Starting /dee2/code/volunteer_pipeline.sh SRR9668901 current disk space = 3051818999808 free memory = 1416794636 SRR9668901 SRAfilesize cf5aa4b63ebb86d0208a827be80e0b92 SRR9668901.sra SRR9668901.sra file validated SRR9668901 is paired end SRR9668901 is conventional basespace SRR9668901 read1 length is 63-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668901_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 63-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.76825 32.0 32.0 32.0 32.0 32.0 2 31.64975 32.0 32.0 32.0 32.0 32.0 3 31.78275 32.0 32.0 32.0 32.0 32.0 4 31.7385 32.0 32.0 32.0 32.0 32.0 5 31.799 32.0 32.0 32.0 32.0 32.0 6 35.45725 36.0 36.0 36.0 36.0 36.0 7 35.51375 36.0 36.0 36.0 36.0 36.0 8 35.48475 36.0 36.0 36.0 36.0 36.0 9 35.47725 36.0 36.0 36.0 36.0 36.0 10-11 35.36 36.0 36.0 36.0 36.0 36.0 12-13 35.433499999999995 36.0 36.0 36.0 36.0 36.0 14-15 35.404125 36.0 36.0 36.0 36.0 36.0 16-17 35.34825 36.0 36.0 36.0 36.0 36.0 18-19 35.42475 36.0 36.0 36.0 36.0 36.0 20-21 35.409375 36.0 36.0 36.0 36.0 36.0 22-23 35.414500000000004 36.0 36.0 36.0 36.0 36.0 24-25 35.326499999999996 36.0 36.0 36.0 36.0 36.0 26-27 35.3155 36.0 36.0 36.0 36.0 36.0 28-29 35.306625 36.0 36.0 36.0 36.0 36.0 30-31 35.313874999999996 36.0 36.0 36.0 36.0 36.0 32-33 35.252250000000004 36.0 36.0 36.0 36.0 36.0 34-35 35.265625 36.0 36.0 36.0 36.0 36.0 36-37 35.20375 36.0 36.0 36.0 36.0 36.0 38-39 35.284625 36.0 36.0 36.0 36.0 36.0 40-41 35.275875 36.0 36.0 36.0 36.0 36.0 42-43 35.160125 36.0 36.0 36.0 36.0 36.0 44-45 35.144125 36.0 36.0 36.0 36.0 36.0 46-47 35.145624999999995 36.0 36.0 36.0 36.0 36.0 48-49 35.182 36.0 36.0 36.0 36.0 36.0 50-51 35.091875 36.0 36.0 36.0 36.0 36.0 52-53 34.954625 36.0 36.0 36.0 34.0 36.0 54-55 34.99825 36.0 36.0 36.0 34.0 36.0 56-57 34.98475 36.0 36.0 36.0 36.0 36.0 58-59 34.878625 36.0 36.0 36.0 32.0 36.0 60-61 34.876625000000004 36.0 36.0 36.0 32.0 36.0 62-63 34.876999999999995 36.0 36.0 36.0 34.0 36.0 64-65 34.90820034255499 36.0 36.0 36.0 34.0 36.0 66-67 34.8836627470603 36.0 36.0 36.0 32.0 36.0 68-69 34.741055791843884 36.0 36.0 36.0 32.0 36.0 70-71 34.7286036036036 36.0 36.0 36.0 32.0 36.0 72-73 34.660886862287896 36.0 36.0 36.0 32.0 36.0 74-75 34.60041605385321 36.0 36.0 36.0 32.0 36.0 76 33.97109166983644 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 4.0 24 5.0 25 5.0 26 11.0 27 27.0 28 31.0 29 41.0 30 67.0 31 74.0 32 110.0 33 157.0 34 387.0 35 3080.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.45 13.925 9.15 36.475 2 21.825 16.925 39.1 22.15 3 19.45 20.825 26.5 33.225 4 23.0 30.95 21.7 24.349999999999998 5 22.2 35.15 22.575 20.075000000000003 6 18.275 35.15 25.6 20.974999999999998 7 14.7 22.425 44.4 18.475 8 18.099999999999998 21.9 33.074999999999996 26.924999999999997 9 18.575 23.05 32.925 25.45 10-11 21.8125 32.2125 23.1625 22.8125 12-13 19.875 26.0375 28.549999999999997 25.5375 14-15 20.9875 26.400000000000002 28.0875 24.525 16-17 20.682756033512568 27.64786795048143 27.735400775290735 23.93397524071527 18-19 19.75 27.8375 27.675 24.7375 20-21 20.5625 28.0625 27.375 24.0 22-23 20.8875 27.4125 26.8125 24.887500000000003 24-25 19.825 27.675 27.8625 24.637500000000003 26-27 21.224999999999998 28.4 26.275 24.099999999999998 28-29 21.425 27.05 27.325 24.2 30-31 20.532699762410907 27.447792922345883 27.53532574715518 24.484181568088033 32-33 20.95 26.450000000000003 27.625 24.975 34-35 20.2125 28.6125 27.825 23.35 36-37 20.9125 27.35 26.8 24.9375 38-39 21.224999999999998 27.0125 27.537499999999998 24.224999999999998 40-41 21.837500000000002 28.262500000000003 26.474999999999998 23.425 42-43 21.6625 27.537499999999998 