Starting /dee2/code/volunteer_pipeline.sh SRR9668899 current disk space = 3051616505856 free memory = 1459635592 SRR9668899 SRAfilesize 74149bbc80f85e8294cf80f539c5c9ab SRR9668899.sra SRR9668899.sra file validated SRR9668899 is paired end SRR9668899 is conventional basespace SRR9668899 read1 length is 36-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668899_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.60925 32.0 32.0 32.0 32.0 32.0 2 31.59075 32.0 32.0 32.0 32.0 32.0 3 31.53575 32.0 32.0 32.0 32.0 32.0 4 31.69575 32.0 32.0 32.0 32.0 32.0 5 31.7355 32.0 32.0 32.0 32.0 32.0 6 35.1165 36.0 36.0 36.0 36.0 36.0 7 35.4005 36.0 36.0 36.0 36.0 36.0 8 35.41125 36.0 36.0 36.0 36.0 36.0 9 35.437 36.0 36.0 36.0 36.0 36.0 10-11 35.350624999999994 36.0 36.0 36.0 36.0 36.0 12-13 35.395624999999995 36.0 36.0 36.0 36.0 36.0 14-15 35.351 36.0 36.0 36.0 36.0 36.0 16-17 35.37525 36.0 36.0 36.0 36.0 36.0 18-19 35.32875 36.0 36.0 36.0 36.0 36.0 20-21 35.34525 36.0 36.0 36.0 36.0 36.0 22-23 35.3315 36.0 36.0 36.0 36.0 36.0 24-25 35.263625 36.0 36.0 36.0 36.0 36.0 26-27 35.284625 36.0 36.0 36.0 36.0 36.0 28-29 35.194625 36.0 36.0 36.0 36.0 36.0 30-31 35.19475 36.0 36.0 36.0 36.0 36.0 32-33 35.173 36.0 36.0 36.0 36.0 36.0 34-35 35.144125 36.0 36.0 36.0 36.0 36.0 36-37 35.1320231307827 36.0 36.0 36.0 36.0 36.0 38-39 35.17254313578395 36.0 36.0 36.0 36.0 36.0 40-41 35.154538634658664 36.0 36.0 36.0 36.0 36.0 42-43 35.14078519629908 36.0 36.0 36.0 36.0 36.0 44-45 35.13240810202551 36.0 36.0 36.0 36.0 36.0 46-47 35.11440360090023 36.0 36.0 36.0 36.0 36.0 48-49 35.01312828207052 36.0 36.0 36.0 36.0 36.0 50-51 35.05651412853213 36.0 36.0 36.0 36.0 36.0 52-53 35.02988247061766 36.0 36.0 36.0 36.0 36.0 54-55 35.04527263631816 36.0 36.0 36.0 36.0 36.0 56-57 34.99774887443722 36.0 36.0 36.0 36.0 36.0 58-59 34.893571785892945 36.0 36.0 36.0 34.0 36.0 60-61 34.94372186093047 36.0 36.0 36.0 36.0 36.0 62-63 34.907703851925966 36.0 36.0 36.0 34.0 36.0 64-65 34.87643821910956 36.0 36.0 36.0 36.0 36.0 66-67 34.96073036518259 36.0 36.0 36.0 36.0 36.0 68-69 34.861634808438666 36.0 36.0 36.0 36.0 36.0 70-71 34.837778726913896 36.0 36.0 36.0 32.0 36.0 72-73 34.78261873652889 36.0 36.0 36.0 32.0 36.0 74-75 34.70206779264625 36.0 36.0 36.0 32.0 36.0 76 34.30290297937357 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 5.0 25 6.0 26 13.0 27 15.0 28 42.0 29 43.0 30 61.0 31 89.0 32 117.0 33 196.0 34 411.0 35 3000.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.525 13.900000000000002 11.15 43.425000000000004 2 20.8 16.975 39.75 22.475 3 19.525000000000002 18.8 26.6 35.075 4 21.425 29.575000000000003 22.175 26.825 5 23.200000000000003 34.75 23.525 18.525 6 18.22995461422088 35.12355017650025 25.668179525970753 20.978315683308118 7 14.85 24.7 42.05 18.4 8 18.35 24.25 31.5 25.900000000000002 9 18.125 23.474999999999998 33.375 25.025 10-11 22.112499999999997 32.925 22.4875 22.475 12-13 21.5375 24.837500000000002 27.3125 26.3125 14-15 21.099999999999998 25.7375 29.125 24.0375 16-17 21.587500000000002 26.5875 27.900000000000002 23.925 18-19 21.6875 26.85 27.5625 23.9 20-21 21.3875 28.4125 26.75 23.45 22-23 20.8125 27.5625 27.3875 24.2375 24-25 20.837500000000002 28.050000000000004 26.5 24.6125 26-27 21.212500000000002 27.150000000000002 27.250000000000004 24.3875 28-29 21.1625 27.875 27.150000000000002 23.8125 30-31 21.575 27.787499999999998 26.875 23.7625 32-33 21.45 27.3625 27.05 24.1375 