Starting /dee2/code/volunteer_pipeline.sh SRR9668898 current disk space = 3051791949824 free memory = 1578409900 SRR9668898 SRAfilesize 59fd0f91a68a1ee60a59ca5687ac86e8 SRR9668898.sra SRR9668898.sra file validated SRR9668898 is paired end SRR9668898 is conventional basespace SRR9668898 read1 length is 49-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668898_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 49-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.48625 32.0 32.0 32.0 32.0 32.0 2 31.5885 32.0 32.0 32.0 32.0 32.0 3 31.52575 32.0 32.0 32.0 32.0 32.0 4 31.628 32.0 32.0 32.0 32.0 32.0 5 31.631 32.0 32.0 32.0 32.0 32.0 6 34.9145 36.0 36.0 36.0 36.0 36.0 7 35.276 36.0 36.0 36.0 36.0 36.0 8 35.2985 36.0 36.0 36.0 36.0 36.0 9 35.33075 36.0 36.0 36.0 36.0 36.0 10-11 35.309749999999994 36.0 36.0 36.0 36.0 36.0 12-13 35.313874999999996 36.0 36.0 36.0 36.0 36.0 14-15 35.262 36.0 36.0 36.0 36.0 36.0 16-17 35.232124999999996 36.0 36.0 36.0 36.0 36.0 18-19 35.2415 36.0 36.0 36.0 36.0 36.0 20-21 35.23375 36.0 36.0 36.0 36.0 36.0 22-23 35.324875000000006 36.0 36.0 36.0 36.0 36.0 24-25 35.1785 36.0 36.0 36.0 36.0 36.0 26-27 35.058 36.0 36.0 36.0 36.0 36.0 28-29 35.188500000000005 36.0 36.0 36.0 36.0 36.0 30-31 35.19175 36.0 36.0 36.0 36.0 36.0 32-33 35.128125 36.0 36.0 36.0 36.0 36.0 34-35 35.032 36.0 36.0 36.0 36.0 36.0 36-37 35.0005 36.0 36.0 36.0 36.0 36.0 38-39 35.1025 36.0 36.0 36.0 36.0 36.0 40-41 35.122875 36.0 36.0 36.0 36.0 36.0 42-43 34.995374999999996 36.0 36.0 36.0 36.0 36.0 44-45 35.056375 36.0 36.0 36.0 36.0 36.0 46-47 35.10425 36.0 36.0 36.0 36.0 36.0 48-49 34.8865 36.0 36.0 36.0 36.0 36.0 50-51 35.043635908977244 36.0 36.0 36.0 36.0 36.0 52-53 35.01412918887551 36.0 36.0 36.0 36.0 36.0 54-55 34.908829414707355 36.0 36.0 36.0 36.0 36.0 56-57 34.89507253626813 36.0 36.0 36.0 36.0 36.0 58-59 34.816158079039525 36.0 36.0 36.0 34.0 36.0 60-61 34.85166541864878 36.0 36.0 36.0 36.0 36.0 62-63 34.79472104078059 36.0 36.0 36.0 34.0 36.0 64-65 34.763882830771394 36.0 36.0 36.0 36.0 36.0 66-67 34.802453680520784 36.0 36.0 36.0 36.0 36.0 68-69 34.866660622037486 36.0 36.0 36.0 36.0 36.0 70-71 34.64349680945454 36.0 36.0 36.0 32.0 36.0 72-73 34.642380593168326 36.0 36.0 36.0 32.0 36.0 74-75 34.567161848218895 36.0 36.0 36.0 32.0 36.0 76 34.1175799086758 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 3.0 24 5.0 25 13.0 26 17.0 27 25.0 28 36.0 29 41.0 30 73.0 31 104.0 32 120.0 33 199.0 34 436.0 35 2926.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.175 13.225000000000001 8.1 33.5 2 23.225 17.8 37.375 21.6 3 19.6 23.075000000000003 26.35 30.975 4 22.5 31.974999999999998 21.8 23.724999999999998 5 22.25 34.9 23.799999999999997 19.05 6 18.970736629667005 35.84762865792129 25.252270433905146 19.929364278506558 7 14.45 24.525 43.05 17.974999999999998 8 19.15 22.575 30.9 27.375 9 17.150000000000002 24.099999999999998 32.824999999999996 25.924999999999997 10-11 22.537499999999998 32.1375 22.975 22.35 12-13 21.625 25.2 27.6875 25.4875 14-15 20.8125 26.1625 28.037499999999998 24.9875 16-17 22.037499999999998 26.737499999999997 27.3375 23.8875 18-19 21.4125 28.037499999999998 26.450000000000003 24.099999999999998 20-21 21.6 27.1625 27.35 