Starting /dee2/code/volunteer_pipeline.sh SRR9668900 current disk space = 3051612835840 free memory = 1489625776 SRR9668900 SRAfilesize acbb5a367c42763ee8a7ac78edc65b6b SRR9668900.sra SRR9668900.sra file validated SRR9668900 is paired end SRR9668900 is conventional basespace SRR9668900 read1 length is 36-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668900_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5915 32.0 32.0 32.0 32.0 32.0 2 31.6495 32.0 32.0 32.0 32.0 32.0 3 31.64525 32.0 32.0 32.0 32.0 32.0 4 31.70225 32.0 32.0 32.0 32.0 32.0 5 31.751 32.0 32.0 32.0 32.0 32.0 6 35.04825 36.0 36.0 36.0 36.0 36.0 7 35.44725 36.0 36.0 36.0 36.0 36.0 8 35.41125 36.0 36.0 36.0 36.0 36.0 9 35.328 36.0 36.0 36.0 36.0 36.0 10-11 35.406375 36.0 36.0 36.0 36.0 36.0 12-13 35.377125 36.0 36.0 36.0 36.0 36.0 14-15 35.372375000000005 36.0 36.0 36.0 36.0 36.0 16-17 35.335625 36.0 36.0 36.0 36.0 36.0 18-19 35.337125 36.0 36.0 36.0 36.0 36.0 20-21 35.372875 36.0 36.0 36.0 36.0 36.0 22-23 35.381625 36.0 36.0 36.0 36.0 36.0 24-25 35.279624999999996 36.0 36.0 36.0 36.0 36.0 26-27 35.226124999999996 36.0 36.0 36.0 36.0 36.0 28-29 35.253125 36.0 36.0 36.0 36.0 36.0 30-31 35.279624999999996 36.0 36.0 36.0 36.0 36.0 32-33 35.312625 36.0 36.0 36.0 36.0 36.0 34-35 35.163250000000005 36.0 36.0 36.0 36.0 36.0 36-37 35.172020723930984 36.0 36.0 36.0 36.0 36.0 38-39 35.171667916979246 36.0 36.0 36.0 36.0 36.0 40-41 35.14928732183046 36.0 36.0 36.0 36.0 36.0 42-43 35.209802450612656 36.0 36.0 36.0 36.0 36.0 44-45 35.16629157289323 36.0 36.0 36.0 36.0 36.0 46-47 35.19629907476869 36.0 36.0 36.0 36.0 36.0 48-49 35.08152038009502 36.0 36.0 36.0 36.0 36.0 50-51 35.150412603150784 36.0 36.0 36.0 36.0 36.0 52-53 35.13190797699424 36.0 36.0 36.0 36.0 36.0 54-55 35.12190547636909 36.0 36.0 36.0 36.0 36.0 56-57 35.02551275637819 36.0 36.0 36.0 36.0 36.0 58-59 34.98686843421711 36.0 36.0 36.0 36.0 36.0 60-61 35.02688844422211 36.0 36.0 36.0 36.0 36.0 62-63 35.00262631315658 36.0 36.0 36.0 36.0 36.0 64-65 34.934215731833895 36.0 36.0 36.0 36.0 36.0 66-67 34.937327995996995 36.0 36.0 36.0 36.0 36.0 68-69 34.91293470102577 36.0 36.0 36.0 36.0 36.0 70-71 34.92163103784151 36.0 36.0 36.0 34.0 36.0 72-73 34.74917681357501 36.0 36.0 36.0 32.0 36.0 74-75 34.734149084468626 36.0 36.0 36.0 32.0 36.0 76 34.526902382782474 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 2.0 24 5.0 25 8.0 26 9.0 27 28.0 28 29.0 29 39.0 30 59.0 31 77.0 32 108.0 33 159.0 34 407.0 35 3069.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.725 12.525 10.525 42.225 2 21.0 17.175 38.025 23.799999999999997 3 19.075 19.625 26.1 35.199999999999996 4 22.25 29.849999999999998 22.45 25.45 5 23.425 34.4 23.125 19.05 6 19.91429291656163 33.35013864381145 26.392740105873457 20.342828333753467 7 14.924999999999999 23.549999999999997 43.25 18.275 8 19.325 23.075000000000003 31.1 26.5 9 19.05 23.65 32.824999999999996 24.474999999999998 10-11 21.637500000000003 33.0125 22.3625 22.9875 12-13 21.227653456682084 24.440555069383674 28.55356919614952 25.778222277784725 14-15 20.5 25.9875 28.537499999999998 24.975 16-17 21.075 26.650000000000002 27.8125 24.462500000000002 18-19 20.3625 27.450000000000003 27.2625 24.925 20-21 20.45 27.6125 26.674999999999997 25.2625 22-23 21.1875 26.525 27.950000000000003 24.337500000000002 24-25 20.375 27.900000000000002 26.400000000000002 25.324999999999996 26-27 21.0 27.1 25.85 26.05 28-29 20.625 28.475 25.724999999999998 25.174999999999997 30-31 20.525 27.712500000000002 27.3 24.462500000000002 32-33 21.15 27.1625 27.425 24.2625 34-35 20.625 27.375 26.787499999999998 25.2125 36-37 