Starting /dee2/code/volunteer_pipeline.sh SRR9668897 current disk space = 3051763191808 free memory = 1410721136 SRR9668897 SRAfilesize bb396e842ff7ef8ab5a0f6c4f1b81957 SRR9668897.sra SRR9668897.sra file validated SRR9668897 is paired end SRR9668897 is conventional basespace SRR9668897 read1 length is 51-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668897_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.51 32.0 32.0 32.0 32.0 32.0 2 31.5715 32.0 32.0 32.0 32.0 32.0 3 31.62125 32.0 32.0 32.0 32.0 32.0 4 31.62575 32.0 32.0 32.0 32.0 32.0 5 31.67125 32.0 32.0 32.0 32.0 32.0 6 35.00125 36.0 36.0 36.0 36.0 36.0 7 35.36475 36.0 36.0 36.0 36.0 36.0 8 35.4185 36.0 36.0 36.0 36.0 36.0 9 35.345 36.0 36.0 36.0 36.0 36.0 10-11 35.292625 36.0 36.0 36.0 36.0 36.0 12-13 35.336875 36.0 36.0 36.0 36.0 36.0 14-15 35.289249999999996 36.0 36.0 36.0 36.0 36.0 16-17 35.34 36.0 36.0 36.0 36.0 36.0 18-19 35.292375 36.0 36.0 36.0 36.0 36.0 20-21 35.266999999999996 36.0 36.0 36.0 36.0 36.0 22-23 35.366749999999996 36.0 36.0 36.0 36.0 36.0 24-25 35.292874999999995 36.0 36.0 36.0 36.0 36.0 26-27 35.255750000000006 36.0 36.0 36.0 36.0 36.0 28-29 35.249125 36.0 36.0 36.0 36.0 36.0 30-31 35.240625 36.0 36.0 36.0 36.0 36.0 32-33 35.2765 36.0 36.0 36.0 36.0 36.0 34-35 35.201 36.0 36.0 36.0 36.0 36.0 36-37 35.048875 36.0 36.0 36.0 36.0 36.0 38-39 35.184375 36.0 36.0 36.0 36.0 36.0 40-41 35.108000000000004 36.0 36.0 36.0 36.0 36.0 42-43 35.14575 36.0 36.0 36.0 36.0 36.0 44-45 35.039 36.0 36.0 36.0 36.0 36.0 46-47 35.0805 36.0 36.0 36.0 36.0 36.0 48-49 34.84325 36.0 36.0 36.0 36.0 36.0 50-51 35.081 36.0 36.0 36.0 36.0 36.0 52-53 35.03226613306653 36.0 36.0 36.0 36.0 36.0 54-55 34.91645822911455 36.0 36.0 36.0 36.0 36.0 56-57 35.02238619309655 36.0 36.0 36.0 36.0 36.0 58-59 34.83729364682341 36.0 36.0 36.0 34.0 36.0 60-61 34.866808404202104 36.0 36.0 36.0 36.0 36.0 62-63 34.948099049524764 36.0 36.0 36.0 36.0 36.0 64-65 34.88556778389194 36.0 36.0 36.0 36.0 36.0 66-67 34.91258129064532 36.0 36.0 36.0 36.0 36.0 68-69 34.819284642321165 36.0 36.0 36.0 36.0 36.0 70-71 34.73599299649825 36.0 36.0 36.0 32.0 36.0 72-73 34.713708187800144 36.0 36.0 36.0 32.0 36.0 74-75 34.527953905672454 36.0 36.0 36.0 32.0 36.0 76 34.47171989226626 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 1.0 24 5.0 25 10.0 26 15.0 27 22.0 28 35.0 29 47.0 30 79.0 31 85.0 32 110.0 33 178.0 34 421.0 35 2990.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.725 12.2 9.675 41.4 2 21.5 16.05 39.550000000000004 22.900000000000002 3 19.075 19.975 25.900000000000002 35.05 4 23.25 28.975 22.225 25.55 5 23.125 32.15 24.349999999999998 20.375 6 18.702675416456334 36.57243816254417 24.381625441696116 20.34326097930338 7 14.85 24.325 42.475 18.35 8 18.95 22.7 32.45 25.900000000000002 9 17.575 24.15 33.6 24.675 10-11 21.637500000000003 32.324999999999996 23.8625 22.175 12-13 20.5875 25.6125 28.050000000000004 25.75 14-15 20.3375 27.375 27.05 25.2375 16-17 20.7375 28.5625 27.1 23.599999999999998 18-19 21.0375 27.3625 27.6375 23.962500000000002 20-21 21.212500000000002 27.250000000000004 26.55 24.9875 22-23 20.837500000000002 28.6375 27.762500000000003 22.7625 24-25 