Starting /dee2/code/volunteer_pipeline.sh SRR9668896 current disk space = 3051699236864 free memory = 1581899228 SRR9668896 SRAfilesize 776f786f42a607d918b48cddda7fcd97 SRR9668896.sra SRR9668896.sra file validated SRR9668896 is paired end SRR9668896 is conventional basespace SRR9668896 read1 length is 50-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668896_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.55075 32.0 32.0 32.0 32.0 32.0 2 31.56575 32.0 32.0 32.0 32.0 32.0 3 31.60675 32.0 32.0 32.0 32.0 32.0 4 31.66375 32.0 32.0 32.0 32.0 32.0 5 31.671 32.0 32.0 32.0 32.0 32.0 6 35.0925 36.0 36.0 36.0 36.0 36.0 7 35.32975 36.0 36.0 36.0 36.0 36.0 8 35.44525 36.0 36.0 36.0 36.0 36.0 9 35.41275 36.0 36.0 36.0 36.0 36.0 10-11 35.31525 36.0 36.0 36.0 36.0 36.0 12-13 35.402125 36.0 36.0 36.0 36.0 36.0 14-15 35.276624999999996 36.0 36.0 36.0 36.0 36.0 16-17 35.305875 36.0 36.0 36.0 36.0 36.0 18-19 35.33325 36.0 36.0 36.0 36.0 36.0 20-21 35.340374999999995 36.0 36.0 36.0 36.0 36.0 22-23 35.302875 36.0 36.0 36.0 36.0 36.0 24-25 35.237875 36.0 36.0 36.0 36.0 36.0 26-27 35.286249999999995 36.0 36.0 36.0 36.0 36.0 28-29 35.192625 36.0 36.0 36.0 36.0 36.0 30-31 35.235625 36.0 36.0 36.0 36.0 36.0 32-33 35.21425 36.0 36.0 36.0 36.0 36.0 34-35 35.199125 36.0 36.0 36.0 36.0 36.0 36-37 35.131125 36.0 36.0 36.0 36.0 36.0 38-39 35.110749999999996 36.0 36.0 36.0 36.0 36.0 40-41 35.071625 36.0 36.0 36.0 36.0 36.0 42-43 35.158375 36.0 36.0 36.0 36.0 36.0 44-45 35.052125000000004 36.0 36.0 36.0 36.0 36.0 46-47 35.139625 36.0 36.0 36.0 36.0 36.0 48-49 35.02975 36.0 36.0 36.0 36.0 36.0 50-51 35.18840081895474 36.0 36.0 36.0 36.0 36.0 52-53 35.068767191797946 36.0 36.0 36.0 36.0 36.0 54-55 35.055638909727435 36.0 36.0 36.0 36.0 36.0 56-57 35.07326831707927 36.0 36.0 36.0 36.0 36.0 58-59 34.873968492123026 36.0 36.0 36.0 36.0 36.0 60-61 34.93010752688172 36.0 36.0 36.0 36.0 36.0 62-63 34.90258126062281 36.0 36.0 36.0 34.0 36.0 64-65 34.909954977488745 36.0 36.0 36.0 36.0 36.0 66-67 34.82403701850926 36.0 36.0 36.0 36.0 36.0 68-69 34.869668947558594 36.0 36.0 36.0 36.0 36.0 70-71 34.826658322903626 36.0 36.0 36.0 32.0 36.0 72-73 34.696019527181306 36.0 36.0 36.0 32.0 36.0 74-75 34.66585137222075 36.0 36.0 36.0 32.0 36.0 76 34.23497895139686 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 0.0 22 0.0 23 2.0 24 5.0 25 4.0 26 11.0 27 27.0 28 40.0 29 44.0 30 57.0 31 88.0 32 117.0 33 193.0 34 395.0 35 3015.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.324999999999996 12.5 9.5 39.675 2 22.675 16.35 38.45 22.525000000000002 3 18.475 20.8 25.25 35.475 4 22.85 28.775000000000002 22.650000000000002 25.724999999999998 5 22.650000000000002 33.475 24.6 19.275000000000002 6 19.581125410042898 33.96416855917234 26.8483472117083 19.60635881907646 7 15.125 22.8 41.975 20.1 8 18.75 24.15 32.1 25.0 9 17.025000000000002 22.875 33.900000000000006 26.200000000000003 10-11 21.3125 31.7625 23.6625 23.2625 12-13 22.0 24.275 27.875 25.85 14-15 20.474999999999998 25.55 29.15 24.825 16-17 20.325 27.650000000000002 27.675 24.349999999999998 18-19 21.45 27.5875 26.9625 24.0 20-21 21.4125 26.237500000000004 27.712500000000002 24.637500000000003 22-23 21.05 28.050000000000004 26.687499999999996 24.212500000000002 24-25 20.9875 27.175 26.6125 25.224999999999998 26-27 