21.227653456682084 27.19089886235779 26.440805100637583 25.14064258032254 38-39 21.05526381595399 27.131782945736433 26.069017254313575 25.743935983995996 40-41 20.40510127531883 28.469617404351087 26.30657664416104 24.81870467616904 42-43 21.030257564391096 28.257064266066518 25.881470367591895 24.831207801950487 44-45 21.417854463615903 27.70692673168292 26.03150787696924 24.843710927731934 46-47 20.84271067766942 27.906976744186046 26.981745436359088 24.268567141785446 48-49 20.80520130032508 27.144286071517882 26.569142285571395 25.481370342585645 50-51 21.36784196049012 27.344336084021002 26.65666416604151 24.63115778944736 52-53 20.80520130032508 27.419354838709676 26.70667666916729 25.068767191797946 54-55 21.10527631907977 26.9567391847962 27.156789197299325 24.781195298824706 56-57 20.847923961980992 27.301150575287643 27.07603801900951 24.77488744372186 58-59 20.772886443221612 27.813906953476735 27.01350675337669 24.399699849924964 60-61 20.597798899449725 27.288644322161083 26.96348174087044 25.15007503751876 62-63 21.173086543271637 27.363681840920464 27.426213106553277 24.037018509254626 64-65 21.388367729831145 27.36710444027517 26.929330831769853 24.315196998123827 66-67 21.02827120340255 27.9459594696022 25.91943957968476 25.106329747310486 68-69 21.278458844133098 26.99524643482612 26.35726795096322 25.369026770077557 70-71 21.02166019782146 27.845248528859397 27.043946412920995 24.089144860398147 72-73 20.87360361491151 27.16204342914522 26.258315551650558 25.706037404292708 74-75 21.78401270513499 22.45897300158814 29.182106934886182 26.574907358390682 76 23.136049192928517 0.0 40.238278247501924 36.62567255956956 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 2.0 16 3.0 17 3.0 18 2.5 19 1.0 20 0.0 21 0.5 22 2.0 23 3.5 24 4.0 25 4.0 26 6.5 27 13.0 28 19.5 29 21.5 30 27.5 31 34.0 32 36.0 33 42.0 34 71.5 35 104.0 36 118.5 37 134.0 38 145.5 39 158.5 40 191.0 41 231.5 42 247.5 43 263.5 44 266.5 45 274.5 46 295.0 47 298.0 48 293.5 49 269.0 50 254.0 51 229.0 52 192.5 53 174.5 54 165.5 55 146.5 56 118.0 57 94.5 58 78.5 59 67.5 60 57.0 61 37.0 62 22.5 63 26.0 64 20.0 65 7.5 66 8.5 67 14.0 68 10.5 69 5.0 70 2.0 71 1.0 72 1.0 73 3.5 74 3.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.8250000000000001 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0125 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 36 1.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 1.0 65 0.0 66 0.0 67 0.0 68 0.0 69 3.0 70 1.0 71 2.0 72 15.0 73 64.0 74 268.0 75 1042.0 76 2602.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.3 #Duplication Level Percentage of deduplicated Percentage of total 1 97.71325796505653 95.075 2 1.9784172661870503 3.85 3 0.20554984583761562 0.6 4 0.051387461459403906 0.2 5 0.025693730729701953 0.125 6 0.025693730729701953 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTG 6 0.15 No Hit GATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTAACAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668900 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668900_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.31275 32.0 32.0 32.0 32.0 32.0 2 31.2645 32.0 32.0 32.0 32.0 32.0 3 31.24225 32.0 32.0 32.0 32.0 32.0 4 31.25725 32.0 32.0 32.0 32.0 32.0 5 31.1485 32.0 32.0 32.0 32.0 32.0 6 34.743 36.0 36.0 36.0 36.0 36.0 7 34.81 36.0 36.0 36.0 36.0 36.0 8 34.71425 36.0 36.0 36.0 32.0 36.0 9 34.794 36.0 36.0 36.0 36.0 36.0 10-11 34.75725 36.0 36.0 36.0 36.0 36.0 12-13 34.80475 36.0 36.0 36.0 34.0 36.0 14-15 34.643875 36.0 36.0 36.0 34.0 36.0 16-17 34.616375000000005 36.0 36.0 36.0 32.0 36.0 18-19 34.714 