34-35 20.549999999999997 29.1125 26.387500000000003 23.95 36-37 20.19002375296912 27.440930116264532 26.790848856107015 25.57819727465933 38-39 21.005251312828207 27.84446111527882 26.91922980745186 24.23105776444111 40-41 21.517879469867466 28.119529882470616 26.36909227306827 23.99349837459365 42-43 21.180295073768445 27.019254813703427 26.694173543385848 25.10627656914228 44-45 21.642910727681922 27.206801700425103 26.906726681670417 24.243560890222557 46-47 21.567891972993248 27.85696424106027 27.11927981995499 23.455863965991497 48-49 20.967741935483872 27.25681420355089 27.11927981995499 24.656164041010253 50-51 20.905226306576644 27.33183295823956 27.481870467616904 24.281070267566893 52-53 21.255313828457115 27.59439859964991 26.63165791447862 24.518629657414355 54-55 20.92296148074037 28.376688344172084 26.32566283141571 24.374687343671837 56-57 21.223111555777887 26.96348174087044 27.651325662831418 24.16208104052026 58-59 20.83541770885443 27.763881940970485 26.738369184592298 24.662331165582792 60-61 21.323161580790394 27.501250625312657 26.17558779389695 25.0 62-63 20.947973986993496 26.850925462731368 28.114057028514257 24.087043521760883 64-65 21.298149074537267 27.776388194097045 26.463231615807903 24.462231115557778 66-67 20.54777388694347 28.064032016008007 27.213606803401703 24.174587293646823 68-69 21.956712123107717 26.86100337795571 26.498185912673588 24.68409858626298 70-71 21.74239579421705 27.888346476405058 27.12479659531856 23.244461134059332 72-73 21.175584024114542 27.706606380306454 25.810097965335345 25.307711630243656 74-75 21.470353629353895 24.68758308960383 28.23717096516884 25.60489231587344 76 21.161191749427044 0.0 40.06875477463713 38.770053475935825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 3.0 24 6.5 25 6.0 26 5.5 27 11.5 28 17.0 29 17.5 30 29.0 31 44.0 32 53.5 33 57.0 34 60.0 35 80.0 36 103.0 37 119.5 38 149.5 39 178.0 40 192.5 41 234.0 42 280.5 43 294.5 44 294.0 45 300.0 46 305.5 47 308.5 48 303.0 49 274.0 50 249.0 51 233.5 52 199.0 53 159.0 54 138.5 55 124.5 56 107.5 57 82.5 58 63.5 59 57.5 60 43.5 61 29.0 62 21.5 63 15.5 64 12.5 65 7.0 66 6.5 67 10.5 68 6.5 69 3.0 70 1.5 71 0.5 72 1.0 73 2.0 74 1.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.8500000000000001 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 36 1.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 1.0 68 1.0 69 1.0 70 1.0 71 3.0 72 20.0 73 77.0 74 266.0 75 1010.0 76 2618.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.52492370295015 96.85000000000001 2 1.2970498474059002 2.55 3 0.10172939979654119 0.3 4 0.0762970498474059 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668899 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668899_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3115 32.0 32.0 32.0 32.0 32.0 2 31.15575 32.0 32.0 32.0 32.0 32.0 3 31.1555 32.0 32.0 32.0 32.0 32.0 4 31.1865 32.0 32.0 32.0 32.0 32.0 5 31.2235 32.0 32.0 32.0 32.0 32.0 6 34.64925 36.0 36.0 36.0 32.0 36.0 7 34.76975 36.0 36.0 36.0 36.0 36.0 8 34.651 36.0 36.0 36.0 32.0 36.0 9 34.78475 36.0 36.0 36.0 32.0 36.0 10-11 34.73675 36.0 36.0 36.0 34.0 36.0 12-13 34.694500000000005 36.0 36.0 36.0 34.0 36.0 14-15 34.597125 36.0 36.0 36.0 32.0 36.0 16-17 34.632374999999996 36.0 36.0 36.0 32.0 36.0 18-19 34.57875 36.0 36.0 36.0 32.0 36.0 20-21 34.547875000000005 36.0 36.0 36.0 32.0 36.0 22-23 34.626999999999995 36.0 36.0 36.0 32.0 36.0 24-25 