26.1 24.7 44-45 21.1125 27.275 27.0 24.6125 46-47 20.575 28.9375 27.525 22.9625 48-49 21.0 27.925 27.187499999999996 23.8875 50-51 20.724999999999998 27.400000000000002 26.75 25.124999999999996 52-53 21.587500000000002 27.85 26.4625 24.099999999999998 54-55 21.15 27.4125 27.212500000000002 24.224999999999998 56-57 21.512500000000003 27.3875 26.5625 24.5375 58-59 21.3625 27.35 27.187499999999996 24.099999999999998 60-61 20.625 27.325 26.737499999999997 25.3125 62-63 21.825 26.724999999999998 28.037499999999998 23.4125 64-65 22.736368184092047 26.825912956478238 26.850925462731368 23.58679339669835 66-67 20.515386539904927 28.49637227920941 26.80760570427821 24.180635476607456 68-69 21.428571428571427 27.87090317738304 26.619964973730298 24.080560420315237 70-71 22.10960960960961 27.27727727727728 27.014514514514516 23.5985985985986 72-73 21.36569416498994 27.867203219315893 26.408450704225352 24.35865191146881 74-75 20.951619352259097 23.750499800079968 29.135012661602026 26.16286818605891 76 22.556104982883227 0.0 37.92316470140738 39.52073031570939 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.5 19 1.5 20 1.5 21 2.0 22 2.0 23 3.0 24 5.5 25 6.5 26 6.5 27 6.5 28 10.0 29 16.0 30 24.5 31 37.0 32 44.0 33 53.5 34 68.0 35 91.0 36 105.5 37 108.0 38 134.0 39 187.5 40 228.0 41 256.0 42 278.5 43 285.5 44 296.0 45 294.0 46 301.5 47 313.0 48 307.5 49 283.5 50 258.0 51 242.5 52 198.5 53 149.5 54 126.5 55 119.5 56 106.5 57 76.0 58 55.5 59 46.0 60 34.0 61 25.5 62 21.0 63 14.5 64 6.5 65 6.0 66 4.0 67 2.5 68 4.5 69 2.5 70 1.0 71 2.0 72 2.5 73 1.5 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0375 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0375 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 63 1.0 64 2.0 65 0.0 66 0.0 67 0.0 68 0.0 69 1.0 70 0.0 71 7.0 72 26.0 73 76.0 74 271.0 75 987.0 76 2629.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.60299720599441 97.05 2 1.2192024384048767 2.4 3 0.1524003048006096 0.44999999999999996 4 0.025400050800101596 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668901 read2 length is 63-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668901_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 63-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.422 32.0 32.0 32.0 32.0 32.0 2 31.3775 32.0 32.0 32.0 32.0 32.0 3 31.43025 32.0 32.0 32.0 32.0 32.0 4 31.31425 32.0 32.0 32.0 32.0 32.0 5 31.4315 32.0 32.0 32.0 32.0 32.0 6 35.10425 36.0 36.0 36.0 36.0 36.0 7 35.0295 36.0 36.0 36.0 36.0 36.0 8 35.073 36.0 36.0 36.0 36.0 36.0 9 35.041 36.0 36.0 36.0 36.0 36.0 10-11 35.039249999999996 36.0 36.0 36.0 36.0 36.0 12-13 35.02925 36.0 36.0 36.0 36.0 36.0 14-15 35.053625 36.0 36.0 36.0 36.0 36.0 16-17 34.962375 36.0 36.0 36.0 36.0 36.0 18-19 35.0085 36.0 36.0 36.0 36.0 36.0 20-21 34.81 36.0 36.0 36.0 36.0 36.0 22-23 34.899 36.0 36.0 36.0 36.0 36.0 24-25 34.939625 36.0 36.0 36.0 36.0 36.0 26-27 34.841750000000005 36.0 36.0 36.0 36.0 36.0 28-29 34.868625 36.0 36.0 36.0 36.0 36.0 30-31 34.816874999999996 36.0 36.0 36.0 36.0 36.0 32-33 34.776624999999996 36.0 36.0 36.0 36.0 36.0 34-35 34.664 36.0 36.0 36.0 36.0 36.0 36-37 34.734875 36.0 36.0 36.0 36.0 36.0 38-39 34.720375000000004 36.0 36.0 36.0 36.0 36.0 40-41 34.727125 36.0 36.0 36.0 36.0 36.0 42-43 34.708375000000004 36.0 36.0 36.0 36.0 36.0 44-45 34.5715 36.0 36.0 36.0 36.0 36.0 46-47 34.647000000000006 36.0 36.0 36.0 36.0 36.0 48-49 34.588375 36.0 36.0 36.0 36.0 36.0 50-51 34.440375 36.0 36.0 36.0 32.0 36.0 52-53 34.542874999999995 36.0 36.0 36.0 32.0 36.0 54-55 34.459625 36.0 36.0 36.0 32.0 36.0 56-57 34.514875 36.0 36.0 36.0 32.0 36.0 58-59 34.446 36.0 36.0 36.0 32.0 36.0 60-61 34.368375 36.0 36.0 36.0 32.0 36.0 62-63 34.41925 36.0 36.0 36.0 32.0 36.0 64-65 34.37042254058636 36.0 36.0 36.0 32.0 36.0 66-67 34.25556667500625 36.0 36.0 36.0 32.0 36.0 68-69 34.242682011508634 36.0 36.0 36.0 32.0 36.0 70-71 34.134009009009006 36.0 36.0 36.0 32.0 36.0 72-73 34.175051362565945 36.0 36.0 36.0 32.0 36.0 74-75 34.24275318586337 36.0 36.0 36.0 32.0 36.0 76 33.429287090558766 36.0 36.