21.637500000000003 27.85 26.887499999999996 23.625 28-29 20.8 27.700000000000003 27.212500000000002 24.2875 30-31 21.1375 26.1625 27.575 25.124999999999996 32-33 20.962500000000002 27.500000000000004 27.200000000000003 24.337500000000002 34-35 21.4875 27.900000000000002 27.224999999999998 23.3875 36-37 20.7875 27.825 26.4625 24.925 38-39 21.775 27.462500000000002 26.4625 24.3 40-41 20.6875 28.812500000000004 26.6 23.9 42-43 21.349999999999998 27.625 26.0125 25.0125 44-45 21.725 27.400000000000002 26.387500000000003 24.4875 46-47 22.15 26.974999999999998 27.6375 23.2375 48-49 22.525000000000002 26.525 26.775 24.175 50-51 20.60257532191524 27.015876984623077 27.303412926615827 25.078134766845857 52-53 22.13053263315829 28.394598649662417 25.668917229307326 23.80595148787197 54-55 21.75543885971493 27.656914228557138 26.481620405101275 24.10602650662666 56-57 20.38009502375594 26.331582895723933 28.26956739184796 25.018754688672168 58-59 21.29282320580145 26.831707926981746 27.231807951987996 24.643660915228807 60-61 21.417854463615903 27.544386096524132 26.731682920730183 24.306076519129782 62-63 21.970739027135174 27.710391396773794 26.28485682130799 24.034012754783042 64-65 22.198599299649825 27.301150575287643 26.075537768884445 24.424712356178087 66-67 21.335667833916958 27.938969484742373 26.525762881440716 24.19959979989995 68-69 21.025641025641026 27.10444027517198 27.30456535334584 24.56535334584115 70-71 20.613266583229038 28.423028785982478 26.7459324155194 24.217772215269086 72-73 21.4321608040201 27.010050251256278 26.90954773869347 24.64824120603015 74-75 21.518310612135792 23.910719059075113 29.230152365677625 25.340817963111466 76 22.770761576731726 0.0 40.87256027554535 36.356678147722924 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 1.0 21 2.5 22 2.5 23 1.5 24 0.5 25 2.0 26 3.0 27 6.5 28 19.0 29 25.0 30 24.0 31 35.5 32 47.5 33 48.5 34 64.0 35 86.0 36 104.5 37 118.5 38 141.5 39 187.0 40 211.0 41 217.0 42 227.5 43 266.5 44 291.5 45 286.5 46 282.0 47 299.5 48 304.5 49 280.5 50 269.0 51 254.0 52 229.5 53 170.0 54 124.0 55 116.5 56 105.0 57 83.0 58 69.0 59 61.5 60 48.5 61 27.0 62 12.5 63 16.0 64 17.5 65 12.5 66 6.0 67 3.5 68 5.0 69 4.0 70 1.5 71 0.5 72 1.0 73 1.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.9249999999999999 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50 1.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 2.0 70 0.0 71 4.0 72 22.0 73 98.0 74 260.0 75 998.0 76 2613.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.075 #Duplication Level Percentage of deduplicated Percentage of total 1 98.39408615855213 96.5 2 1.3510068824878918 2.65 3 0.15294417537598778 0.44999999999999996 4 0.10196278358399186 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668896 read2 length is 61-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668896_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 61-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.26075 32.0 32.0 32.0 32.0 32.0 2 31.1375 32.0 32.0 32.0 32.0 32.0 3 31.22775 32.0 32.0 32.0 32.0 32.0 4 31.108 32.0 32.0 32.0 32.0 32.0 5 31.224 32.0 32.0 32.0 32.0 32.0 6 34.72625 36.0 36.0 36.0 32.0 36.0 7 34.66825 36.0 36.0 36.0 32.0 36.0 8 34.763 36.0 36.0 36.0 36.0 36.0 9 34.69025 36.0 36.0 36.0 32.0 36.0 10-11 34.613 36.0 36.0 36.0 32.0 