Starting /dee2/code/volunteer_pipeline.sh SRR9668895 current disk space = 3051780608000 free memory = 1468669284 SRR9668895 SRAfilesize e538b406a4445a13bfe3f5430809be8d SRR9668895.sra SRR9668895.sra file validated SRR9668895 is paired end SRR9668895 is conventional basespace SRR9668895 read1 length is 69-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668895_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 69-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.59275 32.0 32.0 32.0 32.0 32.0 2 31.6265 32.0 32.0 32.0 32.0 32.0 3 31.63825 32.0 32.0 32.0 32.0 32.0 4 31.66425 32.0 32.0 32.0 32.0 32.0 5 31.6755 32.0 32.0 32.0 32.0 32.0 6 35.0795 36.0 36.0 36.0 36.0 36.0 7 35.41975 36.0 36.0 36.0 36.0 36.0 8 35.45575 36.0 36.0 36.0 36.0 36.0 9 35.38175 36.0 36.0 36.0 36.0 36.0 10-11 35.30525 36.0 36.0 36.0 36.0 36.0 12-13 35.354749999999996 36.0 36.0 36.0 36.0 36.0 14-15 35.357375000000005 36.0 36.0 36.0 36.0 36.0 16-17 35.31975 36.0 36.0 36.0 36.0 36.0 18-19 35.2695 36.0 36.0 36.0 36.0 36.0 20-21 35.334375 36.0 36.0 36.0 36.0 36.0 22-23 35.351625 36.0 36.0 36.0 36.0 36.0 24-25 35.269125 36.0 36.0 36.0 36.0 36.0 26-27 35.260000000000005 36.0 36.0 36.0 36.0 36.0 28-29 35.250625 36.0 36.0 36.0 36.0 36.0 30-31 35.216375 36.0 36.0 36.0 36.0 36.0 32-33 35.25925 36.0 36.0 36.0 36.0 36.0 34-35 35.249375 36.0 36.0 36.0 36.0 36.0 36-37 35.213625 36.0 36.0 36.0 36.0 36.0 38-39 35.20675 36.0 36.0 36.0 36.0 36.0 40-41 35.158125 36.0 36.0 36.0 36.0 36.0 42-43 35.282375 36.0 36.0 36.0 36.0 36.0 44-45 35.194125 36.0 36.0 36.0 36.0 36.0 46-47 35.117875 36.0 36.0 36.0 36.0 36.0 48-49 35.076499999999996 36.0 36.0 36.0 36.0 36.0 50-51 35.156125 36.0 36.0 36.0 36.0 36.0 52-53 35.049375 36.0 36.0 36.0 36.0 36.0 54-55 35.06275 36.0 36.0 36.0 36.0 36.0 56-57 35.078625 36.0 36.0 36.0 36.0 36.0 58-59 34.917874999999995 36.0 36.0 36.0 36.0 36.0 60-61 34.954 36.0 36.0 36.0 36.0 36.0 62-63 34.976375000000004 36.0 36.0 36.0 36.0 36.0 64-65 34.9775 36.0 36.0 36.0 36.0 36.0 66-67 34.983125 36.0 36.0 36.0 36.0 36.0 68-69 34.91575 36.0 36.0 36.0 36.0 36.0 70-71 34.821205301325335 36.0 36.0 36.0 32.0 36.0 72-73 34.82288122615505 36.0 36.0 36.0 32.0 36.0 74-75 34.75129906369796 36.0 36.0 36.0 32.0 36.0 76 34.24294670846395 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 2.0 24 3.0 25 7.0 26 19.0 27 20.0 28 24.0 29 51.0 30 61.0 31 67.0 32 107.0 33 179.0 34 431.0 35 3028.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.65 12.9 8.05 36.4 2 21.95 16.575 38.25 23.225 3 18.825 22.325 25.775 33.074999999999996 4 22.8 29.625 22.75 24.825 5 23.275000000000002 33.7 22.900000000000002 20.125 6 19.329637096774192 35.761088709677416 24.92439516129032 19.984879032258064 7 14.899999999999999 23.65 43.425000000000004 18.025 8 17.875 23.3 31.900000000000002 26.924999999999997 9 19.7 22.225 32.35 25.724999999999998 10-11 21.5625 32.45 23.549999999999997 22.4375 12-13 20.6625 25.124999999999996 28.349999999999998 25.8625 14-15 19.9125 26.724999999999998 28.462500000000002 24.9 16-17 20.775 28.1 26.9625 24.1625 18-19 21.075 28.037499999999998 26.35 24.5375 20-21 21.712500000000002 27.787499999999998 27.1125 23.3875 22-23 21.325 27.987499999999997 