40.0 38 33.646 36.0 33.0 39.0 24.0 40.0 39 33.24575 36.0 32.0 39.0 23.0 40.0 40 33.2595 36.0 31.0 39.0 23.0 40.0 41 33.323 36.0 32.0 39.0 23.0 40.0 42 33.226 36.0 32.0 39.0 23.0 40.0 43 32.91925 36.0 31.0 38.0 23.0 40.0 44 32.58475 36.0 31.0 38.0 22.0 40.0 45 32.62975 36.0 31.0 38.0 23.0 39.0 46 32.906 36.0 31.0 38.0 23.0 40.0 47 32.77775 36.0 31.0 38.0 23.0 39.0 48 32.6405 36.0 31.0 38.0 23.0 40.0 49 32.42275 35.0 31.0 38.0 22.0 39.0 50 32.0875 35.0 30.0 38.0 20.0 39.0 51 32.20775 36.0 31.0 38.0 19.0 40.0 52 31.77525 35.0 30.0 38.0 17.0 39.0 53 31.573 35.0 30.0 38.0 18.0 39.0 54 31.15375 35.0 29.0 38.0 16.0 39.0 55 30.62675 35.0 29.0 38.0 14.0 39.0 56 30.57125 35.0 29.0 38.0 7.0 39.0 57 29.809 34.0 28.0 37.0 2.0 39.0 58 30.05925 34.0 28.0 38.0 2.0 39.0 59 29.50075 33.0 27.0 37.0 2.0 39.0 60 28.99425 33.0 27.0 37.0 2.0 39.0 61 29.21725 33.0 28.0 37.0 2.0 39.0 62 28.61825 33.0 27.0 36.0 2.0 39.0 63 28.51275 33.0 27.0 36.0 2.0 39.0 64 28.21625 33.0 26.0 36.0 2.0 39.0 65 28.099 33.0 26.0 36.0 2.0 38.0 66 27.97625 33.0 26.0 37.0 2.0 39.0 67 27.62325 33.0 25.0 37.0 2.0 39.0 68 27.2855 33.0 24.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 4.0 4 3.0 5 4.0 6 4.0 7 4.0 8 9.0 9 8.0 10 11.0 11 15.0 12 15.0 13 11.0 14 18.0 15 18.0 16 13.0 17 17.0 18 22.0 19 17.0 20 23.0 21 38.0 22 37.0 23 48.0 24 46.0 25 70.0 26 71.0 27 75.0 28 89.0 29 107.0 30 119.0 31 158.0 32 176.0 33 263.0 34 325.0 35 386.0 36 475.0 37 545.0 38 555.0 39 199.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.718256949661907 17.405459554219885 17.831204608064112 40.04507888805409 2 22.775000000000002 24.625 35.0 17.599999999999998 3 23.724999999999998 28.15 26.724999999999998 21.4 4 24.025 32.300000000000004 22.125 21.55 5 25.55 35.525 23.150000000000002 15.775 6 18.30457614403601 39.20980245061265 24.15603900975244 18.3295823955989 7 16.625 17.5 44.975 20.9 8 18.7 25.25 29.375 26.674999999999997 9 20.925 21.475 32.375 25.224999999999998 10 19.400000000000002 39.300000000000004 24.224999999999998 17.075000000000003 11 25.874999999999996 28.349999999999998 22.125 23.65 12 22.525000000000002 25.4 27.950000000000003 24.125 13 19.525000000000002 30.75 30.425 19.3 14 19.975 27.500000000000004 30.55 21.975 15 21.45 28.199999999999996 27.950000000000003 22.400000000000002 16 21.125 28.15 28.275 22.45 17 22.3 28.225 27.775 21.7 18 21.675 28.625 28.349999999999998 21.349999999999998 19 21.05 28.849999999999998 26.825 23.275000000000002 20 21.575 28.275 28.775000000000002 21.375 21 21.925 27.150000000000002 28.4 22.525000000000002 22 21.575 28.375 28.525 21.525 23 21.375 29.375 27.325 21.925 24 22.225 30.0 26.950000000000003 20.825 25 21.275 29.625 27.775 21.325 26 20.775 29.4 26.950000000000003 22.875 27 21.325 29.599999999999998 26.775 22.3 28 21.2 30.25 27.025 21.525 29 21.3 28.849999999999998 27.474999999999998 22.375 30 21.0 28.975 28.625 21.4 31 21.85 28.925 27.05 22.175 32 21.525 28.725 27.900000000000002 21.85 33 21.375 28.375 27.825 22.425 34 21.349999999999998 28.325 28.050000000000004 22.275 35 21.925 28.575 27.875 21.625 36 21.275 28.4 28.65 21.675 37 21.85 27.900000000000002 28.125 22.125 38 21.925 27.450000000000003 27.450000000000003 23.175 39 20.875 29.175 27.400000000000002 22.55 40 20.5 28.225 29.45 21.825 41 22.655663915978995 28.457114278569644 27.881970492623154 21.005251312828207 42 20.424999999999997 29.375 28.199999999999996 22.0 43 20.925 29.875 27.35 21.85 44 21.875 28.225 28.000000000000004 21.9 45 20.474999999999998 29.15 28.825 21.55 46 21.680420105026258 29.232308077019255 28.00700175043761 21.080270067516878 47 22.305576394098527 28.057014253563388 27.85696424106027 21.780445111277817 48 21.630407601900476 28.657164291072768 27.506876719179797 22.20555138784696 49 21.05 27.05 29.349999999999998 22.55 50 21.530382595648913 27.53188297074269 29.457364341085274 21.48037009252313 51 21.48037009252313 28.782195548887223 27.231807951987996 22.50562640660165 52 20.985492746373186 29.739869934967484 