Starting /dee2/code/volunteer_pipeline.sh SRR952903 current disk space = 3058974605312 free memory = 1514177172 SRR952903 SRAfilesize ca01b5c1e85752625733fa0bfd8ce0d0 SRR952903.sra SRR952903.sra file validated SRR952903 is single end SRR952903 is conventional basespace SRR952903 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR952903_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.66925 38.0 35.0 39.0 31.0 40.0 2 36.2875 38.0 35.0 39.0 30.0 40.0 3 36.05225 38.0 35.0 39.0 29.0 40.0 4 36.04075 38.0 35.0 39.0 30.0 40.0 5 35.9075 38.0 35.0 39.0 29.0 40.0 6 36.1175 38.0 35.0 39.0 30.0 40.0 7 36.16775 38.0 35.0 39.0 30.0 40.0 8 35.917 38.0 35.0 39.0 29.0 40.0 9 35.83475 38.0 35.0 39.0 29.0 40.0 10 35.8155 38.0 35.0 39.0 29.0 40.0 11 35.97425 38.0 35.0 39.0 29.0 40.0 12 35.56025 38.0 34.0 39.0 28.0 40.0 13 35.8375 38.0 35.0 39.0 29.0 40.0 14 35.68475 38.0 35.0 39.0 29.0 40.0 15 35.31625 38.0 33.0 39.0 28.0 40.0 16 35.90525 38.0 35.0 39.0 29.0 40.0 17 35.6395 38.0 35.0 39.0 29.0 40.0 18 35.252 38.0 33.0 39.0 27.0 40.0 19 35.33525 38.0 33.0 39.0 28.0 40.0 20 35.425 38.0 33.0 39.0 28.0 40.0 21 35.51525 38.0 35.0 39.0 28.0 40.0 22 35.54175 38.0 35.0 39.0 29.0 40.0 23 35.1435 38.0 33.0 39.0 27.0 40.0 24 35.54375 38.0 34.0 39.0 29.0 40.0 25 35.317 38.0 33.0 39.0 28.0 40.0 26 35.3475 38.0 35.0 39.0 28.0 40.0 27 35.27975 38.0 35.0 39.0 28.0 40.0 28 34.806 38.0 33.0 39.0 27.0 40.0 29 34.90625 38.0 33.0 39.0 27.0 40.0 30 34.4975 37.0 33.0 39.0 27.0 40.0 31 34.51075 38.0 33.0 39.0 26.0 40.0 32 34.13075 37.0 33.0 39.0 26.0 40.0 33 33.4755 36.0 32.0 39.0 23.0 40.0 34 33.92325 37.0 33.0 39.0 25.0 40.0 35 33.90125 37.0 33.0 39.0 25.0 40.0 36 33.73275 37.0 33.0 39.0 23.0 40.0 37 33.50375 36.0 32.0 39.0 23.0 40.0 38 33.35975 36.0 32.0 39.0 23.0 40.0 39 33.19075 36.0 31.0 39.0 23.0 40.0 40 33.1005 36.0 31.0 39.0 23.0 40.0 41 33.3345 36.0 32.0 39.0 23.0 40.0 42 33.022 36.0 31.0 39.0 23.0 40.0 43 32.89125 36.0 31.0 38.0 23.0 40.0 44 32.4575 36.0 30.0 38.0 22.0 39.0 45 32.47275 36.0 31.0 38.0 22.0 39.0 46 32.77425 36.0 31.0 38.0 22.0 40.0 47 32.599 36.0 31.0 38.0 23.0 40.0 48 32.42975 36.0 31.0 38.0 21.0 39.0 49 32.207 35.0 31.0 38.0 21.0 39.0 50 32.01775 35.0 30.0 38.0 20.0 39.0 51 32.00125 35.0 31.0 38.0 19.0 39.0 52 31.488 35.0 30.0 38.0 18.0 39.0 53 31.3235 35.0 30.0 38.0 17.0 39.0 54 31.0325 35.0 29.0 38.0 16.0 39.0 55 30.37575 34.0 29.0 38.0 10.0 39.0 56 29.951 35.0 28.0 38.0 2.0 39.0 57 29.3875 33.0 27.0 37.0 2.0 39.0 58 29.56875 34.0 28.0 37.0 2.0 39.0 59 29.0725 33.0 27.0 37.0 2.0 39.0 60 28.55775 33.0 26.0 36.0 2.0 39.0 61 28.75675 33.0 27.0 37.0 2.0 39.0 62 28.09425 33.0 26.0 36.0 2.0 39.0 63 28.10125 33.0 26.0 36.0 2.0 38.0 64 27.8445 33.0 25.0 36.0 2.0 38.0 65 27.70375 33.0 25.0 36.0 2.0 38.0 66 27.52625 33.0 24.0 37.0 2.0 39.0 67 27.27475 33.0 24.0 36.0 2.0 39.0 68 27.00775 33.0 23.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 1.0 4 3.0 5 2.0 6 1.0 7 2.0 8 10.0 9 6.0 10 15.0 11 16.0 12 11.0 13 9.0 14 27.0 15 15.0 16 18.0 17 22.0 18 20.0 19 23.0 20 37.0 21 38.0 22 41.0 23 49.0 24 41.0 25 67.0 26 72.0 27 90.0 28 74.0 29 118.0 30 111.0 31 173.0 32 197.0 33 228.0 34 302.0 35 393.0 36 481.0 37 601.0 38 516.0 39 160.