20.1125 28.4 26.6625 24.825 26-27 21.25 28.225 26.150000000000002 24.375 28-29 20.525 28.6875 26.687499999999996 24.099999999999998 30-31 20.45 28.1125 26.6625 24.775 32-33 21.224999999999998 27.962500000000002 26.8 24.0125 34-35 21.587500000000002 27.275 27.125 24.0125 36-37 20.8625 29.375 25.424999999999997 24.337500000000002 38-39 21.587500000000002 28.1 26.3625 23.95 40-41 20.974999999999998 28.225 26.8375 23.962500000000002 42-43 20.8875 27.4125 26.887499999999996 24.8125 44-45 20.6875 27.8875 26.9125 24.5125 46-47 20.95 27.750000000000004 27.1 24.2 48-49 21.4 28.125 26.487500000000004 23.9875 50-51 20.6875 28.525 27.175 23.6125 52-53 21.223111555777887 27.351175587793897 26.80090045022511 24.6248124062031 54-55 20.72286143071536 27.56378189094547 26.700850425212607 25.012506253126567 56-57 21.673336668334166 27.75137568784392 26.425712856428213 24.149574787393696 58-59 21.61080540270135 28.189094547273637 26.18809404702351 24.012006003001503 60-61 20.185092546273136 28.451725862931465 26.388194097048522 24.974987493746873 62-63 20.635317658829415 27.201100550275136 28.001500750375186 24.16208104052026 64-65 22.198599299649825 27.70135067533767 26.038019009504755 24.062031015507753 66-67 20.572786393196598 27.988994497248626 26.525762881440716 24.912456228114056 68-69 21.1855927963982 27.41370685342671 26.88844422211106 24.512256128064035 70-71 21.59829914957479 27.07603801900951 26.700850425212607 24.6248124062031 72-73 21.60331200602183 27.81332329695145 26.947685359427926 23.635679337598795 74-75 21.644562334217508 23.819628647214856 28.965517241379313 25.57029177718833 76 23.624470950365524 0.0 39.36129280492497 37.0142362447095 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.5 23 1.5 24 4.0 25 5.5 26 8.0 27 13.5 28 17.0 29 16.5 30 24.0 31 42.0 32 49.0 33 46.0 34 63.0 35 83.0 36 105.0 37 132.5 38 161.0 39 191.0 40 203.0 41 224.0 42 253.5 43 279.0 44 291.5 45 314.0 46 330.0 47 319.5 48 322.5 49 293.0 50 247.0 51 222.0 52 193.0 53 155.5 54 135.0 55 125.0 56 104.0 57 76.5 58 58.5 59 54.5 60 47.5 61 37.5 62 27.0 63 15.5 64 9.0 65 9.0 66 5.5 67 3.5 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.95 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 51 2.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 3.0 72 19.0 73 84.0 74 244.0 75 1049.0 76 2599.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80831643002028 97.425 2 1.0141987829614605 2.0 3 0.15212981744421905 0.44999999999999996 4 0.0 0.0 5 0.02535496957403651 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668897 read2 length is 44-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668897_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 44-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.351 32.0 32.0 32.0 32.0 32.0 2 31.16175 32.0 32.0 32.0 32.0 32.0 3 31.239 32.0 32.0 32.0 32.0 32.0 4 31.18825 32.0 32.0 32.0 32.0 32.0 5 31.2165 32.0 32.0 32.0 32.0 32.0 6 34.623 36.0 36.0 36.0 32.0 36.0 7 34.6965 36.0 36.0 36.0 32.0 36.0 8 34.7955 36.0 36.0 36.0 32.0 36.0 9 34.76075 36.0 36.0 36.0 32.0 36.0 10-11 34.641375 36.0 36.0 36.0 32.0 36.0 12-13 34.723875 36.0 36.0 36.0 34.0 36.0 14-15 34.67975 36.0 36.0 36.0 