27.788894447223612 21.48574287143572 53 21.880470117529384 28.532133033258315 29.03225806451613 20.555138784696176 54 23.005751437859466 28.80720180045011 27.60690172543136 20.580145036259065 55 22.030507626906726 28.132033008252062 27.956989247311824 21.880470117529384 56 21.349999999999998 28.925 29.049999999999997 20.674999999999997 57 22.25 28.775000000000002 27.675 21.3 58 22.925 27.900000000000002 28.175 21.0 59 22.825 28.199999999999996 27.525 21.45 60 19.950000000000003 28.925 29.425 21.7 61 22.325 27.975 28.025 21.675 62 22.900000000000002 27.750000000000004 27.700000000000003 21.65 63 20.3 28.225 29.299999999999997 22.175 64 21.875 28.275 27.700000000000003 22.15 65 22.175 27.1 28.349999999999998 22.375 66 21.925 28.775000000000002 27.725 21.575 67 21.775 29.2 26.950000000000003 22.075 68 22.6 28.975 27.150000000000002 21.275 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.5 19 1.0 20 2.0 21 3.0 22 3.0 23 3.5 24 6.0 25 8.0 26 12.0 27 19.5 28 23.0 29 25.0 30 37.0 31 47.0 32 63.0 33 91.5 34 104.0 35 126.5 36 173.5 37 198.0 38 238.5 39 302.5 40 344.0 41 362.0 42 371.0 43 367.5 44 355.0 45 353.0 46 326.5 47 302.0 48 274.0 49 220.0 50 194.0 51 183.0 52 150.0 53 128.0 54 96.5 55 63.5 56 62.0 57 48.0 58 28.0 59 22.0 60 19.0 61 16.0 62 16.0 63 13.0 64 8.5 65 4.5 66 2.0 67 1.5 68 1.0 69 1.0 70 1.0 71 1.0 72 1.0 73 1.5 74 1.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.025 42 0.0 43 0.0 44 0.0 45 0.0 46 0.025 47 0.025 48 0.025 49 0.0 50 0.025 51 0.025 52 0.05 53 0.025 54 0.025 55 0.025 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.075 0.0 0.0 0.0 0.0 36 0.075 0.0 0.0 0.0 0.0 37 0.075 0.0 0.0 0.0 0.0 38 0.075 0.0 0.0 0.0 0.0 39 0.075 0.0 0.0 0.0 0.0 40 0.075 0.0 0.0 0.0 0.0 41 0.075 0.0 0.0 0.0 0.0 42 0.075 0.0 0.0 0.0 0.0 43 0.075 0.0 0.0 0.0 0.0 44 0.075 0.0 0.0 0.0 0.0 45 0.075 0.0 0.0 0.0 0.0 46 0.075 0.0 0.0 0.0 0.0 47 0.075 0.0 0.0 0.0 0.0 48 0.075 0.0 0.0 0.0 0.0 49 0.075 0.0 0.0 0.0 0.0 50 0.075 0.0 0.0 0.0 0.0 51 0.075 0.0 0.0 0.0 0.0 52 0.075 0.0 0.0 0.0 0.0 53 0.075 0.0 0.0 0.0 0.0 54 0.075 0.0 0.0 0.0 0.0 55 0.075 0.0 0.0 0.0 0.0 56 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 143065 spots for SRR952902.sra Written 143065 spots for SRR952902.sra Read 143065 spots for SRR952902.sra Written 143065 spots for SRR952902.sra Read 143065 spots for SRR952902.sra Written 143065 spots for SRR952902.sra Read 143065 spots for SRR952902.sra Written 143065 spots for SRR952902.sra Read 143065 spots for SRR952902.sra Written 143065 spots for SRR952902.sra Read 143065 spots for SRR952902.sra Written 143065 spots for SRR952902.sra Read 143065 spots for SRR952902.sra Written 143065 spots for SRR952902.sra Read 143065 spots for SRR952902.sra Written 143065 spots for SRR952902.sra Read 143065 spots for SRR952902.sra Written 143065 spots for SRR952902.sra Read 143065 spots for SRR952902.sra Written 143065 spots for SRR952902.sra Read 143065 spots for SRR952902.sra Written 143065 spots for SRR952902.sra Read 143065 spots for SRR952902.sra Written 143065 spots for SRR952902.sra Read 143065 spots for SRR952902.sra Written 143065 spots for SRR952902.sra Read 143065 spots for SRR952902.sra Written 143065 spots for SRR952902.sra Read 143065 spots for SRR952902.sra Written 143065 spots for SRR952902.sra Read 143065 spots for SRR952902.sra Written 143065 spots for SRR952902.sra Read 143065 spots for SRR952902.sra Written 143065 spots for SRR952902.sra Read 143065 spots for SRR952902.sra Written 143065 spots for SRR952902.sra Read 143065 spots for SRR952902.sra Written 143065 spots for SRR952902.sra Read 143078 spots for SRR952902.sra Written 143078 spots for SRR952902.sra SRR ids: ['SRR952902.