23.8875 22-23 21.337500000000002 27.575 26.7125 24.375 24-25 21.45 28.6125 26.150000000000002 23.7875 26-27 21.087500000000002 26.775 27.5625 24.575 28-29 21.75 28.287499999999998 26.325 23.6375 30-31 21.1375 28.3875 26.400000000000002 24.075 32-33 21.025 27.200000000000003 27.5625 24.212500000000002 34-35 21.5 27.250000000000004 27.212500000000002 24.0375 36-37 20.837500000000002 28.799999999999997 25.624999999999996 24.7375 38-39 21.5 26.575 27.762500000000003 24.1625 40-41 22.325 28.599999999999998 25.587500000000002 23.4875 42-43 21.425 28.125 26.275 24.175 44-45 21.224999999999998 28.1375 27.0875 23.549999999999997 46-47 21.4 27.875 27.212500000000002 23.5125 48-49 20.424999999999997 27.725 27.1625 24.6875 50-51 21.117779444861213 27.60690172543136 26.18154538634659 25.09377344336084 52-53 21.35800925347005 27.5728398149306 26.710016256096036 24.359134675503313 54-55 20.497748874437217 27.951475737868936 26.650825412706354 24.899949974987493 56-57 20.79789894947474 26.988494247123562 27.238619309654826 24.974987493746873 58-59 21.310655327663834 27.41370685342671 26.775887943971988 24.499749874937468 60-61 21.41338336460288 27.779862414008754 26.866791744840523 23.939962476547844 62-63 21.653740305228922 27.1703777833375 27.18288716537403 23.992994746059544 64-65 21.246246246246248 28.053053053053052 26.58908908908909 24.11161161161161 66-67 20.918878317476214 27.879318978467705 27.04056084126189 24.161241862794192 68-69 21.297107800175286 27.331914360836358 27.194190559659447 24.17678727932891 70-71 21.395465363898282 26.907177752724536 27.14518351496931 24.552173368407868 72-73 20.100692259282567 27.942101950912523 26.93517935808685 25.022026431718064 74-75 21.032914102221035 23.36098474712336 28.445276960128446 27.160824190527162 76 21.270928462709286 0.0 41.210045662100455 37.51902587519026 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 3.0 22 2.5 23 1.5 24 3.5 25 5.5 26 10.5 27 15.5 28 14.5 29 13.5 30 26.5 31 36.5 32 44.0 33 59.0 34 69.5 35 87.0 36 106.5 37 122.0 38 135.0 39 172.5 40 213.5 41 233.5 42 251.0 43 270.0 44 283.0 45 304.0 46 325.5 47 300.5 48 282.0 49 274.0 50 254.0 51 231.5 52 210.0 53 172.0 54 142.0 55 135.0 56 102.5 57 74.5 58 68.5 59 64.5 60 52.0 61 29.0 62 12.5 63 11.5 64 9.0 65 4.5 66 4.5 67 6.0 68 5.0 69 3.0 70 1.0 71 0.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.8999999999999999 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 49 1.0 50 0.0 51 0.0 52 1.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 1.0 61 0.0 62 0.0 63 0.0 64 2.0 65 1.0 66 0.0 67 0.0 68 1.0 69 1.0 70 1.0 71 4.0 72 29.0 73 84.0 74 274.0 75 972.0 76 2628.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.95 #Duplication Level Percentage of deduplicated Percentage of total 1 98.59622256253189 96.575 2 0.9443593670239917 1.8499999999999999 3 0.3318019397651863 0.975 4 0.0765696784073507 0.3 5 0.0 0.0 6 0.05104645227156713 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTG 6 0.15 No Hit CAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668898 read2 length is 49-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668898_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 49-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.08 