36.0 36.0 36.0 36.0 36.0 20-21 34.656375 36.0 36.0 36.0 32.0 36.0 22-23 34.64475 36.0 36.0 36.0 32.0 36.0 24-25 34.6265 36.0 36.0 36.0 32.0 36.0 26-27 34.6165 36.0 36.0 36.0 32.0 36.0 28-29 34.46825 36.0 36.0 36.0 32.0 36.0 30-31 34.57899999999999 36.0 36.0 36.0 34.0 36.0 32-33 34.58862499999999 36.0 36.0 36.0 32.0 36.0 34-35 34.481875 36.0 36.0 36.0 32.0 36.0 36-37 34.410237201174155 36.0 36.0 36.0 32.0 36.0 38-39 34.409034034034036 36.0 36.0 36.0 32.0 36.0 40-41 34.509009009009006 36.0 36.0 36.0 32.0 36.0 42-43 34.41378878878879 36.0 36.0 36.0 32.0 36.0 44-45 34.34568210262829 36.0 36.0 36.0 32.0 36.0 46-47 34.25682102628285 36.0 36.0 36.0 32.0 36.0 48-49 34.28017025538308 36.0 36.0 36.0 32.0 36.0 50-51 34.290310465698546 36.0 36.0 36.0 32.0 36.0 52-53 34.344767150726085 36.0 36.0 36.0 32.0 36.0 54-55 34.14308963445168 36.0 36.0 36.0 32.0 36.0 56-57 34.179814675682444 36.0 36.0 36.0 32.0 36.0 58-59 34.1412471825695 36.0 36.0 36.0 32.0 36.0 60-61 34.160030052592035 36.0 36.0 36.0 32.0 36.0 62-63 34.20510894064613 36.0 36.0 36.0 32.0 36.0 64-65 34.03105669766781 36.0 36.0 36.0 32.0 36.0 66-67 33.96756012024048 36.0 36.0 36.0 29.5 36.0 68-69 34.02680360721443 36.0 36.0 36.0 32.0 36.0 70-71 33.952118325394835 36.0 36.0 36.0 32.0 36.0 72-73 33.98703771881757 36.0 36.0 36.0 32.0 36.0 74-75 33.96850669824837 36.0 36.0 36.0 32.0 36.0 76 33.17579908675799 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 4.0 15 10.0 16 11.0 17 6.0 18 5.0 19 7.0 20 15.0 21 7.0 22 11.0 23 14.0 24 10.0 25 25.0 26 33.0 27 39.0 28 52.0 29 71.0 30 77.0 31 85.0 32 143.0 33 227.0 34 568.0 35 2576.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.60190285428143 19.779669504256383 14.847270906359539 30.771156735102657 2 29.497122842131603 23.842882161621215 31.973980485364024 14.686014510883163 3 25.544158118588946 24.518388791593697 27.395546659994995 22.54190642982237 4 25.594195646735052 32.99974981235927 21.1408556417313 20.26519889917438 5 26.64498373780335 34.87615711783838 21.165874405804352 17.312984738553915 6 23.692769577182887 36.25218914185639 20.565424068051037 19.489617212909682 7 22.59194395796848 17.86339754816112 37.828371278458846 21.71628721541156 8 24.093069802351764 24.06805103827871 26.64498373780335 25.193895421566175 9 25.55055055055055 24.374374374374376 27.7027027027027 22.372372372372375 10-11 26.55155155155155 29.604604604604607 22.51001001001001 21.333833833833836 12-13 25.12826930296584 25.078212989613313 26.129395570016268 23.66412213740458 14-15 25.966712551620574 27.06795144537605 26.404705293455137 20.560630709548242 16-17 25.325325325325327 26.989489489489486 25.33783783783784 22.347347347347345 18-19 25.353522713052186 27.656113127268178 25.566262044800403 21.42410211487924 20-21 25.7007007007007 27.45245245245245 25.33783783783784 21.50900900900901 22-23 25.294117647058822 27.62202753441802 25.60700876095119 21.476846057571965 24-25 25.5005005005005 26.401401401401404 26.113613613613612 21.984484484484483 26-27 25.616318358152924 26.967838818671 25.190839694656486 22.225003128519585 28-29 24.924924924924923 27.152152152152155 26.401401401401404 21.52152152152152 30-31 25.41609310474284 26.442247528469526 26.56738831185083 21.5742710549368 32-33 24.274274274274273 28.153153153153156 26.18868868868869 21.383883883883883 34-35 26.05105105105105 27.32732732732733 25.763263263263266 20.85835835835836 36-37 25.353522713052186 27.005381053685397 26.454761606807658 21.186334626454762 38-39 24.88421579672049 27.487795719113784 26.19852296908249 21.42946551508324 40-41 26.84026039058588 25.27541311967952 26.264396594892336 21.61992989484226 