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.70117824016044 16.344948608673853 16.9967410378541 38.9571321133116 2 21.25 24.7 34.875 19.175 3 22.475 28.999999999999996 25.650000000000002 22.875 4 25.05 31.95 22.55 20.45 5 25.825 34.4 22.225 17.549999999999997 6 17.829457364341085 39.034758689672415 22.80570142535634 20.330082520630157 7 16.375 18.425 44.775 20.424999999999997 8 19.55 23.45 29.95 27.05 9 20.375 22.95 31.1 25.575 10 20.200000000000003 38.475 24.5 16.825000000000003 11 24.4 28.575 22.75 24.275 12 21.5 25.324999999999996 27.500000000000004 25.674999999999997 13 18.925 29.075 31.7 20.3 14 21.275 27.125 29.15 22.45 15 21.75 27.525 27.800000000000004 22.925 16 22.475 28.449999999999996 26.474999999999998 22.6 17 22.0 29.725 26.950000000000003 21.325 18 22.875 27.675 27.900000000000002 21.55 19 22.625 29.2 26.150000000000002 22.025 20 22.2 28.4 27.85 21.55 21 21.825 28.425 27.525 22.225 22 22.3 28.175 27.650000000000002 21.875 23 21.0 28.449999999999996 28.7 21.85 24 21.675 28.675 27.925 21.725 25 21.6 28.7 27.474999999999998 22.225 26 22.325 27.950000000000003 27.025 22.7 27 22.25 28.1 26.900000000000002 22.75 28 22.025 27.500000000000004 28.125 22.35 29 21.175 26.950000000000003 28.775000000000002 23.1 30 21.85 27.725 28.749999999999996 21.675 31 22.075 27.0 28.075 22.85 32 22.675 27.750000000000004 28.1 21.475 33 22.075 28.549999999999997 27.85 21.525 34 23.150000000000002 26.974999999999998 27.900000000000002 21.975 35 22.925 27.975 27.3 21.8 36 22.025 29.575000000000003 27.325 21.075 37 23.45 27.35 27.775 21.425 38 22.5 29.2 27.250000000000004 21.05 39 23.325000000000003 27.775 26.724999999999998 22.175 40 21.825 28.549999999999997 27.224999999999998 22.400000000000002 41 22.58064516129032 29.457364341085274 26.531632908227053 21.43035758939735 42 22.8 27.875 27.975 21.349999999999998 43 22.225 27.700000000000003 29.25 20.825 44 22.025 27.800000000000004 27.025 23.150000000000002 45 22.5 27.825 28.125 21.55 46 23.20580145036259 27.131782945736433 27.656914228557138 22.005501375343837 47 22.575 28.1 28.249999999999996 21.075 48 22.13053263315829 28.507126781695426 27.70692673168292 21.655413853463365 49 22.775000000000002 28.249999999999996 27.55 21.425 50 22.83070767691923 27.60690172543136 27.631907976994246 21.930482620655166 51 22.330582645661416 28.507126781695426 27.056764191047762 22.1055263815954 52 22.316737553164874 26.1195896922692 29.947460595446586 21.61621215911934 53 22.755688922230558 27.28182045511378 29.35733933483371 20.605151287821954 54 23.005751437859466 27.60690172543136 28.182045511377847 21.205301325331334 55 21.330332583145786 28.00700175043761 27.131782945736433 23.53088272068017 56 21.85 27.325 28.225 22.6 57 22.725 28.175 27.250000000000004 21.85 58 22.025 28.475 27.325 22.175 59 21.825 29.599999999999998 26.224999999999998 22.35 60 23.225 28.1 27.3 21.375 61 23.150000000000002 25.95 28.025 22.875 62 21.85 28.625 27.725 21.8 63 23.05 27.474999999999998 27.1 22.375 64 22.475 27.375 27.250000000000004 22.900000000000002 65 22.5 28.875 27.250000000000004 21.375 66 22.3 28.275 28.1 21.325 67 23.400000000000002 26.8 28.525 21.275 68 21.45 28.449999999999996 27.55 22.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 2.0 26 3.5 27 8.0 28 11.0 29 16.0 30 27.0 31 33.0 32 38.5 33 69.5 34 95.0 35 115.0 36 150.5 37 166.0 38 200.0 39 270.5 40 320.0 41 333.0 42 363.5 43 393.0 44 392.0 45 390.0 46 378.5 47 369.0 48 322.0 49 245.5 50 216.0 51 193.5 52 148.5 53 126.0 54 107.0 55 77.5 56 67.0 57 53.5 58 33.5 59 27.0 60 23.5 61 15.5 62 11.0 63 10.0 64 9.0 65 5.5 66 2.0 67 1.0 68 0.5 69 1.0 70 1.5 71 1.0 72 0.0 73 0.5 74 1.5 75 2.