32.0 32.0 32.0 32.0 32.0 2 30.97875 32.0 32.0 32.0 32.0 32.0 3 31.033 32.0 32.0 32.0 32.0 32.0 4 31.0015 32.0 32.0 32.0 32.0 32.0 5 30.9165 32.0 32.0 32.0 32.0 32.0 6 34.35025 36.0 36.0 36.0 32.0 36.0 7 34.5125 36.0 36.0 36.0 32.0 36.0 8 34.42625 36.0 36.0 36.0 32.0 36.0 9 34.54375 36.0 36.0 36.0 32.0 36.0 10-11 34.415375 36.0 36.0 36.0 32.0 36.0 12-13 34.516000000000005 36.0 36.0 36.0 32.0 36.0 14-15 34.3495 36.0 36.0 36.0 32.0 36.0 16-17 34.213625 36.0 36.0 36.0 32.0 36.0 18-19 34.403999999999996 36.0 36.0 36.0 32.0 36.0 20-21 34.415625000000006 36.0 36.0 36.0 32.0 36.0 22-23 34.370125 36.0 36.0 36.0 32.0 36.0 24-25 34.243875 36.0 36.0 36.0 32.0 36.0 26-27 34.271 36.0 36.0 36.0 32.0 36.0 28-29 34.223749999999995 36.0 36.0 36.0 32.0 36.0 30-31 34.22475 36.0 36.0 36.0 32.0 36.0 32-33 34.1305 36.0 36.0 36.0 32.0 36.0 34-35 34.092124999999996 36.0 36.0 36.0 32.0 36.0 36-37 34.1155 36.0 36.0 36.0 32.0 36.0 38-39 34.070750000000004 36.0 36.0 36.0 32.0 36.0 40-41 34.039249999999996 36.0 36.0 36.0 32.0 36.0 42-43 33.95225 36.0 36.0 36.0 29.5 36.0 44-45 33.909375 36.0 36.0 36.0 29.5 36.0 46-47 33.844375 36.0 36.0 36.0 29.5 36.0 48-49 34.01325 36.0 36.0 36.0 29.5 36.0 50-51 33.87246811702926 36.0 36.0 36.0 29.5 36.0 52-53 33.70338254273423 36.0 36.0 36.0 27.0 36.0 54-55 33.7736368184092 36.0 36.0 36.0 29.5 36.0 56-57 33.66645822911455 36.0 36.0 36.0 27.0 36.0 58-59 33.63344172086043 36.0 36.0 36.0 27.0 36.0 60-61 33.79089544772386 36.0 36.0 36.0 27.0 36.0 62-63 33.51438219109555 36.0 36.0 36.0 27.0 36.0 64-65 33.52444986573387 36.0 36.0 36.0 27.0 36.0 66-67 33.41049073610416 36.0 36.0 36.0 27.0 36.0 68-69 33.34576446908342 36.0 36.0 36.0 27.0 36.0 70-71 33.43629482091218 36.0 36.0 36.0 27.0 36.0 72-73 33.38024772026891 36.0 36.0 36.0 27.0 36.0 74-75 33.38651499781579 36.0 36.0 36.0 27.0 36.0 76 32.719890153001174 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 25.0 16 15.0 17 9.0 18 10.0 19 12.0 20 8.0 21 13.0 22 11.0 23 16.0 24 23.0 25 26.0 26 41.0 27 61.0 28 71.0 29 78.0 30 80.0 31 151.0 32 193.0 33 238.0 34 604.0 35 2312.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.04304304304304 20.92092092092092 10.385385385385385 25.650650650650654 2 29.25 27.450000000000003 28.875 14.424999999999999 3 22.75 28.349999999999998 27.775 21.125 4 25.8 34.525 21.025 18.65 5 25.874999999999996 35.775 20.05 18.3 6 22.675 35.425000000000004 22.3 19.6 7 21.175 18.725 38.824999999999996 21.275 8 23.425 22.650000000000002 27.500000000000004 26.424999999999997 9 22.675 24.45 27.85 25.025 10-11 25.162499999999998 31.974999999999998 22.0 20.8625 12-13 25.424999999999997 23.8125 27.725 23.0375 14-15 24.7 26.825 27.025 21.45 16-17 24.975 26.5375 26.987499999999997 21.5 18-19 25.0 27.537499999999998 26.05 21.4125 20-21 24.3125 27.1375 26.7125 21.837500000000002 22-23 25.324999999999996 27.187499999999996 25.85 21.637500000000003 24-25 24.8125 27.425 25.6 22.162499999999998 26-27 23.9375 29.225 25.687500000000004 21.15 28-29 24.75 28.537499999999998 25.4375 21.275 30-31 23.9125 27.85 26.7625 21.475 32-33 24.55 27.5125 26.237500000000004 21.7 34-35 24.3125 26.950000000000003 26.887499999999996 21.85 36-37 24.125 27.700000000000003 26.6125 21.5625 38-39 24.15 