27.224999999999998 23.4625 24-25 20.875 28.487499999999997 26.525 24.1125 26-27 21.15 28.025 26.7125 24.1125 28-29 20.6125 28.475 27.775 23.1375 30-31 20.8875 28.3125 26.1625 24.637500000000003 32-33 21.5 27.700000000000003 26.950000000000003 23.849999999999998 34-35 20.925 28.425 26.887499999999996 23.7625 36-37 21.1875 29.012500000000003 25.2625 24.5375 38-39 20.424999999999997 28.1 27.025 24.45 40-41 21.4125 28.3875 26.7625 23.4375 42-43 22.412499999999998 27.474999999999998 26.1625 23.95 44-45 22.025 27.0625 27.462500000000002 23.45 46-47 21.7875 28.025 26.650000000000002 23.5375 48-49 20.1875 28.349999999999998 26.4125 25.05 50-51 20.8125 28.1625 26.275 24.75 52-53 22.025 27.975 26.7625 23.2375 54-55 20.962500000000002 27.4125 27.287499999999998 24.337500000000002 56-57 20.1 28.575 27.0625 24.2625 58-59 21.4375 28.775000000000002 25.374999999999996 24.4125 60-61 20.625 28.3875 26.137500000000003 24.85 62-63 21.825 28.1375 26.5875 23.45 64-65 21.4 27.500000000000004 26.650000000000002 24.45 66-67 20.4 28.199999999999996 26.5125 24.887500000000003 68-69 20.6375 27.5875 27.2625 24.5125 70-71 21.13028257064266 28.319579894973746 26.59414853713428 23.95598899724931 72-73 21.16229446466675 27.60135559181624 26.434040416718968 24.80230952679804 74-75 20.5552589428724 24.572877736252003 28.43032568072611 26.44153764014949 76 22.962382445141067 0.0 41.02664576802508 36.010971786833856 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 2.0 19 2.0 20 0.5 21 0.0 22 0.5 23 4.0 24 6.0 25 3.5 26 5.5 27 10.5 28 13.5 29 17.0 30 26.0 31 37.5 32 46.0 33 54.0 34 73.0 35 97.5 36 115.5 37 129.0 38 164.5 39 196.0 40 209.5 41 244.5 42 264.0 43 261.5 44 274.0 45 285.5 46 288.0 47 300.0 48 293.5 49 268.5 50 256.5 51 233.0 52 192.5 53 164.5 54 155.5 55 139.5 56 110.5 57 76.0 58 56.0 59 51.5 60 39.0 61 28.0 62 19.5 63 13.0 64 9.5 65 7.5 66 5.0 67 2.5 68 2.5 69 1.5 70 1.0 71 2.0 72 2.5 73 2.0 74 1.0 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.8 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 69 1.0 70 0.0 71 4.0 72 23.0 73 89.0 74 274.0 75 1057.0 76 2552.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.175 #Duplication Level Percentage of deduplicated Percentage of total 1 98.57397504456328 96.775 2 1.1204481792717087 2.1999999999999997 3 0.2037178507766743 0.6 4 0.07639419404125286 0.3 5 0.025464731347084286 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTGGC 20 0.006583462 52.246876 65 >>END_MODULE SRR9668895 read2 length is 71-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668895_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 71-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3305 32.0 32.0 32.0 32.0 32.0 2 31.188 32.0 32.0 32.0 32.0 32.0 3 31.24125 32.0 32.0 32.0 32.0 32.0 4 31.16725 32.0 32.0 32.0 32.0 32.0 5 31.132 32.0 32.0 32.0 32.0 32.0 6 34.775 36.0 36.0 36.0 32.0 36.0 7 34.78875 36.0 36.0 36.0 36.0 36.0 8 34.746 36.0 36.0 36.0 32.0 36.0 9 34.64575 36.0 36.0 36.0 32.0 36.0 10-11 34.698125000000005 36.0 36.0 36.0 34.0 36.0 12-13 34.665375 36.0 36.0 36.0 32.0 36.0 14-15 34.665625000000006 36.0 36.0 36.0 34.0 36.0 16-17 34.655125 36.0 36.0 36.0 34.0 36.0 18-19 34.631875 36.0 36.0 36.0 