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.025 42 0.0 43 0.0 44 0.0 45 0.0 46 0.025 47 0.0 48 0.025 49 0.0 50 0.025 51 0.025 52 0.075 53 0.025 54 0.025 55 0.025 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82460536206464 99.6 2 0.15033826108744675 0.3 3 0.0 0.0 4 0.025056376847907794 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.075 0.0 0.0 0.0 0.0 18 0.1 0.0 0.0 0.0 0.0 19 0.1 0.0 0.0 0.0 0.0 20 0.1 0.0 0.0 0.0 0.0 21 0.1 0.0 0.0 0.0 0.0 22 0.1 0.0 0.0 0.0 0.0 23 0.1 0.0 0.0 0.0 0.0 24 0.1 0.0 0.0 0.0 0.0 25 0.1 0.0 0.0 0.0 0.0 26 0.1 0.0 0.0 0.0 0.0 27 0.1 0.0 0.0 0.0 0.0 28 0.1 0.0 0.0 0.0 0.0 29 0.1 0.0 0.0 0.0 0.0 30 0.1 0.0 0.0 0.0 0.0 31 0.125 0.0 0.0 0.0 0.0 32 0.125 0.0 0.0 0.0 0.0 33 0.125 0.0 0.0 0.0 0.0 34 0.125 0.0 0.0 0.0 0.0 35 0.125 0.0 0.0 0.0 0.0 36 0.125 0.0 0.0 0.0 0.0 37 0.125 0.0 0.0 0.0 0.0 38 0.125 0.0 0.0 0.0 0.0 39 0.125 0.0 0.0 0.0 0.0 40 0.125 0.0 0.0 0.0 0.0 41 0.125 0.0 0.0 0.0 0.0 42 0.125 0.0 0.0 0.0 0.0 43 0.125 0.0 0.0 0.0 0.0 44 0.125 0.0 0.0 0.0 0.0 45 0.125 0.0 0.0 0.0 0.0 46 0.15 0.0 0.0 0.0 0.0 47 0.15 0.0 0.0 0.0 0.0 48 0.15 0.0 0.0 0.0 0.0 49 0.15 0.0 0.0 0.0 0.0 50 0.15 0.0 0.0 0.0 0.0 51 0.15 0.0 0.0 0.0 0.0 52 0.15 0.0 0.0 0.0 0.0 53 0.15 0.0 0.0 0.0 0.0 54 0.15 0.0 0.0 0.0 0.0 55 0.15 0.0 0.0 0.0 0.0 56 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 169077 spots for SRR952903.sra Written 169077 spots for SRR952903.sra Read 169077 spots for SRR952903.sra Written 169077 spots for SRR952903.sra Read 169077 spots for SRR952903.sra Written 169077 spots for SRR952903.sra Read 169077 spots for SRR952903.sra Written 169077 spots for SRR952903.sra Read 169077 spots for SRR952903.sra Written 169077 spots for SRR952903.sra Read 169077 spots for SRR952903.sra Written 169077 spots for SRR952903.sra Read 169077 spots for SRR952903.sra Written 169077 spots for SRR952903.sra Read 169077 spots for SRR952903.sra Written 169077 spots for SRR952903.sra Read 169077 spots for SRR952903.sra Written 169077 spots for SRR952903.sra Read 169077 spots for SRR952903.sra Written 169077 spots for SRR952903.sra Read 169077 spots for SRR952903.sra Written 169077 spots for SRR952903.sra Read 169077 spots for SRR952903.sra Written 169077 spots for SRR952903.sra Read 169077 spots for SRR952903.sra Written 169077 spots for SRR952903.sra Read 169077 spots for SRR952903.sra Written 169077 spots for SRR952903.sra Read 169077 spots for SRR952903.sra Written 169077 spots for SRR952903.sra Read 169077 spots for SRR952903.sra Written 169077 spots for SRR952903.sra Read 169077 spots for SRR952903.sra Written 169077 spots for SRR952903.sra Read 169077 spots for SRR952903.sra Written 169077 spots for SRR952903.sra Read 169077 spots for SRR952903.sra Written 169077 spots for SRR952903.sra Read 169092 spots for SRR952903.sra Written 169092 spots for SRR952903.sra SRR ids: ['SRR952903.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w25mfflf SRR952903.sra spots: 3381555 blocks: [[1, 169077], [169078, 338154], [338155, 507231], [507232, 676308], [676309, 845385], [845386, 1014462], [1014463, 1183539], [1183540, 1352616], [1352617, 1521693], [1521694, 1690770], [1690771, 1859847], [1859848, 2028924], [2028925, 2198001], [2198002, 2367078], [2367079, 2536155], [2536156, 2705232], [2705233, 2874309], [2874310, 3043386], [3043387, 3212463], [3212464, 3381555]] SRR952903 file size 706195 SRR952903 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR952903 SRR952903_1.fastq Input file: SRR952903_1.fastq trimmed: SRR952903-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 11:40:32 2025 >> started