42-43 24.918648310387987 27.897371714643306 25.481852315394242 21.70212765957447 44-45 25.1408538875673 27.89532991110555 26.104920495805683 20.858895705521473 46-47 25.27541311967952 27.71657486229344 25.600901352028043 21.407110665999 48-49 25.381918357124967 27.235161532682195 26.283496118206862 21.099423991985976 50-51 25.782619584272474 27.61081893313298 25.19408965689958 21.41247182569497 52-53 25.544703230653642 26.546456298522415 26.070623591284747 21.838216879539193 54-55 24.405209115952918 27.823691460055095 26.383671424993736 21.387427998998245 56-57 25.86422845691383 27.041583166332668 25.851703406813627 21.24248496993988 58-59 25.150300601202403 27.367234468937873 25.964428857715433 21.51803607214429 60-61 25.35070140280561 26.603206412825653 26.365230460921847 21.680861723446892 62-63 25.175350701402806 26.84118236472946 26.152304609218437 21.8311623246493 64-65 26.10874467551992 26.923076923076923 25.507391631170133 21.460786770233025 66-67 26.375140959779475 26.162135070793134 25.836361358225783 21.626362611201603 68-69 25.783011776497116 27.19869706840391 25.88323728388875 21.135053871210225 70-71 25.141065830721004 26.959247648902824 26.9717868338558 20.927899686520377 72-73 24.55037102251289 27.858131052697775 26.361463966796627 21.230033957992706 74-75 26.07882431529726 23.79425517702071 28.042752171008683 22.084168336673347 76 28.62580890749905 0.0 39.96954701180053 31.404644080700418 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.5 8 1.0 9 0.5 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 2.5 21 3.0 22 3.0 23 2.0 24 3.0 25 5.0 26 4.5 27 5.0 28 7.5 29 11.0 30 16.5 31 24.0 32 29.0 33 32.0 34 45.5 35 74.5 36 100.5 37 110.5 38 123.5 39 154.0 40 188.0 41 222.5 42 239.0 43 252.5 44 292.5 45 311.0 46 309.0 47 318.5 48 319.0 49 285.0 50 248.0 51 226.0 52 201.0 53 175.0 54 156.0 55 142.0 56 118.0 57 95.5 58 89.5 59 81.5 60 65.0 61 46.0 62 31.0 63 20.5 64 13.5 65 12.5 66 9.0 67 6.5 68 5.5 69 6.0 70 4.0 71 1.0 72 3.5 73 4.0 74 1.0 75 0.5 76 1.5 77 1.0 78 1.5 79 2.5 80 1.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 16.5 100 33.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.075 3 0.075 4 0.075 5 0.075 6 0.075 7 0.075 8 0.075 9 0.1 10-11 0.1 12-13 0.11249999999999999 14-15 0.11249999999999999 16-17 0.1 18-19 0.11249999999999999 20-21 0.1 22-23 0.125 24-25 0.1 26-27 0.11249999999999999 28-29 0.1 30-31 0.11249999999999999 32-33 0.1 34-35 0.1 36-37 0.025021894157387717 38-39 0.03753753753753754 40-41 0.050050050050050046 42-43 0.025025025025025023 44-45 0.03754693366708385 46-47 0.025031289111389236 48-49 0.025037556334501748 50-51 0.025037556334501748 52-53 0.025037556334501748 54-55 0.025037556334501748 56-57 0.025043826696719257 58-59 0.025043826696719257 60-61 0.025043826696719257 62-63 0.025043826696719257 64-65 0.037570444583594244 66-67 0.037575150300601205 68-69 0.0250501002004008 70-71 0.0376034093757834 72-73 0.037716872014080964 74-75 0.026712969146520632 76 0.0380517503805175 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 3.0 36 1.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 1.0 44 0.0 45 0.0 46 0.0 47 1.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 1.0 65 0.0 66 0.0 67 0.0 68 0.0 69 3.0 70 0.0 71 2.0 72 20.0 73 79.0 74 289.0 75 971.0 76 2628.