34.0 36.0 20-21 34.58525 36.0 36.0 36.0 32.0 36.0 22-23 34.64625 36.0 36.0 36.0 32.0 36.0 24-25 34.60275 36.0 36.0 36.0 32.0 36.0 26-27 34.517375 36.0 36.0 36.0 32.0 36.0 28-29 34.50575 36.0 36.0 36.0 32.0 36.0 30-31 34.462125 36.0 36.0 36.0 32.0 36.0 32-33 34.506875 36.0 36.0 36.0 32.0 36.0 34-35 34.5115 36.0 36.0 36.0 32.0 36.0 36-37 34.4215 36.0 36.0 36.0 32.0 36.0 38-39 34.405874999999995 36.0 36.0 36.0 32.0 36.0 40-41 34.25675 36.0 36.0 36.0 32.0 36.0 42-43 34.32175 36.0 36.0 36.0 32.0 36.0 44-45 34.2665 36.0 36.0 36.0 32.0 36.0 46-47 34.1495 36.0 36.0 36.0 32.0 36.0 48-49 34.201625 36.0 36.0 36.0 32.0 36.0 50-51 34.057375 36.0 36.0 36.0 32.0 36.0 52-53 34.143625 36.0 36.0 36.0 32.0 36.0 54-55 34.00275 36.0 36.0 36.0 32.0 36.0 56-57 34.025875 36.0 36.0 36.0 32.0 36.0 58-59 33.969625 36.0 36.0 36.0 32.0 36.0 60-61 34.030375 36.0 36.0 36.0 32.0 36.0 62-63 33.926625 36.0 36.0 36.0 32.0 36.0 64-65 33.793875 36.0 36.0 36.0 29.5 36.0 66-67 33.78275 36.0 36.0 36.0 29.5 36.0 68-69 33.854375000000005 36.0 36.0 36.0 29.5 36.0 70-71 33.82825 36.0 36.0 36.0 29.5 36.0 72-73 33.87317452356028 36.0 36.0 36.0 32.0 36.0 74-75 33.73048298174152 36.0 36.0 36.0 27.0 36.0 76 32.82593593207256 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 3.0 15 12.0 16 7.0 17 7.0 18 8.0 19 9.0 20 11.0 21 7.0 22 7.0 23 10.0 24 25.0 25 24.0 26 35.0 27 41.0 28 72.0 29 70.0 30 83.0 31 101.0 32 166.0 33 242.0 34 609.0 35 2450.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.495247623811906 23.28664332166083 10.730365182591296 25.48774387193597 2 28.449999999999996 28.199999999999996 30.275000000000002 13.075000000000001 3 21.875 27.800000000000004 30.3 20.025000000000002 4 25.424999999999997 34.025 22.6 17.95 5 26.55 36.9 19.650000000000002 16.900000000000002 6 22.275 37.875 20.625 19.225 7 20.775 18.575 39.825 20.825 8 22.625 24.575 27.375 25.424999999999997 9 24.85 23.474999999999998 27.625 24.05 10-11 25.137500000000003 31.337500000000002 22.75 20.775 12-13 24.406101525381345 25.318829707426854 27.319329832458116 22.95573893473368 14-15 24.121545579592347 27.335250719019633 27.822933600100036 20.720270101287984 16-17 24.815601950243778 27.765970746343292 26.615826978372297 20.80260032504063 18-19 24.381095273818453 27.93198299574894 26.994248562140534 20.69267316829207 20-21 24.0780097512189 26.96587073384173 27.015876984623077 21.94024253031629 22-23 24.61230615307654 27.47623811905953 26.313156578289142 21.59829914957479 24-25 25.025 27.2625 26.3 21.4125 26-27 24.424712356178087 27.613806903451728 26.588294147073537 21.373186593296648 28-29 24.603075384423054 27.415926990873857 26.253281660207527 21.727715964495562 30-31 23.546329873702636 26.972614730523947 27.91046642490934 21.570588970864073 32-33 23.921470551456796 26.409903713892707 27.047642866074778 22.620982868575716 34-35 23.6875 27.762500000000003 26.900000000000002 21.65 36-37 23.7625 26.625 27.3375 22.275 38-39 24.01850462615654 27.481870467616904 26.806701675418854 21.6929232308077 40-41 24.387193596798397 28.039019509754876 26.775887943971988 20.79789894947474 42-43 23.465433179147393 27.3284160520065 27.25340667583448 21.952744093011624 44-45 23.78094523630908 27.74443610902726 