32.0 36.0 16-17 34.6185 36.0 36.0 36.0 32.0 36.0 18-19 34.631875 36.0 36.0 36.0 32.0 36.0 20-21 34.5835 36.0 36.0 36.0 32.0 36.0 22-23 34.644499999999994 36.0 36.0 36.0 32.0 36.0 24-25 34.56175 36.0 36.0 36.0 32.0 36.0 26-27 34.490750000000006 36.0 36.0 36.0 32.0 36.0 28-29 34.499875 36.0 36.0 36.0 32.0 36.0 30-31 34.536125 36.0 36.0 36.0 32.0 36.0 32-33 34.512125 36.0 36.0 36.0 32.0 36.0 34-35 34.380250000000004 36.0 36.0 36.0 32.0 36.0 36-37 34.39375 36.0 36.0 36.0 32.0 36.0 38-39 34.278125 36.0 36.0 36.0 32.0 36.0 40-41 34.309625 36.0 36.0 36.0 32.0 36.0 42-43 34.377875 36.0 36.0 36.0 32.0 36.0 44-45 34.276654851212804 36.0 36.0 36.0 32.0 36.0 46-47 34.19254813703426 36.0 36.0 36.0 32.0 36.0 48-49 34.26656664166042 36.0 36.0 36.0 32.0 36.0 50-51 34.166041510377596 36.0 36.0 36.0 32.0 36.0 52-53 34.04177717246894 36.0 36.0 36.0 32.0 36.0 54-55 34.03841341341341 36.0 36.0 36.0 32.0 36.0 56-57 34.0447947947948 36.0 36.0 36.0 32.0 36.0 58-59 33.9354375031015 36.0 36.0 36.0 32.0 36.0 60-61 34.009263895843766 36.0 36.0 36.0 32.0 36.0 62-63 33.93440160240361 36.0 36.0 36.0 32.0 36.0 64-65 33.7586379569354 36.0 36.0 36.0 29.5 36.0 66-67 33.80070105157736 36.0 36.0 36.0 27.0 36.0 68-69 33.79428107851735 36.0 36.0 36.0 27.0 36.0 70-71 33.914725770097675 36.0 36.0 36.0 32.0 36.0 72-73 33.833788692246145 36.0 36.0 36.0 29.5 36.0 74-75 33.77183446172339 36.0 36.0 36.0 27.0 36.0 76 32.89431206764028 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 12.0 16 9.0 17 9.0 18 6.0 19 7.0 20 3.0 21 6.0 22 11.0 23 15.0 24 21.0 25 26.0 26 33.0 27 48.0 28 54.0 29 81.0 30 86.0 31 103.0 32 175.0 33 244.0 34 596.0 35 2452.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.892446223111556 20.110055027513756 13.981990995497748 31.015507753876935 2 28.050000000000004 26.0 31.4 14.549999999999999 3 22.375 28.15 27.650000000000002 21.825 4 23.974999999999998 33.875 21.8 20.349999999999998 5 26.6 35.8 20.825 16.775000000000002 6 21.224999999999998 37.425000000000004 22.3 19.05 7 22.05 18.475 38.375 21.099999999999998 8 22.125 23.599999999999998 27.875 26.400000000000002 9 22.5 23.7 29.275000000000002 24.525 10-11 24.6125 31.387500000000003 22.1875 21.8125 12-13 24.224999999999998 25.4875 26.150000000000002 24.1375 14-15 23.6125 27.1125 27.525 21.75 16-17 24.725 26.8 26.174999999999997 22.3 18-19 23.4375 28.1375 26.137500000000003 22.287499999999998 20-21 24.6875 28.1875 26.375 20.75 22-23 24.962500000000002 26.974999999999998 26.674999999999997 21.3875 24-25 24.0125 26.75 27.4125 21.825 26-27 24.0625 28.262500000000003 25.5125 22.162499999999998 28-29 24.5 27.525 26.3 21.675 30-31 24.887500000000003 27.125 26.2125 21.775 32-33 24.5125 28.425 25.837500000000002 21.224999999999998 34-35 24.3125 27.250000000000004 26.224999999999998 22.2125 36-37 24.224999999999998 26.887499999999996 27.287499999999998 21.6 38-39 24.15 27.224999999999998 27.05 21.575 40-41 24.0 27.3625 27.500000000000004 21.1375 42-43 24.2 27.675 26.2125 21.912499999999998 44-45 23.47793474184273 27.54094261782723 27.00337542192774 21.9777472184023 46-47 25.1937984496124 26.756689172293076 26.38159539884971 21.66791697924481 48-49 23.968492123030757 28.294573643410853 