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 8.0 16 4.0 17 12.0 18 8.0 19 5.0 20 10.0 21 4.0 22 10.0 23 9.0 24 15.0 25 11.0 26 30.0 27 30.0 28 46.0 29 64.0 30 79.0 31 89.0 32 116.0 33 176.0 34 417.0 35 2857.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.851266616503636 22.72385252069225 11.336844745422624 27.088036117381492 2 29.22922922922923 26.176176176176174 30.98098098098098 13.613613613613614 3 22.366775081310983 26.870152614460846 29.422066549912433 21.341005754315738 4 25.224999999999998 34.9 20.674999999999997 19.2 5 25.624999999999996 35.925000000000004 20.75 17.7 6 21.6 35.425000000000004 22.575 20.4 7 21.85 17.974999999999998 39.0 21.175 8 23.1 24.0 26.025 26.875 9 24.05 24.224999999999998 28.125 23.599999999999998 10-11 25.874999999999996 30.5 22.275 21.349999999999998 12-13 25.337500000000002 24.95 25.924999999999997 23.7875 14-15 24.4375 27.150000000000002 27.2625 21.15 16-17 25.650000000000002 27.0 26.25 21.099999999999998 18-19 23.7125 27.6 26.3625 22.325 20-21 24.375 27.125 26.375 22.125 22-23 25.137500000000003 27.3 27.3 20.2625 24-25 23.7875 27.150000000000002 27.450000000000003 21.6125 26-27 23.8375 27.3625 26.700000000000003 22.1 28-29 24.337500000000002 27.075 26.5 22.0875 30-31 23.8875 27.700000000000003 27.075 21.337500000000002 32-33 23.5125 27.8875 26.775 21.825 34-35 24.275 27.500000000000004 26.900000000000002 21.325 36-37 24.7 27.212500000000002 26.200000000000003 21.8875 38-39 24.5125 27.1625 26.987499999999997 21.337500000000002 40-41 24.4375 27.575 26.337500000000002 21.65 42-43 23.8375 27.900000000000002 27.3375 20.925 44-45 24.5 27.0125 26.3125 22.175 46-47 24.45 27.250000000000004 26.437500000000004 21.8625 48-49 24.8625 27.4125 26.474999999999998 21.25 50-51 23.674999999999997 27.762500000000003 26.5625 22.0 52-53 24.4375 27.025 27.075 21.462500000000002 54-55 24.3125 26.75 27.4125 21.525 56-57 23.925 26.987499999999997 26.575 22.5125 58-59 23.9875 27.925 27.025 21.0625 60-61 23.45 26.974999999999998 27.237499999999997 22.3375 62-63 24.2625 27.762500000000003 27.0625 20.9125 64-65 24.64982491245623 27.00100050025013 26.350675337668832 21.99849924962481 66-67 23.44258193645234 26.745058794095574 26.65749311983988 23.15486614961221 68-69 23.405053790342755 27.09532149111834 26.945208906680012 22.554415811858895 70-71 24.436936936936938 27.965465465465467 26.914414414414416 20.683183183183182 72-73 24.054766989071723 27.13226981534983 27.05690239919608 21.756060796382364 74-75 24.735361114833175 24.949752110411364 28.35320916521506 21.961677609540402 76 25.39499036608863 0.0 42.58188824662813 32.02312138728324 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.5 23 1.5 24 3.0 25 4.0 26 4.5 27 6.5 28 9.5 29 12.0 30 15.5 31 22.5 32 30.5 33 35.5 34 49.0 35 76.0 36 106.0 37 122.0 38 148.5 39 190.5 40 226.0 41 258.5 42 278.5 43 301.0 44 317.0 45 322.5 46 331.5 47 330.0 48 301.5 49 263.0 50 242.5 51 220.0 52 183.5 53 157.0 54 138.5 55 120.0 56 94.0 57 71.5 58 63.0 59 52.5 60 40.0 61 25.5 62 18.0 63 11.5 64 6.0 65 6.5 66 4.0 67 2.5 68 3.0 69 2.0 70 1.5 71 3.0 72 4.5 73 3.5 74 2.5 75 2.5 76 1.