26.84421105276319 21.630407601900476 46-47 25.29066133266658 26.56582072759095 27.040880110013752 21.102637829728714 48-49 24.634237839189694 26.65999749906215 26.972614730523947 21.73314993122421 50-51 23.974487243621812 27.538769384692348 27.576288144072038 20.910455227613806 52-53 25.212606303151574 27.026013006503252 26.563281640820406 21.198099049524764 54-55 24.112056028014006 27.70135067533767 27.4512256128064 20.735367683841922 56-57 24.72486243121561 27.426213106553277 26.488244122061033 21.360680340170084 58-59 23.81190595297649 27.00100050025013 27.188594297148573 21.99849924962481 60-61 24.012006003001503 26.813406703351678 26.713356678339167 22.461230615307652 62-63 23.67433716858429 27.40120060030015 27.226113056528263 21.698349174587296 64-65 24.437218609304654 26.8384192096048 26.588294147073537 22.136068034017008 66-67 23.539712320200127 27.229518449030643 27.166979362101312 22.063789868667918 68-69 24.349674837418707 27.40120060030015 26.738369184592298 21.510755377688845 70-71 24.48392343300388 26.748404854247465 26.773426748404855 21.9942449643438 72-73 23.316582914572866 27.62562814070352 27.022613065326635 22.035175879396984 74-75 24.75871313672922 23.847184986595174 28.136729222520106 23.257372654155496 76 27.11471610660487 0.0 41.17419853225183 31.711085361143297 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 1.5 23 1.0 24 0.5 25 2.0 26 4.0 27 5.0 28 9.5 29 16.5 30 18.5 31 24.5 32 41.0 33 53.0 34 66.5 35 78.5 36 94.0 37 114.0 38 144.5 39 201.5 40 237.5 41 267.0 42 286.0 43 283.0 44 292.5 45 299.0 46 295.0 47 306.5 48 305.5 49 268.0 50 235.5 51 215.0 52 197.5 53 167.5 54 141.5 55 119.5 56 100.5 57 88.0 58 74.0 59 60.5 60 43.0 61 25.0 62 17.5 63 13.5 64 6.0 65 4.5 66 5.0 67 4.5 68 4.0 69 4.5 70 2.5 71 1.0 72 1.5 73 1.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 5.0 100 9.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.025 14-15 0.0375 16-17 0.0125 18-19 0.025 20-21 0.0125 22-23 0.05 24-25 0.0 26-27 0.05 28-29 0.0125 30-31 0.0375 32-33 0.0375 34-35 0.0 36-37 0.0 38-39 0.025 40-41 0.05 42-43 0.0125 44-45 0.025 46-47 0.0125 48-49 0.0375 50-51 0.05 52-53 0.05 54-55 0.05 56-57 0.05 58-59 0.05 60-61 0.05 62-63 0.05 64-65 0.05 66-67 0.0625 68-69 0.05 70-71 0.08750000000000001 72-73 0.05022601707684581 74-75 0.05359056806002144 76 0.0771902740254728 >>END_MODULE >>Sequence Length Distribution warn #Length Count 71 7.0 72 22.0 73 94.0 74 290.0 75 996.0 76 2591.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.45 #Duplication Level Percentage of deduplicated Percentage of total 1 98.933468765871 97.39999999999999 2 0.7872016251904521 1.55 3 0.20314880650076178 0.6 4 0.025393600812595223 0.1 5 0.025393600812595223 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025393600812595223 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit GTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1161171 spots for SRR9668895.sra Written 1161171 spots for SRR9668895.sra Read 1161171 spots for SRR9668895.sra Written 1161171 spots for SRR9668895.sra Read 1161171 spots for SRR9668895.sra Written 1161171 spots for SRR9668895.sra Read 1161171 spots for SRR9668895.sra Written 