26.70667666916729 21.030257564391096 50-51 24.781195298824706 27.481870467616904 26.456614153538382 21.280320080020005 52-53 24.86229344016024 27.378567851777667 26.02653980971457 21.732598898347522 54-55 23.71353449355202 29.235006886190057 26.217603605859523 20.8338550143984 56-57 24.217772215269086 27.183979974968707 27.033792240300375 21.564455569461828 58-59 24.129727022289003 27.523165539694467 27.42299023290759 20.924117205108942 60-61 24.473947895791586 26.603206412825653 26.991482965931862 21.9313627254509 62-63 24.210921843687373 27.980961923847698 26.465430861723448 21.34268537074148 64-65 24.812124248496996 27.15430861723447 26.61573146292585 21.417835671342687 66-67 24.724448897795593 26.791082164328657 27.730460921843687 20.754008016032063 68-69 24.552173368407868 26.330953275710883 27.18276337216585 21.934109983715395 70-71 25.068939583855602 26.560541489095012 26.81123088493357 21.559288042115817 72-73 24.61267162111097 26.46429021287316 27.245244993072177 21.677793172943698 74-75 24.448034464189554 24.676898222940228 27.36941303177167 23.505654281098547 76 26.0 0.0 40.42307692307692 33.57692307692307 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 1.0 13 1.0 14 0.5 15 0.5 16 1.0 17 1.0 18 0.5 19 0.5 20 1.0 21 0.5 22 0.5 23 1.5 24 1.5 25 2.5 26 5.0 27 5.5 28 6.5 29 9.5 30 16.5 31 24.5 32 32.0 33 39.0 34 55.5 35 85.5 36 101.5 37 105.5 38 134.5 39 190.0 40 226.5 41 253.5 42 286.0 43 297.5 44 308.5 45 319.0 46 325.5 47 337.0 48 323.0 49 278.5 50 241.5 51 216.0 52 192.0 53 157.5 54 128.5 55 113.5 56 99.5 57 77.5 58 59.5 59 53.0 60 36.5 61 22.0 62 15.0 63 10.0 64 8.0 65 8.5 66 3.5 67 0.5 68 3.5 69 3.0 70 1.0 71 1.5 72 1.0 73 1.5 74 1.5 75 1.0 76 1.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.5 95 1.0 96 1.0 97 1.0 98 1.0 99 11.5 100 22.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.06255473539346929 54-55 0.06256256256256257 56-57 0.025025025025025023 58-59 0.05006257822277847 60-61 0.050075112669003496 62-63 0.050075112669003496 64-65 0.050075112669003496 66-67 0.050075112669003496 68-69 0.05008138224615 70-71 0.10017530678687703 72-73 0.05035880649628604 74-75 0.05382131324004305 76 0.07686395080707148 >>END_MODULE >>Sequence Length Distribution warn #Length Count 44 1.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 2.0 52 1.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 2.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 0.0 70 0.0 71 5.0 72 33.0 73 92.0 74 294.0 75 967.0 76 2602.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.92966360856269 97.05 2 0.7900101936799184 1.55 3 0.20387359836901123 0.6 4 0.05096839959225281 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025484199796126403 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 24 0.6 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1190616 spots for SRR9668897.sra Written 1190616 spots for SRR9668897.sra Read 1190623 spots for SRR9668897.sra Written 1190623 spots for SRR9668897.sra Read 1190616 spots for SRR9668897.sra Written 1190616 spots for SRR9668897.sra Read 1190616 spots for SRR9668897.sra Written 1190616 spots for SRR9668897.sra Read 1190616 spots for SRR9668897.sra