Mon Feb 10 11:40:33 2025 >> done (1.654s) 3381555 reads processed; of these: 10830 ( 0.32%) short reads filtered out after trimming by size control 7036 ( 0.21%) empty reads filtered out after trimming by size control 3363689 (99.47%) reads available; of these: 355603 (10.57%) trimmed reads available after processing 3008086 (89.43%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1186 0.04% 19 1779 0.05% 20 2491 0.07% 21 848 0.03% 22 1318 0.04% 23 1923 0.06% 24 3030 0.09% 25 4952 0.15% 26 1373 0.04% 27 1914 0.06% 28 2423 0.07% 29 3692 0.11% 30 5883 0.17% 31 1669 0.05% 32 2031 0.06% 33 2659 0.08% 34 4036 0.12% 35 5901 0.18% 36 1634 0.05% 37 2021 0.06% 38 3112 0.09% 39 4600 0.14% 40 7192 0.21% 41 1564 0.05% 42 2272 0.07% 43 3403 0.10% 44 5253 0.16% 45 8434 0.25% 46 2093 0.06% 47 2924 0.09% 48 4638 0.14% 49 7727 0.23% 50 12485 0.37% 51 3188 0.09% 52 4631 0.14% 53 7492 0.22% 54 12052 0.36% 55 21737 0.65% 56 4468 0.13% 57 6287 0.19% 58 9946 0.30% 59 17039 0.51% 60 31480 0.94% 61 6089 0.18% 62 9076 0.27% 63 14335 0.43% 64 25471 0.76% 65 41664 1.24% 66 8559 0.25% 67 13629 0.41% 68 3008086 89.43% 3363689 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=30 prefix-density=0.11 prefix-fanout=2.0 sequence=CAAGGTAAGAGTTCATGGCCAGAGCT criterion=fanout-score sequence-density=0.04 sequence-density-rank=17 fanout-score=69.00 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=12.9 sequence=TGGTGGTGGAGG Started job on | Feb 10 11:40:48 Started mapping on | Feb 10 11:40:48 Finished on | Feb 10 11:40:53 Mapping speed, Million of reads per hour | 2421.86 Number of input reads | 3363689 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 3076939 Uniquely mapped reads % | 91.48% Average mapped length | 66.40 Number of splices: Total | 674454 Number of splices: Annotated (sjdb) | 665214 Number of splices: GT/AG | 664231 Number of splices: GC/AG | 8915 Number of splices: AT/AC | 557 Number of splices: Non-canonical | 751 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.78 Insertion rate per base | 0.01% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 244386 % of reads mapped to multiple loci | 7.27% Number of reads mapped to too many loci | 20835 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.63% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 42364 42364 42364 N_multimapping 244386 244386 244386 N_noFeature 89563 1553431 1604074 N_ambiguous 16191 3766 3473 UnstrandedReadsAssigned:2971185 PositiveStrandReadsAssigned:1519742 NegativeStrandReadsAssigned:1469392 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR952903 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR952903-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,363,689 reads, 3,151,847 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,049 rounds 52401 SRR952903.ke.tsv 34699 SRR952903.se.tsv 87100 total ==> SRR952903.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 586 130.754 Potri.005G024800.1.v4.1 1035 936 129 59.0127 Potri.004G059700.1.v4.1 961 862 1 0.496735 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 135.198 20.3551 Potri.016G087400.1.v4.1 270 171 91 227.865 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 152.235 38.9395 Potri.012G127500.1.v4.1 977 878 533 259.935 ==> SRR952903.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 54 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 2 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR952903 completed mapping pipeline successfully