36.0 12-13 34.76675 36.0 36.0 36.0 34.0 36.0 14-15 34.678625 36.0 36.0 36.0 32.0 36.0 16-17 34.577875 36.0 36.0 36.0 32.0 36.0 18-19 34.624875 36.0 36.0 36.0 32.0 36.0 20-21 34.554249999999996 36.0 36.0 36.0 32.0 36.0 22-23 34.453625 36.0 36.0 36.0 32.0 36.0 24-25 34.534125 36.0 36.0 36.0 32.0 36.0 26-27 34.419624999999996 36.0 36.0 36.0 32.0 36.0 28-29 34.404624999999996 36.0 36.0 36.0 32.0 36.0 30-31 34.478625 36.0 36.0 36.0 32.0 36.0 32-33 34.37375 36.0 36.0 36.0 32.0 36.0 34-35 34.380625 36.0 36.0 36.0 32.0 36.0 36-37 34.364625000000004 36.0 36.0 36.0 32.0 36.0 38-39 34.333375000000004 36.0 36.0 36.0 32.0 36.0 40-41 34.26575 36.0 36.0 36.0 32.0 36.0 42-43 34.297375 36.0 36.0 36.0 32.0 36.0 44-45 34.01425 36.0 36.0 36.0 29.5 36.0 46-47 34.076 36.0 36.0 36.0 32.0 36.0 48-49 34.1625 36.0 36.0 36.0 32.0 36.0 50-51 34.0265 36.0 36.0 36.0 32.0 36.0 52-53 34.084375 36.0 36.0 36.0 32.0 36.0 54-55 33.991749999999996 36.0 36.0 36.0 32.0 36.0 56-57 33.99487499999999 36.0 36.0 36.0 32.0 36.0 58-59 33.883375 36.0 36.0 36.0 32.0 36.0 60-61 34.0355 36.0 36.0 36.0 32.0 36.0 62-63 33.79527021485168 36.0 36.0 36.0 29.5 36.0 64-65 33.70427820865649 36.0 36.0 36.0 29.5 36.0 66-67 33.71115836877658 36.0 36.0 36.0 27.0 36.0 68-69 33.693854474940295 36.0 36.0 36.0 27.0 36.0 70-71 33.667376064096146 36.0 36.0 36.0 27.0 36.0 72-73 33.677877558394 36.0 36.0 36.0 27.0 36.0 74-75 33.62640207170643 36.0 36.0 36.0 27.0 36.0 76 32.74311926605505 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 2.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 3.0 15 8.0 16 7.0 17 8.0 18 10.0 19 2.0 20 11.0 21 15.0 22 13.0 23 18.0 24 17.0 25 22.0 26 36.0 27 49.0 28 58.0 29 69.0 30 67.0 31 132.0 32 172.0 33 299.0 34 613.0 35 2369.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.50162621966475 22.61696272204153 12.15911933950463 29.72229171878909 2 27.325 27.025 31.7 13.950000000000001 3 22.775000000000002 27.025 29.475 20.724999999999998 4 24.375 33.425 21.099999999999998 21.099999999999998 5 26.724999999999998 35.449999999999996 20.275000000000002 17.549999999999997 6 21.45 35.175 23.95 19.425 7 21.224999999999998 18.7 37.075 23.0 8 22.98649324662331 23.736868434217108 27.688844422211105 25.587793896948476 9 23.51175587793897 24.712356178089045 28.414207103551774 23.36168084042021 10-11 24.862431215607803 30.71535767883942 22.63631815907954 21.785892946473236 12-13 24.987493746873437 24.912456228114056 26.088044022011005 24.012006003001503 14-15 23.461730865432717 27.826413206603302 27.33866933466733 21.373186593296648 16-17 25.387693846923458 27.01350675337669 26.088044022011005 21.510755377688845 18-19 24.312156078039017 27.60130065032516 26.600800400200097 21.48574287143572 20-21 24.537268634317158 27.60130065032516 26.000500250125064 21.860930465232617 22-23 24.84992496248124 28.114057028514257 26.038019009504755 20.99799899949975 24-25 23.836918459229615 27.56378189094547 26.563281640820406 22.0360180090045 26-27 24.64982491245623 27.288644322161083 26.25062531265633 21.810905452726363 28-29 24.262131065532767 28.68934467233617 25.700350175087543 21.34817408704352 30-31 23.149074537268636 28.53926963481741 26.21310655327664 22.098549274637318 32-33 24.474737368684345 27.801400700350175 26.17558779389695 21.548274137068535 34-35 24.64982491245623 27.901450725362682 