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a6y5zm5l SRR952902.sra spots: 2861313 blocks: [[1, 143065], [143066, 286130], [286131, 429195], [429196, 572260], [572261, 715325], [715326, 858390], [858391, 1001455], [1001456, 1144520], [1144521, 1287585], [1287586, 1430650], [1430651, 1573715], [1573716, 1716780], [1716781, 1859845], [1859846, 2002910], [2002911, 2145975], [2145976, 2289040], [2289041, 2432105], [2432106, 2575170], [2575171, 2718235], [2718236, 2861313]] SRR952902 file size 597376 SRR952902 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR952902 SRR952902_1.fastq Input file: SRR952902_1.fastq trimmed: SRR952902-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 12:06:38 2025 >> started Mon Feb 10 12:06:40 2025 >> done (1.488s) 2861313 reads processed; of these: 8195 ( 0.29%) short reads filtered out after trimming by size control 6650 ( 0.23%) empty reads filtered out after trimming by size control 2846468 (99.48%) reads available; of these: 286475 (10.06%) trimmed reads available after processing 2559993 (89.94%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 982 0.03% 19 1527 0.05% 20 2138 0.08% 21 668 0.02% 22 1002 0.04% 23 1544 0.05% 24 2472 0.09% 25 4126 0.14% 26 1047 0.04% 27 1566 0.06% 28 2003 0.07% 29 2940 0.10% 30 4875 0.17% 31 1296 0.05% 32 1583 0.06% 33 2163 0.08% 34 3259 0.11% 35 4728 0.17% 36 1373 0.05% 37 1681 0.06% 38 2626 0.09% 39 3762 0.13% 40 5750 0.20% 41 1336 0.05% 42 1875 0.07% 43 2794 0.10% 44 4400 0.15% 45 6904 0.24% 46 1564 0.05% 47 2377 0.08% 48 3800 0.13% 49 6124 0.22% 50 9922 0.35% 51 2520 0.09% 52 3668 0.13% 53 6067 0.21% 54 9619 0.34% 55 17406 0.61% 56 3690 0.13% 57 5078 0.18% 58 7863 0.28% 59 13799 0.48% 60 25300 0.89% 61 4820 0.17% 62 7351 0.26% 63 11557 0.41% 64 20500 0.72% 65 33672 1.18% 66 6727 0.24% 67 10631 0.37% 68 2559993 89.94% 2846468 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=23 prefix-density=0.12 prefix-fanout=2.0 sequence=CAAGGTAAGAGTTCATGGCCAGAGCT criterion=fanout-score sequence-density=0.03 sequence-density-rank=20 fanout-score=153.88 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=20.6 sequence=TTCTTCTTCTTT Started job on | Feb 10 12:06:53 Started mapping on | Feb 10 12:06:53 Finished on | Feb 10 12:06:59 Mapping speed, Million of reads per hour | 1707.88 Number of input reads | 2846468 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 2628532 Uniquely mapped reads % | 92.34% Average mapped length | 66.47 Number of splices: Total | 546192 Number of splices: Annotated (sjdb) | 537666 Number of splices: GT/AG | 537924 Number of splices: GC/AG | 7182 Number of splices: AT/AC | 451 Number of splices: Non-canonical | 635 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.80 Insertion rate per base | 0.01% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 178162 % of reads mapped to multiple loci | 6.26% Number of reads mapped to too many loci | 22401 % of reads mapped to too many loci | 0.79% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.60% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 39774 39774 39774 N_multimapping 178162 178162 178162 N_noFeature 116418 1348357 1387438 N_ambiguous 15671 3335 3247 UnstrandedReadsAssigned:2496443 PositiveStrandReadsAssigned:1276840 NegativeStrandReadsAssigned:1237847 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR952902 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR952902-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,846,468 reads, 2,623,545 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,084 rounds 52401 SRR952902.ke.tsv 34699 SRR952902.se.tsv 87100 total ==> SRR952902.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 486.426 132.894 Potri.005G024800.1.v4.1 1035 936 119 66.6551 Potri.004G059700.1.v4.1 961 862 2 1.21642 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 101.588 18.7273 Potri.016G087400.1.v4.1 270 171 51 156.364 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 95.8014 30.004 Potri.012G127500.1.v4.1 977 878 622 371.414 ==> SRR952902.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 46 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 3 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR952902 completed mapping pipeline successfully