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.15 #Duplication Level Percentage of deduplicated Percentage of total 1 98.14719505918681 95.35 2 1.59547092125579 3.1 3 0.2058672156459084 0.6 4 0.02573340195573855 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02573340195573855 0.8500000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 34 0.8500000000000001 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1185931 spots for SRR9668900.sra Written 1185931 spots for SRR9668900.sra Read 1185931 spots for SRR9668900.sra Written 1185931 spots for SRR9668900.sra Read 1185931 spots for SRR9668900.sra Written 1185931 spots for SRR9668900.sra Read 1185931 spots for SRR9668900.sra Written 1185931 spots for SRR9668900.sra Read 1185931 spots for SRR9668900.sra Written 1185931 spots for SRR9668900.sra Read 1185931 spots for SRR9668900.sra Written 1185931 spots for SRR9668900.sra Read 1185931 spots for SRR9668900.sra Written 1185931 spots for SRR9668900.sra Read 1185931 spots for SRR9668900.sra Written 1185931 spots for SRR9668900.sra Read 1185931 spots for SRR9668900.sra Written 1185931 spots for SRR9668900.sra Read 1185931 spots for SRR9668900.sra Written 1185931 spots for SRR9668900.sra Read 1185931 spots for SRR9668900.sra Written 1185931 spots for SRR9668900.sra Read 1185931 spots for SRR9668900.sra Written 1185931 spots for SRR9668900.sra Read 1185931 spots for SRR9668900.sra Written 1185931 spots for SRR9668900.sra Read 1185931 spots for SRR9668900.sra Written 1185931 spots for SRR9668900.sra Read 1185931 spots for SRR9668900.sra Written 1185931 spots for SRR9668900.sra Read 1185931 spots for SRR9668900.sra Written 1185931 spots for SRR9668900.sra Read 1185931 spots for SRR9668900.sra Written 1185931 spots for SRR9668900.sra Read 1185931 spots for SRR9668900.sra Written 1185931 spots for SRR9668900.sra Read 1185933 spots for SRR9668900.sra Written 1185933 spots for SRR9668900.sra Read 1185931 spots for SRR9668900.sra Written 1185931 spots for SRR9668900.sra SRR ids: ['SRR9668900.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zsx8a2bm SRR9668900.sra spots: 23718622 blocks: [[1, 1185931], [1185932, 2371862], [2371863, 3557793], [3557794, 4743724], [4743725, 5929655], [5929656, 7115586], [7115587, 8301517], [8301518, 9487448], [9487449, 10673379], [10673380, 11859310], [11859311, 13045241], [13045242, 14231172], [14231173, 15417103], [15417104, 16603034], [16603035, 17788965], [17788966, 18974896], [18974897, 20160827], [20160828, 21346758], [21346759, 22532689], [22532690, 23718622]] SRR9668900 file size 4495230 SRR9668900 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668900 SRR9668900_1.fastq SRR9668900_2.fastq Input file: SRR9668900_1.fastq Paired file: SRR9668900_2.fastq trimmed: SRR9668900-trimmed-pair1.fastq, SRR9668900-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:25:57 2025 >> started Wed Feb 12 15:26:18 2025 >> done (21.329s) 23718622 read pairs processed; of these: 3470 ( 0.01%) short read pairs filtered out after trimming by size control 8552 ( 0.04%) empty read pairs filtered out after trimming by size control 23706600 (99.95%) read pairs available; of these: 12191 ( 0.05%) trimmed read pairs available after processing 23694409 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 1 0.00% 21 2 0.00% 22 7 0.00% 23 6 0.00% 24 12 0.00% 25 13 0.00% 26 14 0.00% 27 11 0.00% 28 10 0.00% 29 22 0.00% 30 31 0.00% 31 27 0.00% 32 18 0.00% 33 23 0.00% 34 30 0.00% 35 171 0.00% 36 172 0.00% 37 215 0.00% 38 170 0.00% 39 206 0.00% 40 220 0.00% 41 193 0.00% 42 212 0.00% 43 286 0.00% 44 293 0.00% 45 309 0.00% 46 227 0.00% 47 345 0.00% 48 299 0.00% 49 388 0.00% 50 400 0.00% 51 496 0.00% 52 479 0.00% 53 545 0.00% 54 558 0.00% 55 835 0.00% 56 945 0.00% 57 904 0.00% 58 975 0.00% 59 1469 0.01% 60 1691 0.01% 61 1766 0.01% 62 1744 0.01% 63 1804 0.01% 64 2020 0.01% 65 2361 0.01% 66 2415 0.01% 67 2952 0.01% 68 2773 0.01% 69 2986 0.01% 70 3672 0.02% 71 5449 