25.78789394697349 21.660830415207606 36-37 24.64982491245623 26.43821910955478 26.138069034517258 22.773886943471737 38-39 24.087043521760883 28.23911955977989 25.975487743871934 21.698349174587296 40-41 24.224612306153077 27.876438219109556 25.83791895947974 22.061030515257627 42-43 23.574287143571787 27.5887943971986 25.850425212606304 22.98649324662331 44-45 23.961980990495245 28.026513256628316 26.3631815907954 21.64832416208104 46-47 24.73736868434217 26.92596298149075 26.488244122061033 21.848424212106053 48-49 24.337168584292147 27.4512256128064 26.95097548774387 21.260630315157577 50-51 24.77488744372186 28.214107053526767 25.71285642821411 21.298149074537267 52-53 24.874937468734366 27.276138069034516 26.3631815907954 21.48574287143572 54-55 23.974487243621812 27.4512256128064 26.43821910955478 22.136068034017008 56-57 23.949474737368686 27.176088044022013 26.375687843921963 22.498749374687343 58-59 25.3751875937969 27.138569284642323 26.550775387693847 20.935467733866933 60-61 23.461730865432717 28.46423211605803 26.87593796898449 21.198099049524764 62-63 24.34934934934935 27.039539539539543 26.5015015015015 22.10960960960961 64-65 24.480600750938674 26.47058823529412 26.758448060075096 22.290362953692114 66-67 24.69336670838548 27.19649561952441 27.146433041301627 20.963704630788484 68-69 24.320941294279635 26.924521216672925 26.84941794968081 21.90511953936663 70-71 25.60120240480962 27.51753507014028 26.44038076152305 20.440881763527056 72-73 24.688718400201232 27.06577788957364 26.361463966796627 21.8840397434285 74-75 24.14806895630095 22.958706401176 29.146064412668714 23.747160229854337 76 27.429227237949505 0.0 39.6327467482785 32.938026013771996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 2.0 23 3.0 24 3.0 25 2.5 26 2.0 27 7.0 28 10.5 29 10.0 30 13.0 31 24.0 32 34.0 33 41.0 34 57.0 35 89.0 36 114.0 37 121.0 38 138.0 39 173.5 40 209.5 41 238.5 42 254.0 43 269.0 44 295.5 45 302.5 46 306.0 47 328.0 48 308.5 49 265.0 50 232.0 51 217.0 52 203.0 53 166.0 54 147.5 55 131.5 56 110.0 57 90.5 58 76.5 59 62.0 60 47.0 61 33.0 62 22.5 63 20.0 64 12.5 65 5.5 66 2.5 67 3.5 68 4.0 69 2.5 70 1.0 71 0.0 72 1.5 73 3.0 74 1.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 1.5 96 3.0 97 1.5 98 0.0 99 6.5 100 13.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.05 9 0.05 10-11 0.05 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.05 24-25 0.05 26-27 0.05 28-29 0.05 30-31 0.05 32-33 0.05 34-35 0.05 36-37 0.05 38-39 0.05 40-41 0.05 42-43 0.05 44-45 0.05 46-47 0.05 48-49 0.05 50-51 0.05 52-53 0.05 54-55 0.05 56-57 0.05 58-59 0.05 60-61 0.05 62-63 0.05002501250625312 64-65 0.05003752814610958 66-67 0.05003752814610958 68-69 0.050043788314775434 70-71 0.050075112669003496 72-73 0.0502828409805154 74-75 0.053425938293041264 76 0.0764525993883792 >>END_MODULE >>Sequence Length Distribution warn #Length Count 61 1.0 62 2.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 2.0 70 0.0 71 5.0 72 23.0 73 76.0 74 293.0 75 981.0 76 2616.