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.5 82 1.0 83 1.0 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 1.5 90 1.5 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 1.0 98 1.0 99 7.5 100 15.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.1 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 63 1.0 64 2.0 65 0.0 66 0.0 67 0.0 68 0.0 69 1.0 70 0.0 71 3.0 72 25.0 73 88.0 74 297.0 75 988.0 76 2595.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.4 #Duplication Level Percentage of deduplicated Percentage of total 1 98.90752032520325 97.32499999999999 2 0.9400406504065042 1.8499999999999999 3 0.12703252032520324 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025406504065040653 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 18 0.44999999999999996 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCCAA 15 0.0021315527 69.45 26 >>END_MODULE Read 1314701 spots for SRR9668901.sra Written 1314701 spots for SRR9668901.sra Read 1314701 spots for SRR9668901.sra Written 1314701 spots for SRR9668901.sra Read 1314701 spots for SRR9668901.sra Written 1314701 spots for SRR9668901.sra Read 1314701 spots for SRR9668901.sra Written 1314701 spots for SRR9668901.sra Read 1314701 spots for SRR9668901.sra Written 1314701 spots for SRR9668901.sra Read 1314701 spots for SRR9668901.sra Written 1314701 spots for SRR9668901.sra Read 1314701 spots for SRR9668901.sra Written 1314701 spots for SRR9668901.sra Read 1314701 spots for SRR9668901.sra Written 1314701 spots for SRR9668901.sra Read 1314701 spots for SRR9668901.sra Written 1314701 spots for SRR9668901.sra Read 1314701 spots for SRR9668901.sra Written 1314701 spots for SRR9668901.sra Read 1314701 spots for SRR9668901.sra Written 1314701 spots for SRR9668901.sra Read 1314701 spots for SRR9668901.sra Written 1314701 spots for SRR9668901.sra Read 1314701 spots for SRR9668901.sra Written 1314701 spots for SRR9668901.sra Read 1314701 spots for SRR9668901.sra Written 1314701 spots for SRR9668901.sra Read 1314701 spots for SRR9668901.sra Written 1314701 spots for SRR9668901.sra Read 1314716 spots for SRR9668901.sra Written 1314716 spots for SRR9668901.sra Read 1314701 spots for SRR9668901.sra Written 1314701 spots for SRR9668901.sra Read 1314701 spots for SRR9668901.sra Written 1314701 spots for SRR9668901.sra Read 1314701 spots for SRR9668901.sra Written 1314701 spots for SRR9668901.sra Read 1314701 spots for SRR9668901.sra Written 1314701 spots for SRR9668901.sra SRR ids: ['SRR9668901.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r_mqis6o SRR9668901.sra spots: 26294035 blocks: [[1, 1314701], [1314702, 2629402], [2629403, 3944103], [3944104, 5258804], [5258805, 6573505], [6573506, 7888206], [7888207, 9202907], [9202908, 10517608], [10517609, 11832309], [11832310, 13147010], [13147011, 14461711], [14461712, 15776412], [15776413, 17091113], [17091114, 18405814], [18405815, 19720515], [19720516, 21035216], [21035217, 22349917], [22349918, 23664618], [23664619, 24979319], [24979320, 26294035]] SRR9668901 file size 4985260 SRR9668901 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668901 SRR9668901_1.fastq SRR9668901_2.fastq Input file: SRR9668901_1.fastq Paired file: SRR9668901_2.fastq trimmed: SRR9668901-trimmed-pair1.fastq, SRR9668901-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:10:30 2025 >> started Wed Feb 12 15:11:08 2025 >> done (37.642s) 26294035 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 2603 ( 0.01%) empty read pairs filtered out after trimming by size control 26291432 (99.99%) read pairs available; of these: 3389 ( 0.01%) trimmed read pairs available after processing 26288043 (99.