1161171 spots for SRR9668895.sra Read 1161171 spots for SRR9668895.sra Written 1161171 spots for SRR9668895.sra Read 1161171 spots for SRR9668895.sra Written 1161171 spots for SRR9668895.sra Read 1161171 spots for SRR9668895.sra Written 1161171 spots for SRR9668895.sra Read 1161171 spots for SRR9668895.sra Written 1161171 spots for SRR9668895.sra Read 1161171 spots for SRR9668895.sra Written 1161171 spots for SRR9668895.sra Read 1161171 spots for SRR9668895.sra Written 1161171 spots for SRR9668895.sra Read 1161171 spots for SRR9668895.sra Written 1161171 spots for SRR9668895.sra Read 1161171 spots for SRR9668895.sra Written 1161171 spots for SRR9668895.sra Read 1161171 spots for SRR9668895.sra Written 1161171 spots for SRR9668895.sra Read 1161171 spots for SRR9668895.sra Written 1161171 spots for SRR9668895.sra Read 1161171 spots for SRR9668895.sra Written 1161171 spots for SRR9668895.sra Read 1161171 spots for SRR9668895.sra Written 1161171 spots for SRR9668895.sra Read 1161171 spots for SRR9668895.sra Written 1161171 spots for SRR9668895.sra Read 1161171 spots for SRR9668895.sra Written 1161171 spots for SRR9668895.sra Read 1161171 spots for SRR9668895.sra Written 1161171 spots for SRR9668895.sra Read 1161171 spots for SRR9668895.sra Written 1161171 spots for SRR9668895.sra SRR ids: ['SRR9668895.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z4yhsx9x SRR9668895.sra spots: 23223420 blocks: [[1, 1161171], [1161172, 2322342], [2322343, 3483513], [3483514, 4644684], [4644685, 5805855], [5805856, 6967026], [6967027, 8128197], [8128198, 9289368], [9289369, 10450539], [10450540, 11611710], [11611711, 12772881], [12772882, 13934052], [13934053, 15095223], [15095224, 16256394], [16256395, 17417565], [17417566, 18578736], [18578737, 19739907], [19739908, 20901078], [20901079, 22062249], [22062250, 23223420]] SRR9668895 file size 4400532 SRR9668895 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668895 SRR9668895_1.fastq SRR9668895_2.fastq Input file: SRR9668895_1.fastq Paired file: SRR9668895_2.fastq trimmed: SRR9668895-trimmed-pair1.fastq, SRR9668895-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:14:05 2025 >> started Wed Feb 12 15:14:26 2025 >> done (21.596s) 23223420 read pairs processed; of these: 3411 ( 0.01%) short read pairs filtered out after trimming by size control 22177 ( 0.10%) empty read pairs filtered out after trimming by size control 23197832 (99.89%) read pairs available; of these: 12041 ( 0.05%) trimmed read pairs available after processing 23185791 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 2 0.00% 21 4 0.00% 22 11 0.00% 23 8 0.00% 24 16 0.00% 25 22 0.00% 26 25 0.00% 27 34 0.00% 28 39 0.00% 29 46 0.00% 30 49 0.00% 31 39 0.00% 32 42 0.00% 33 43 0.00% 34 44 0.00% 35 202 0.00% 36 206 0.00% 37 249 0.00% 38 235 0.00% 39 247 0.00% 40 251 0.00% 41 285 0.00% 42 259 0.00% 43 307 0.00% 44 340 0.00% 45 331 0.00% 46 267 0.00% 47 333 0.00% 48 350 0.00% 49 408 0.00% 50 472 0.00% 51 462 0.00% 52 500 0.00% 53 591 0.00% 54 595 0.00% 55 807 0.00% 56 922 0.00% 57 1021 0.00% 58 1092 0.00% 59 1339 0.01% 60 1705 0.01% 61 1777 0.01% 62 1750 0.01% 63 1834 0.01% 64 2136 0.01% 65 2505 0.01% 66 2436 0.01% 