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 98.62525458248473 96.85000000000001 2 1.2219959266802443 2.4 3 0.07637474541751527 0.22499999999999998 4 0.05091649694501018 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02545824847250509 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1208144 spots for SRR9668896.sra Written 1208144 spots for SRR9668896.sra Read 1208144 spots for SRR9668896.sra Written 1208144 spots for SRR9668896.sra Read 1208144 spots for SRR9668896.sra Written 1208144 spots for SRR9668896.sra Read 1208144 spots for SRR9668896.sra Written 1208144 spots for SRR9668896.sra Read 1208144 spots for SRR9668896.sra Written 1208144 spots for SRR9668896.sra Read 1208144 spots for SRR9668896.sra Written 1208144 spots for SRR9668896.sra Read 1208144 spots for SRR9668896.sra Written 1208144 spots for SRR9668896.sra Read 1208144 spots for SRR9668896.sra Written 1208144 spots for SRR9668896.sra Read 1208144 spots for SRR9668896.sra Written 1208144 spots for SRR9668896.sra Read 1208144 spots for SRR9668896.sra Written 1208144 spots for SRR9668896.sra Read 1208144 spots for SRR9668896.sra Written 1208144 spots for SRR9668896.sra Read 1208144 spots for SRR9668896.sra Written 1208144 spots for SRR9668896.sra Read 1208144 spots for SRR9668896.sra Written 1208144 spots for SRR9668896.sra Read 1208144 spots for SRR9668896.sra Written 1208144 spots for SRR9668896.sra Read 1208144 spots for SRR9668896.sra Written 1208144 spots for SRR9668896.sra Read 1208160 spots for SRR9668896.sra Written 1208160 spots for SRR9668896.sra Read 1208144 spots for SRR9668896.sra Written 1208144 spots for SRR9668896.sra Read 1208144 spots for SRR9668896.sra Written 1208144 spots for SRR9668896.sra Read 1208144 spots for SRR9668896.sra Written 1208144 spots for SRR9668896.sra Read 1208144 spots for SRR9668896.sra Written 1208144 spots for SRR9668896.sra SRR ids: ['SRR9668896.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_am1kw6r7 SRR9668896.sra spots: 24162896 blocks: [[1, 1208144], [1208145, 2416288], [2416289, 3624432], [3624433, 4832576], [4832577, 6040720], [6040721, 7248864], [7248865, 8457008], [8457009, 9665152], [9665153, 10873296], [10873297, 12081440], [12081441, 13289584], [13289585, 14497728], [14497729, 15705872], [15705873, 16914016], [16914017, 18122160], [18122161, 19330304], [19330305, 20538448], [20538449, 21746592], [21746593, 22954736], [22954737, 24162896]] SRR9668896 file size 4579543 SRR9668896 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668896 SRR9668896_1.fastq SRR9668896_2.fastq Input file: SRR9668896_1.fastq Paired file: SRR9668896_2.fastq trimmed: SRR9668896-trimmed-pair1.fastq, SRR9668896-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:43:37 2025 >> started Wed Feb 12 15:43:59 2025 >> done (21.609s) 24162896 read pairs processed; of these: 3460 ( 0.01%) short read pairs filtered out after trimming by size control 13261 ( 0.05%) empty read pairs filtered out after trimming by size control 24146175 (99.93%) read pairs available; of these: 12808 ( 0.05%) trimmed read pairs available after processing 24133367 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 22 7 0.00% 23 11 0.00% 24 8 0.00% 25 19 0.00% 26 14 0.00% 27 14 0.00% 28 21 0.00% 29 27 0.00% 30 18 0.00% 31 22 0.00% 32 16 0.00% 33 24 0.00% 34 38 0.00% 35 228 0.00% 36 210 0.00% 37 224 0.00% 38 234 0.00% 39 243 0.00% 40 274 0.00% 41 249 0.00% 42 311 0.00% 43 327 0.00% 44 365 0.00% 45 367 0.00% 46 313 0.00% 47 360 0.00% 48 417 0.00% 49 467 0.00% 50 535 0.00% 51 555 0.00% 52 546 0.00% 53 586 0.00% 54 599 0.00% 55 941 