34.584125 36.0 36.0 36.0 32.0 36.0 26-27 34.489875 36.0 36.0 36.0 32.0 36.0 28-29 34.612875 36.0 36.0 36.0 32.0 36.0 30-31 34.41075 36.0 36.0 36.0 32.0 36.0 32-33 34.410875000000004 36.0 36.0 36.0 32.0 36.0 34-35 34.483000000000004 36.0 36.0 36.0 32.0 36.0 36-37 34.42477821806627 36.0 36.0 36.0 32.0 36.0 38-39 34.31453226613307 36.0 36.0 36.0 32.0 36.0 40-41 34.36880940470235 36.0 36.0 36.0 32.0 36.0 42-43 34.376063031515756 36.0 36.0 36.0 32.0 36.0 44-45 34.159954977488745 36.0 36.0 36.0 32.0 36.0 46-47 34.15223917938454 36.0 36.0 36.0 32.0 36.0 48-49 34.240180135101326 36.0 36.0 36.0 32.0 36.0 50-51 34.2391793845384 36.0 36.0 36.0 32.0 36.0 52-53 34.039029271953964 36.0 36.0 36.0 32.0 36.0 54-55 34.03966466466466 36.0 36.0 36.0 32.0 36.0 56-57 34.06806806806807 36.0 36.0 36.0 32.0 36.0 58-59 33.977352352352355 36.0 36.0 36.0 32.0 36.0 60-61 34.078328328328325 36.0 36.0 36.0 32.0 36.0 62-63 33.87512512512512 36.0 36.0 36.0 32.0 36.0 64-65 33.87337337337337 36.0 36.0 36.0 29.5 36.0 66-67 33.8048048048048 36.0 36.0 36.0 27.0 36.0 68-69 33.712515644555694 36.0 36.0 36.0 27.0 36.0 70-71 33.80731437125636 36.0 36.0 36.0 27.0 36.0 72-73 33.77056855370395 36.0 36.0 36.0 27.0 36.0 74-75 33.644263600705756 36.0 36.0 36.0 27.0 36.0 76 32.992380952380955 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 2.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 4.0 15 9.0 16 7.0 17 4.0 18 4.0 19 4.0 20 12.0 21 11.0 22 14.0 23 11.0 24 20.0 25 17.0 26 33.0 27 43.0 28 52.0 29 81.0 30 92.0 31 121.0 32 172.0 33 262.0 34 629.0 35 2394.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.749562171628725 19.664748561421067 14.535901926444833 33.049787340505375 2 28.982245561390346 26.081520380095025 32.23305826456614 12.703175793948487 3 23.40585146286572 28.08202050512628 28.032008002000502 20.4801200300075 4 24.10602650662666 33.33333333333333 22.680670167541887 19.879969992498125 5 26.081520380095025 33.683420855213804 23.030757689422355 17.20430107526882 6 21.75543885971493 35.58389597399349 22.58064516129032 20.080020005001252 7 20.855213803450862 18.35458864716179 39.634908727181795 21.155288822205552 8 22.861430715357677 22.536268134067033 28.58929464732366 26.013006503251624 9 22.992244183137352 23.767825869402053 28.896672504378284 24.34325744308231 10-11 25.7661038148843 30.70669168230144 22.37648530331457 21.150719199499687 12-13 25.487987987987985 24.524524524524523 26.776776776776778 23.21071071071071 14-15 24.380475594493117 27.88485607008761 26.645807259073845 21.088861076345434 16-17 23.97697409585784 27.39331748216744 27.08046552371418 21.54924289826054 18-19 24.577649856088097 27.08046552371418 27.681141283944438 20.660743336253283 20-21 24.56513577774997 27.330747090476788 26.742585408584656 21.361531723188588 22-23 25.3566958698373 26.107634543178975 27.15894868585732 21.376720901126408 24-25 24.74974974974975 26.676676676676674 26.126126126126124 22.44744744744745 26-27 23.879849812265334 27.77221526908636 26.633291614518146 21.714643304130163 28-29 24.62770616944062 26.980352897009137 25.84157176823927 22.550369165310975 30-31 24.04255319148936 27.647058823529413 26.495619524405505 21.81476846057572 32-33 24.167709637046308 27.096370463078852 27.19649561952441 21.53942428035044 34-35 24.721631427499062 27.44901789065432 26.473164018516204 21.356186663330416 36-37 24.31181181181181 26.901901901901905 27.57757757757758 21.20870870870871 38-39 24.45863061709851 