27.925 26.125 21.8 40-41 24.975 27.900000000000002 26.05 21.075 42-43 24.125 27.800000000000004 26.450000000000003 21.625 44-45 23.7625 26.674999999999997 27.987499999999997 21.575 46-47 24.95 26.525 27.250000000000004 21.275 48-49 23.6625 26.150000000000002 27.35 22.8375 50-51 24.33108277069267 27.169292323080768 26.806701675418854 21.6929232308077 52-53 25.35950981618107 26.960110041265473 26.572464674252842 21.10791546830061 54-55 24.824912456228116 27.463731865932967 26.663331665832917 21.048024012006003 56-57 24.874937468734366 26.40070035017509 26.80090045022511 21.92346173086543 58-59 24.874937468734366 27.48874437218609 25.53776888444222 22.098549274637318 60-61 25.175087543771884 27.238619309654826 26.088044022011005 21.498249124562278 62-63 23.499249624812407 26.113056528264135 27.67633816908454 22.71135567783892 64-65 25.084448892781186 26.886025272113102 26.51069685975228 21.518828975353436 66-67 24.2864296444667 27.165748622934398 26.91537305958938 21.632448673009513 68-69 24.182842830306825 27.03819661865999 27.263619286161557 21.515341264871633 70-71 23.8817190828217 28.041598797143212 26.713444430522493 21.363237689512594 72-73 24.61906560886538 26.167988918272258 28.119884145573604 21.093061327288755 74-75 25.578905099718913 24.09316021951546 27.94806585463793 22.379868826127694 76 28.128677912907023 0.0 41.66339741074931 30.207924676343662 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 1.0 20 1.0 21 1.0 22 0.5 23 1.0 24 2.5 25 2.5 26 2.5 27 4.5 28 9.0 29 14.5 30 19.0 31 23.0 32 29.5 33 42.0 34 56.0 35 75.5 36 104.5 37 131.0 38 148.0 39 169.5 40 220.5 41 251.5 42 256.0 43 267.5 44 287.0 45 312.0 46 316.5 47 317.5 48 316.0 49 284.0 50 250.0 51 230.5 52 205.5 53 167.5 54 134.0 55 121.0 56 103.0 57 77.5 58 66.5 59 65.5 60 52.0 61 33.5 62 24.0 63 15.0 64 9.5 65 8.5 66 6.0 67 5.5 68 7.0 69 6.5 70 4.5 71 3.5 72 3.5 73 2.0 74 0.5 75 0.5 76 0.5 77 1.0 78 0.5 79 1.0 80 1.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.5 92 1.0 93 1.0 94 0.5 95 1.0 96 2.0 97 1.0 98 0.5 99 9.0 100 17.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.025053238131028437 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 49 1.0 50 0.0 51 0.0 52 1.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 3.0 65 1.0 66 0.0 67 1.0 68 1.0 69 0.0 70 1.0 71 12.0 72 17.0 73 63.0 74 327.0 75 1023.0 76 2549.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.075 #Duplication Level Percentage of deduplicated Percentage of total 1 98.72546520520011 96.825 2 1.0960999235279123 2.15 3 0.07647208768799389 0.22499999999999998 4 0.05098139179199593 0.2 5 0.025490695895997964 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025490695895997964 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 19 0.475 No Hit GGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1165179 spots for SRR9668898.sra Written 1165179 spots for SRR9668898.sra Read 1165179 spots for SRR9668898.sra Written 1165179 spots for SRR9668898.sra Read 1165179 spots for SRR9668898.sra Written 1165179 spots for SRR9668898.sra Read 1165179 spots for SRR9668898.sra Written 1165179 spots for SRR9668898.sra Read 1165179 spots for SRR9668898.sra Written 1165179 spots for SRR9668898.sra Read 1165179 