0.00% 56 904 0.00% 57 1060 0.00% 58 1255 0.01% 59 1542 0.01% 60 1827 0.01% 61 1748 0.01% 62 2019 0.01% 63 1937 0.01% 64 2300 0.01% 65 2516 0.01% 66 2512 0.01% 67 2985 0.01% 68 2635 0.01% 69 3065 0.01% 70 3814 0.02% 71 5304 0.02% 72 18186 0.08% 73 212598 0.88% 74 2003686 8.30% 75 11693188 48.43% 76 10172504 42.13% 24146175 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=28 prefix-density=0.66 prefix-fanout=2.2 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=48.87 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.1 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCATAAGGGAAGGACATGAGGCCCTTAATTCCACCACAGGCGCTGTGTCCAATGACCACAATGTATT criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=28 prefix-density=0.44 prefix-fanout=2.1 sequence=CCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=14.72 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.3 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR9668896 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:44:27 Started mapping on | Feb 12 15:44:27 Finished on | Feb 12 15:45:32 Mapping speed, Million of reads per hour | 1337.33 Number of input reads | 24146175 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 21338863 Uniquely mapped reads % | 88.37% Average mapped length | 150.45 Number of splices: Total | 9584435 Number of splices: Annotated (sjdb) | 9479990 Number of splices: GT/AG | 9403659 Number of splices: GC/AG | 155968 Number of splices: AT/AC | 6357 Number of splices: Non-canonical | 18451 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.01% Insertion average length | 1.92 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 968434 % of reads mapped to multiple loci | 4.01% Number of reads mapped to too many loci | 755525 % of reads mapped to too many loci | 3.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.38% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1839138 1839138 1839138 N_multimapping 968434 968434 968434 N_noFeature 558550 21079089 629592 N_ambiguous 311670 887 122254 UnstrandedReadsAssigned:20468643 PositiveStrandReadsAssigned:258887 NegativeStrandReadsAssigned:20587017 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668896 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668896-trimmed-pair1.fastq SRR9668896-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,146,175 reads, 21,727,321 reads pseudoaligned [quant] estimated average fragment length: 196.772 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52401 SRR9668896.ke.tsv 34699 SRR9668896.se.tsv 87100 total ==> SRR9668896.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1822.23 363 7.85053 Potri.005G024800.1.v4.1 1035 839.228 101 4.74282 Potri.004G059700.1.v4.1 961 765.228 56 2.88398 Potri.007G009000.2.v4.1 1416 1220.23 0 0 Potri.003G141000.2.v4.1 2943 2747.23 314 4.50433 Potri.016G087400.1.v4.1 270 91.3294 1433.14 618.405 Potri.015G069301.1.v4.1 564 368.381 0 0 Potri.010G195200.1.v4.1 1773 1577.23 4 0.0999449 Potri.012G127500.1.v4.1 977 781.228 4504 227.204 ==> SRR9668896.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 19 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 313 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 44 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR9668896 completed mapping pipeline successfully