67 2918 0.01% 68 2580 0.01% 69 2825 0.01% 70 3543 0.02% 71 4879 0.02% 72 17592 0.08% 73 206675 0.89% 74 1936984 8.35% 75 11260080 48.54% 76 9733115 41.96% 23197832 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=25 prefix-density=0.64 prefix-fanout=2.2 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=15.20 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.7 sequence=AACATTGAATTCAATTTCTAAATTGCTCCATTCAGCTAATTCATTTGTTCATGCCAGTTGCCTTCTTAACTCCTTCAACAGCTCCCTGTGCCGTAGACATCACCTGTTGACCAGCCCCTTGCACTGATTCCTT criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=26 prefix-density=0.46 prefix-fanout=1.9 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=12.50 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.4 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR9668895 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:14:59 Started mapping on | Feb 12 15:14:59 Finished on | Feb 12 15:16:13 Mapping speed, Million of reads per hour | 1128.54 Number of input reads | 23197832 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 20418271 Uniquely mapped reads % | 88.02% Average mapped length | 150.45 Number of splices: Total | 9074917 Number of splices: Annotated (sjdb) | 8976373 Number of splices: GT/AG | 8908136 Number of splices: GC/AG | 143162 Number of splices: AT/AC | 6209 Number of splices: Non-canonical | 17410 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.01% Insertion average length | 1.90 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 892797 % of reads mapped to multiple loci | 3.85% Number of reads mapped to too many loci | 794224 % of reads mapped to too many loci | 3.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.60% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1887040 1887040 1887040 N_multimapping 892797 892797 892797 N_noFeature 439423 20171923 509862 N_ambiguous 300762 921 124177 UnstrandedReadsAssigned:19678086 PositiveStrandReadsAssigned:245427 NegativeStrandReadsAssigned:19784232 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668895 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668895-trimmed-pair1.fastq SRR9668895-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,197,832 reads, 20,914,498 reads pseudoaligned [quant] estimated average fragment length: 197.539 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,043 rounds 52401 SRR9668895.ke.tsv 34699 SRR9668895.se.tsv 87100 total ==> SRR9668895.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1821.46 331 7.40503 Potri.005G024800.1.v4.1 1035 838.461 118 5.7348 Potri.004G059700.1.v4.1 961 764.461 52 2.77183 Potri.007G009000.2.v4.1 1416 1219.46 2 0.0668315 Potri.003G141000.2.v4.1 2943 2746.46 302 4.48077 Potri.016G087400.1.v4.1 270 91.3596 1516.69 676.491 Potri.015G069301.1.v4.1 564 367.661 0 0 Potri.010G195200.1.v4.1 1773 1576.46 5 0.129243 Potri.012G127500.1.v4.1 977 780.461 6333 330.657 ==> SRR9668895.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 22 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 303 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 46 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 16 SRR9668895 completed mapping pipeline successfully