spots for SRR9668898.sra Written 1165179 spots for SRR9668898.sra Read 1165179 spots for SRR9668898.sra Written 1165179 spots for SRR9668898.sra Read 1165179 spots for SRR9668898.sra Written 1165179 spots for SRR9668898.sra Read 1165179 spots for SRR9668898.sra Written 1165179 spots for SRR9668898.sra Read 1165179 spots for SRR9668898.sra Written 1165179 spots for SRR9668898.sra Read 1165179 spots for SRR9668898.sra Written 1165179 spots for SRR9668898.sra Read 1165179 spots for SRR9668898.sra Written 1165179 spots for SRR9668898.sra Read 1165179 spots for SRR9668898.sra Written 1165179 spots for SRR9668898.sra Read 1165179 spots for SRR9668898.sra Written 1165179 spots for SRR9668898.sra Read 1165179 spots for SRR9668898.sra Written 1165179 spots for SRR9668898.sra Read 1165179 spots for SRR9668898.sra Written 1165179 spots for SRR9668898.sra Read 1165179 spots for SRR9668898.sra Written 1165179 spots for SRR9668898.sra Read 1165179 spots for SRR9668898.sra Written 1165179 spots for SRR9668898.sra Read 1165179 spots for SRR9668898.sra Written 1165179 spots for SRR9668898.sra Read 1165179 spots for SRR9668898.sra Written 1165179 spots for SRR9668898.sra SRR ids: ['SRR9668898.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j0uje_1h SRR9668898.sra spots: 23303580 blocks: [[1, 1165179], [1165180, 2330358], [2330359, 3495537], [3495538, 4660716], [4660717, 5825895], [5825896, 6991074], [6991075, 8156253], [8156254, 9321432], [9321433, 10486611], [10486612, 11651790], [11651791, 12816969], [12816970, 13982148], [13982149, 15147327], [15147328, 16312506], [16312507, 17477685], [17477686, 18642864], [18642865, 19808043], [19808044, 20973222], [20973223, 22138401], [22138402, 23303580]] SRR9668898 file size 4415438 SRR9668898 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668898 SRR9668898_1.fastq SRR9668898_2.fastq Input file: SRR9668898_1.fastq Paired file: SRR9668898_2.fastq trimmed: SRR9668898-trimmed-pair1.fastq, SRR9668898-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:56:15 2025 >> started Wed Feb 12 15:56:36 2025 >> done (21.024s) 23303580 read pairs processed; of these: 3331 ( 0.01%) short read pairs filtered out after trimming by size control 11239 ( 0.05%) empty read pairs filtered out after trimming by size control 23289010 (99.94%) read pairs available; of these: 12182 ( 0.05%) trimmed read pairs available after processing 23276828 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 3 0.00% 22 3 0.00% 23 7 0.00% 24 10 0.00% 25 10 0.00% 26 17 0.00% 27 15 0.00% 28 24 0.00% 29 23 0.00% 30 26 0.00% 31 15 0.00% 32 19 0.00% 33 28 0.00% 34 20 0.00% 35 184 0.00% 36 212 0.00% 37 207 0.00% 38 239 0.00% 39 234 0.00% 40 254 0.00% 41 287 0.00% 42 303 0.00% 43 325 0.00% 44 410 0.00% 45 386 0.00% 46 344 0.00% 47 386 0.00% 48 505 0.00% 49 557 0.00% 50 604 0.00% 51 633 0.00% 52 750 0.00% 53 843 0.00% 54 832 0.00% 55 1160 0.00% 56 1321 0.01% 57 1250 0.01% 58 1449 0.01% 59 2022 0.01% 60 2310 0.01% 61 2321 0.01% 62 2390 0.01% 63 2625 0.01% 64 2889 0.01% 65 3196 0.01% 66 3354 0.01% 67 3850 0.02% 68 3717 0.02% 69 3868 0.02% 70 4747 0.02% 71 6397 0.03% 72 19269 0.08% 73 208178 0.89% 74 1941380 8.34% 75 11276308 48.42% 76 9786293 42.02% 23289010 