Written 1190616 spots for SRR9668897.sra Read 1190616 spots for SRR9668897.sra Written 1190616 spots for SRR9668897.sra Read 1190616 spots for SRR9668897.sra Written 1190616 spots for SRR9668897.sra Read 1190616 spots for SRR9668897.sra Written 1190616 spots for SRR9668897.sra Read 1190616 spots for SRR9668897.sra Written 1190616 spots for SRR9668897.sra Read 1190616 spots for SRR9668897.sra Written 1190616 spots for SRR9668897.sra Read 1190616 spots for SRR9668897.sra Written 1190616 spots for SRR9668897.sra Read 1190616 spots for SRR9668897.sra Written 1190616 spots for SRR9668897.sra Read 1190616 spots for SRR9668897.sra Written 1190616 spots for SRR9668897.sra Read 1190616 spots for SRR9668897.sra Written 1190616 spots for SRR9668897.sra Read 1190616 spots for SRR9668897.sra Written 1190616 spots for SRR9668897.sra Read 1190616 spots for SRR9668897.sra Written 1190616 spots for SRR9668897.sra Read 1190616 spots for SRR9668897.sra Written 1190616 spots for SRR9668897.sra Read 1190616 spots for SRR9668897.sra Written 1190616 spots for SRR9668897.sra Read 1190616 spots for SRR9668897.sra Written 1190616 spots for SRR9668897.sra Read 1190616 spots for SRR9668897.sra Written 1190616 spots for SRR9668897.sra SRR ids: ['SRR9668897.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u3v9dgd8 SRR9668897.sra spots: 23812327 blocks: [[1, 1190616], [1190617, 2381232], [2381233, 3571848], [3571849, 4762464], [4762465, 5953080], [5953081, 7143696], [7143697, 8334312], [8334313, 9524928], [9524929, 10715544], [10715545, 11906160], [11906161, 13096776], [13096777, 14287392], [14287393, 15478008], [15478009, 16668624], [16668625, 17859240], [17859241, 19049856], [19049857, 20240472], [20240473, 21431088], [21431089, 22621704], [22621705, 23812327]] SRR9668897 file size 4512711 SRR9668897 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668897 SRR9668897_1.fastq SRR9668897_2.fastq Input file: SRR9668897_1.fastq Paired file: SRR9668897_2.fastq trimmed: SRR9668897-trimmed-pair1.fastq, SRR9668897-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 14:51:34 2025 >> started Wed Feb 12 14:52:09 2025 >> done (35.534s) 23812327 read pairs processed; of these: 3503 ( 0.01%) short read pairs filtered out after trimming by size control 11276 ( 0.05%) empty read pairs filtered out after trimming by size control 23797548 (99.94%) read pairs available; of these: 12805 ( 0.05%) trimmed read pairs available after processing 23784743 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 5 0.00% 21 6 0.00% 22 11 0.00% 23 25 0.00% 24 38 0.00% 25 23 0.00% 26 33 0.00% 27 37 0.00% 28 34 0.00% 29 44 0.00% 30 40 0.00% 31 44 0.00% 32 40 0.00% 33 54 0.00% 34 57 0.00% 35 173 0.00% 36 226 0.00% 37 256 0.00% 38 285 0.00% 39 277 0.00% 40 323 0.00% 41 324 0.00% 42 323 0.00% 43 329 0.00% 44 359 0.00% 45 384 0.00% 46 297 0.00% 47 411 0.00% 48 418 0.00% 49 433 0.00% 50 521 0.00% 51 529 0.00% 52 565 0.00% 53 631 0.00% 54 641 0.00% 55 917 0.00% 56 1013 0.00% 57 1029 0.00% 58 1228 0.01% 59 1465 0.01% 60 1774 0.01% 61 1807 0.01% 62 1876 0.01% 63 1916 0.01% 64 2109 0.01% 65 2383 0.01% 66 2441 0.01% 67 2909 0.01% 68 2592 0.01% 69 2893 0.01% 70 