0.02% 72 18079 0.08% 73 203651 0.86% 74 1928020 8.13% 75 11433102 48.23% 76 10080574 42.52% 23706600 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=23 prefix-density=0.71 prefix-fanout=2.1 sequence=CTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGT criterion=fanout-score sequence-density=0.10 sequence-density-rank=26 fanout-score=12.90 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=3.7 sequence=CCATCTTTCGGCTAACCTAGCCTCCTCCGTCCCTCGGGACCAACAAGGGGTAGTACAGGAATATTCGCCTGTTGTCCATCGACTACGCCTTTCGGCCTGATCTTAGGCCCTGACTCACCCTCCGTGGACGAACCTTGCGGAGGAACCCTTAGGTTTTCGGGGCATTGGATTCTCACCAATGTTTGCGTTACTCAAGCCGACATTCTCGCTTCCGCTTCGTCCACCCCCGCTCGCGCGGGTGCTTCCCTCTAAGCGGAACGCTCCCCTACCGATGCATTTTTACATCCCACAGCTTCGGCAGATCGCTTAGCCCCGTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTATTACGCACTCTTTCAAGGGTGGCTGCTTCTAGGCAAACCTCCTGGCTGTCTCTGCACCCCTACCTCCTTTATCACTGAGCGGTCATTTAGGGGCCTTAGCTGGTGATCCGGGCTGTTTCCCTCTCGACGATGAAGCTTATCCCCCACCGTCTCACTGGC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=26 prefix-density=0.45 prefix-fanout=2.1 sequence=CCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=15.89 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=3.2 sequence=CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR9668900 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:26:46 Started mapping on | Feb 12 15:26:46 Finished on | Feb 12 15:28:03 Mapping speed, Million of reads per hour | 1108.36 Number of input reads | 23706600 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 20165957 Uniquely mapped reads % | 85.06% Average mapped length | 150.44 Number of splices: Total | 8317825 Number of splices: Annotated (sjdb) | 8224891 Number of splices: GT/AG | 8160499 Number of splices: GC/AG | 134349 Number of splices: AT/AC | 5497 Number of splices: Non-canonical | 17480 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.02% Insertion average length | 1.98 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1065339 % of reads mapped to multiple loci | 4.49% Number of reads mapped to too many loci | 1549205 % of reads mapped to too many loci | 6.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.71% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2475604 2475604 2475604 N_multimapping 1065339 1065339 1065339 N_noFeature 816107 19870997 896079 N_ambiguous 341946 1353 125892 UnstrandedReadsAssigned:19007904 PositiveStrandReadsAssigned:293607 NegativeStrandReadsAssigned:19143986 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668900 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668900-trimmed-pair1.fastq SRR9668900-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,706,600 reads, 20,817,717 reads pseudoaligned [quant] estimated average fragment length: 192.221 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52401 SRR9668900.ke.tsv 34699 SRR9668900.se.tsv 87100 total ==> SRR9668900.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1826.78 226.501 4.50278 Potri.005G024800.1.v4.1 1035 843.779 94 4.04572 Potri.004G059700.1.v4.1 961 769.788 47 2.21729 Potri.007G009000.2.v4.1 1416 1224.78 0 0 Potri.003G141000.2.v4.1 2943 2751.78 200 2.63945 Potri.016G087400.1.v4.1 270 94.642 1599.3 613.682 Potri.015G069301.1.v4.1 564 372.901 0 0 Potri.010G195200.1.v4.1 1773 1581.78 1 0.0229589 Potri.012G127500.1.v4.1 977 785.788 5363 247.856 ==> SRR9668900.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 9 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 298 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 46 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 8 SRR9668900 completed mapping pipeline successfully