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=22 prefix-density=0.68 prefix-fanout=2.2 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=70.80 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.3 sequence=CTTGGCCAACGGCACGTGCCTCCGGGGCCAAGAGGCCCCTACTGCAGGTCGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACTTAGAGGCGTTCAGTCATAATCCAACGCACGGTAGCTTCGCGCCACTGGCTTTTCAACCAAGCGCGATGACCAATTGTGCGAATCAACGGTTCCTCTCGTACTAGGTTGGATTACTATTGCGACACTGTCATCAGTAGGGTAAAACTAACCTGTCTCACGACGGTCTAA criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=30 prefix-density=0.38 prefix-fanout=2.0 sequence=GAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=10.46 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.2 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR9668898 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:57:06 Started mapping on | Feb 12 15:57:06 Finished on | Feb 12 15:58:05 Mapping speed, Million of reads per hour | 1421.02 Number of input reads | 23289010 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 20120211 Uniquely mapped reads % | 86.39% Average mapped length | 150.41 Number of splices: Total | 9057686 Number of splices: Annotated (sjdb) | 8963696 Number of splices: GT/AG | 8890986 Number of splices: GC/AG | 142835 Number of splices: AT/AC | 6001 Number of splices: Non-canonical | 17864 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.02% Deletion average length | 2.13 Insertion rate per base | 0.01% Insertion average length | 1.93 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 898504 % of reads mapped to multiple loci | 3.86% Number of reads mapped to too many loci | 678411 % of reads mapped to too many loci | 2.91% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.73% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2270577 2270577 2270577 N_multimapping 898504 898504 898504 N_noFeature 448085 19894040 513516 N_ambiguous 273975 856 112624 UnstrandedReadsAssigned:19398151 PositiveStrandReadsAssigned:225315 NegativeStrandReadsAssigned:19494071 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668898 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668898-trimmed-pair1.fastq SRR9668898-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,289,010 reads, 20,658,867 reads pseudoaligned [quant] estimated average fragment length: 191.141 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,201 rounds 52401 SRR9668898.ke.tsv 34699 SRR9668898.se.tsv 87100 total ==> SRR9668898.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1827.86 294 6.8056 Potri.005G024800.1.v4.1 1035 844.859 96 4.80783 Potri.004G059700.1.v4.1 961 770.859 51 2.79935 Potri.007G009000.2.v4.1 1416 1225.86 0 0 Potri.003G141000.2.v4.1 2943 2752.86 318 4.88771 Potri.016G087400.1.v4.1 270 94.0573 1258.96 566.344 Potri.015G069301.1.v4.1 564 373.94 0 0 Potri.010G195200.1.v4.1 1773 1582.86 2 0.0534626 Potri.012G127500.1.v4.1 977 786.859 5940 319.412 ==> SRR9668898.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 16 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 277 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 51 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR9668898 completed mapping pipeline successfully