3373 0.01% 71 4850 0.02% 72 17572 0.07% 73 213754 0.90% 74 1984396 8.34% 75 11536024 48.48% 76 10001028 42.03% 23797548 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=33 prefix-density=0.31 prefix-fanout=1.9 sequence=GTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=38.32 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.6 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCA criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=28 prefix-density=0.49 prefix-fanout=2.1 sequence=CCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGTCCCTAGCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=15.67 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.3 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR9668897 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 14:52:45 Started mapping on | Feb 12 14:52:45 Finished on | Feb 12 14:54:02 Mapping speed, Million of reads per hour | 1112.61 Number of input reads | 23797548 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 21692240 Uniquely mapped reads % | 91.15% Average mapped length | 150.48 Number of splices: Total | 9934961 Number of splices: Annotated (sjdb) | 9830915 Number of splices: GT/AG | 9751071 Number of splices: GC/AG | 159175 Number of splices: AT/AC | 6187 Number of splices: Non-canonical | 18528 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.02% Deletion average length | 2.14 Insertion rate per base | 0.01% Insertion average length | 1.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 924181 % of reads mapped to multiple loci | 3.88% Number of reads mapped to too many loci | 382198 % of reads mapped to too many loci | 1.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.30% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1181411 1181411 1181411 N_multimapping 924181 924181 924181 N_noFeature 359285 21449282 424287 N_ambiguous 305369 703 126920 UnstrandedReadsAssigned:21027586 PositiveStrandReadsAssigned:242255 NegativeStrandReadsAssigned:21141033 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668897 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668897-trimmed-pair1.fastq SRR9668897-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,797,548 reads, 21,985,233 reads pseudoaligned [quant] estimated average fragment length: 200.724 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52401 SRR9668897.ke.tsv 34699 SRR9668897.se.tsv 87100 total ==> SRR9668897.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1818.28 344 7.35515 Potri.005G024800.1.v4.1 1035 835.276 127 5.91108 Potri.004G059700.1.v4.1 961 761.276 62 3.16623 Potri.007G009000.2.v4.1 1416 1216.28 0 0 Potri.003G141000.2.v4.1 2943 2743.28 288 4.08147 Potri.016G087400.1.v4.1 270 87.4495 1772.97 788.2 Potri.015G069301.1.v4.1 564 364.347 0 0 Potri.010G195200.1.v4.1 1773 1573.28 5 0.123554 Potri.012G127500.1.v4.1 977 777.276 5463 273.243 ==> SRR9668897.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 18 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 292 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 45 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 20 SRR9668897 completed mapping pipeline successfully