26.94955563900363 26.498936037050946 22.092877706846913 40-41 25.31296945418127 26.639959939909865 26.91537305958938 21.13169754631948 42-43 24.60575719649562 26.758448060075096 27.23404255319149 21.401752190237797 44-45 23.917396745932415 27.709637046307883 27.008760951188986 21.364205256570713 46-47 24.9749624436655 26.32699048572859 26.852779168753127 21.84526790185278 48-49 24.649474211316978 26.664997496244368 27.42864296444667 21.256885327991988 50-51 23.960941412118178 27.666499749624435 26.53980971457186 21.832749123685527 52-53 25.41948409717005 26.183320811419986 27.1099423991986 21.28725269221137 54-55 24.66182364729459 27.07915831663327 26.81613226452906 21.442885771543086 56-57 25.225450901803608 26.903807615230463 26.690881763527052 21.17985971943888 58-59 24.561623246492985 26.515531062124246 27.07915831663327 21.8436873747495 60-61 24.448897795591183 27.342184368737477 26.791082164328657 21.417835671342687 62-63 23.86022044088176 26.803607214428858 27.17935871743487 22.15681362725451 64-65 25.112725450901802 26.703406813627257 26.84118236472946 21.34268537074148 66-67 24.9248496993988 26.465430861723448 27.066633266533067 21.54308617234469 68-69 24.968679528940115 27.136056126284142 27.09847156101228 20.79679278376347 70-71 25.059546195311523 26.601479252851952 27.265889432117334 21.07308511971919 72-73 25.52495913491764 26.706903055450777 26.69432918395574 21.073808625675845 74-75 24.7765176784523 23.34889926617745 28.725817211474315 23.14876584389593 76 26.211369706219003 0.0 41.43456695917589 32.35406333460511 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 2.0 22 2.5 23 1.5 24 1.5 25 1.5 26 4.0 27 10.5 28 13.0 29 12.5 30 16.0 31 23.0 32 26.5 33 29.5 34 50.5 35 84.0 36 109.5 37 124.5 38 139.5 39 180.0 40 235.5 41 252.0 42 251.0 43 286.0 44 305.5 45 320.0 46 350.0 47 340.5 48 313.5 49 273.5 50 241.0 51 214.5 52 179.0 53 158.5 54 147.0 55 128.5 56 96.0 57 72.0 58 60.0 59 47.0 60 36.5 61 31.5 62 25.0 63 17.0 64 10.5 65 8.5 66 7.0 67 4.0 68 2.0 69 2.5 70 4.0 71 4.0 72 3.5 73 3.5 74 2.5 75 1.0 76 0.5 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 1.0 91 1.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 14.5 100 29.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.05 9 0.075 10-11 0.0625 12-13 0.1 14-15 0.125 16-17 0.11249999999999999 18-19 0.11249999999999999 20-21 0.11249999999999999 22-23 0.125 24-25 0.1 26-27 0.125 28-29 0.11249999999999999 30-31 0.125 32-33 0.125 34-35 0.08750000000000001 36-37 0.06252344629235963 38-39 0.08754377188594298 40-41 0.10005002501250625 42-43 0.0750375187593797 44-45 0.0750375187593797 46-47 0.07505629221916438 48-49 0.07505629221916438 50-51 0.07505629221916438 52-53 0.10007505629221916 54-55 0.10010010010010009 56-57 0.10010010010010009 58-59 0.10010010010010009 60-61 0.10010010010010009 62-63 0.10010010010010009 64-65 0.10010010010010009 66-67 0.10010010010010009 68-69 0.10012515644555695 70-71 0.12520345561537496 72-73 0.10048988820499938 74-75 0.10662401705984273 76 0.1523809523809524 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 1.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 1.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 1.0 68 0.0 69 1.0 70 1.0 71 4.0 72 17.0 73 67.0 74 307.0 75 973.0 76 2625.