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 0 0.00% 22 5 0.00% 23 8 0.00% 24 6 0.00% 25 5 0.00% 26 6 0.00% 27 19 0.00% 28 18 0.00% 29 23 0.00% 30 18 0.00% 31 18 0.00% 32 32 0.00% 33 23 0.00% 34 27 0.00% 35 85 0.00% 36 88 0.00% 37 97 0.00% 38 103 0.00% 39 138 0.00% 40 142 0.00% 41 171 0.00% 42 164 0.00% 43 197 0.00% 44 193 0.00% 45 229 0.00% 46 242 0.00% 47 274 0.00% 48 363 0.00% 49 415 0.00% 50 515 0.00% 51 583 0.00% 52 689 0.00% 53 673 0.00% 54 694 0.00% 55 807 0.00% 56 965 0.00% 57 1216 0.00% 58 1439 0.01% 59 1586 0.01% 60 1792 0.01% 61 1857 0.01% 62 2083 0.01% 63 2138 0.01% 64 2428 0.01% 65 2650 0.01% 66 2949 0.01% 67 3250 0.01% 68 3422 0.01% 69 4086 0.02% 70 4955 0.02% 71 7034 0.03% 72 21369 0.08% 73 235157 0.89% 74 2193670 8.34% 75 12755570 48.52% 76 11034743 41.97% 26291432 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=29 prefix-density=0.56 prefix-fanout=2.2 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=12.15 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=1.8 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCT criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=28 prefix-density=0.42 prefix-fanout=1.9 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=20.03 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=3.1 sequence=CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR9668901 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:11:43 Started mapping on | Feb 12 15:11:44 Finished on | Feb 12 15:13:18 Mapping speed, Million of reads per hour | 1006.91 Number of input reads | 26291432 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 23006282 Uniquely mapped reads % | 87.50% Average mapped length | 150.44 Number of splices: Total | 10423884 Number of splices: Annotated (sjdb) | 10315169 Number of splices: GT/AG | 10235045 Number of splices: GC/AG | 162426 Number of splices: AT/AC | 7043 Number of splices: Non-canonical | 19370 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.01% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1034820 % of reads mapped to multiple loci | 3.94% Number of reads mapped to too many loci | 813907 % of reads mapped to too many loci | 3.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.35% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2250330 2250330 2250330 N_multimapping 1034820 1034820 1034820 N_noFeature 576946 22748478 657608 N_ambiguous 295367 1073 117391 UnstrandedReadsAssigned:22133969 PositiveStrandReadsAssigned:256731 NegativeStrandReadsAssigned:22231283 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668901 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668901-trimmed-pair1.fastq SRR9668901-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,291,432 reads, 23,481,774 reads pseudoaligned [quant] estimated average fragment length: 193.364 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,140 rounds 52401 SRR9668901.ke.tsv 34699 SRR9668901.se.tsv 87100 total ==> SRR9668901.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1825.64 417 8.85625 Potri.005G024800.1.v4.1 1035 842.636 118 5.42962 Potri.004G059700.1.v4.1 961 768.636 61 3.07707 Potri.007G009000.2.v4.1 1416 1223.64 0 0 Potri.003G141000.2.v4.1 2943 2750.64 363 5.11683 Potri.016G087400.1.v4.1 270 92.8231 1478 617.37 Potri.015G069301.1.v4.1 564 371.838 0 0 Potri.010G195200.1.v4.1 1773 1580.64 7 0.171709 Potri.012G127500.1.v4.1 977 784.636 5895 291.302 ==> SRR9668901.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 21 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 277 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 124 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 12 SRR9668901 completed mapping pipeline successfully