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.175 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98141074611662 97.175 2 0.9167303284950344 1.7999999999999998 3 0.025464731347084286 0.075 4 0.05092946269416857 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025464731347084286 0.75 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 30 0.75 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1135492 spots for SRR9668899.sra Written 1135492 spots for SRR9668899.sra Read 1135492 spots for SRR9668899.sra Written 1135492 spots for SRR9668899.sra Read 1135492 spots for SRR9668899.sra Written 1135492 spots for SRR9668899.sra Read 1135492 spots for SRR9668899.sra Written 1135492 spots for SRR9668899.sra Read 1135492 spots for SRR9668899.sra Written 1135492 spots for SRR9668899.sra Read 1135492 spots for SRR9668899.sra Written 1135492 spots for SRR9668899.sra Read 1135492 spots for SRR9668899.sra Written 1135492 spots for SRR9668899.sra Read 1135492 spots for SRR9668899.sra Written 1135492 spots for SRR9668899.sra Read 1135492 spots for SRR9668899.sra Written 1135492 spots for SRR9668899.sra Read 1135492 spots for SRR9668899.sra Written 1135492 spots for SRR9668899.sra Read 1135492 spots for SRR9668899.sra Written 1135492 spots for SRR9668899.sra Read 1135503 spots for SRR9668899.sra Written 1135503 spots for SRR9668899.sra Read 1135492 spots for SRR9668899.sra Written 1135492 spots for SRR9668899.sra Read 1135492 spots for SRR9668899.sra Written 1135492 spots for SRR9668899.sra Read 1135492 spots for SRR9668899.sra Written 1135492 spots for SRR9668899.sra Read 1135492 spots for SRR9668899.sra Written 1135492 spots for SRR9668899.sra Read 1135492 spots for SRR9668899.sra Written 1135492 spots for SRR9668899.sra Read 1135492 spots for SRR9668899.sra Written 1135492 spots for SRR9668899.sra Read 1135492 spots for SRR9668899.sra Written 1135492 spots for SRR9668899.sra Read 1135492 spots for SRR9668899.sra Written 1135492 spots for SRR9668899.sra SRR ids: ['SRR9668899.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8ft_k66r SRR9668899.sra spots: 22709851 blocks: [[1, 1135492], [1135493, 2270984], [2270985, 3406476], [3406477, 4541968], [4541969, 5677460], [5677461, 6812952], [6812953, 7948444], [7948445, 9083936], [9083937, 10219428], [10219429, 11354920], [11354921, 12490412], [12490413, 13625904], [13625905, 14761396], [14761397, 15896888], [15896889, 17032380], [17032381, 18167872], [18167873, 19303364], [19303365, 20438856], [20438857, 21574348], [21574349, 22709851]] SRR9668899 file size 4303080 SRR9668899 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668899 SRR9668899_1.fastq SRR9668899_2.fastq Input file: SRR9668899_1.fastq Paired file: SRR9668899_2.fastq trimmed: SRR9668899-trimmed-pair1.fastq, SRR9668899-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:24:19 2025 >> started Wed Feb 12 15:24:50 2025 >> done (30.957s) 22709851 read pairs processed; of these: 3232 ( 0.01%) short read pairs filtered out after trimming by size control 8884 ( 0.04%) empty read pairs filtered out after trimming by size control 22697735 (99.95%) read pairs available; of these: 11978 ( 0.05%) trimmed read pairs available after processing 22685757 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 0 0.00% 21 5 0.00% 22 9 0.00% 23 4 0.00% 24 10 0.00% 25 6 0.00% 26 23 0.00% 27 13 0.00% 28 21 0.00% 29 17 0.00% 30 21 0.00% 31 27 0.00% 32 21 0.00% 33 28 0.00% 34 25 0.00% 35 195 0.00% 36 169 0.00% 37 178 0.00% 38 216 0.00% 39 244 0.00% 40 235 0.00% 41 244 0.00% 42 276 0.00% 43 295 0.00% 44 339 0.00% 45 339 0.00% 46 254 0.00% 47 340 0.00% 48 349 0.00% 49 422 0.00% 50 450 0.00% 51 441 0.00% 52 490 0.00% 53 603 0.00% 54 495 0.00% 55 719 0.00% 56 866 0.00% 57 875 0.00% 58 983 0.00% 59 1366 0.01% 60 1547 0.01% 61 1573 0.01% 62 1568 0.01% 63 1652 0.01% 64 1844 0.01% 65 2122 0.01% 66 2092 0.01% 67 2508 0.01% 68 2249 0.01% 69 2515 0.01% 70 3085 0.01% 71 4579 0.02% 72 16692 0.07% 73 198636 0.88% 74 1873160 8.25% 75 10961506 48.29% 76 9608792 42.33% 22697735 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=24 prefix-density=0.56 prefix-fanout=2.1 sequence=CTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=52.89 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.6 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCA criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=24 prefix-density=0.38 prefix-fanout=2.1 sequence=CCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=13.55 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.3 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR9668899 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:25:17 Started mapping on | Feb 12 15:25:17 Finished on | Feb 12 15:26:48 Mapping speed, Million of reads per hour | 897.93 Number of input reads | 22697735 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 20147544 Uniquely mapped reads % | 88.76% Average mapped length | 150.47 Number of splices: Total | 9113417 Number of splices: Annotated (sjdb) | 9012012 Number of splices: GT/AG | 8944465 Number of splices: GC/AG | 145477 Number of splices: AT/AC | 6087 Number of splices: Non-canonical | 17388 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.02% Deletion average length | 2.14 Insertion rate per base | 0.01% Insertion average length | 1.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 920935 % of reads mapped to multiple loci | 4.06% Number of reads mapped to too many loci | 900659 % of reads mapped to too many loci | 3.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.09% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1629511 1629511 1629511 N_multimapping 920935 920935 920935 N_noFeature 510171 19908116 580316 N_ambiguous 284773 1003 114707 UnstrandedReadsAssigned:19352600 PositiveStrandReadsAssigned:238425 NegativeStrandReadsAssigned:19452521 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668899 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668899-trimmed-pair1.fastq SRR9668899-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,697,735 reads, 20,553,526 reads pseudoaligned [quant] estimated average fragment length: 196.9 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,019 rounds 52401 SRR9668899.ke.tsv 34699 SRR9668899.se.tsv 87100 total ==> SRR9668899.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1822.1 281 6.52269 Potri.005G024800.1.v4.1 1035 839.1 100 5.04056 Potri.004G059700.1.v4.1 961 765.1 46 2.54292 Potri.007G009000.2.v4.1 1416 1220.1 0 0 Potri.003G141000.2.v4.1 2943 2747.1 289 4.44955 Potri.016G087400.1.v4.1 270 91.1316 1471.58 682.979 Potri.015G069301.1.v4.1 564 368.233 0 0 Potri.010G195200.1.v4.1 1773 1577.1 1 0.0268184 Potri.012G127500.1.v4.1 977 781.1 5893 319.097 ==> SRR9668899.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 12 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 253 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 64 Potri.001G416900.v4.1 5 Potri.001G452600.v4.1 9 SRR9668899 completed mapping pipeline successfully