Starting /dee2/code/volunteer_pipeline.sh SRR9668902 current disk space = 3051710689280 free memory = 1504407364 SRR9668902 SRAfilesize 62d397c85b9caf3d46c1c911debca1ac SRR9668902.sra SRR9668902.sra file validated SRR9668902 is paired end SRR9668902 is conventional basespace SRR9668902 read1 length is 63-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668902_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 63-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6675 32.0 32.0 32.0 32.0 32.0 2 31.64825 32.0 32.0 32.0 32.0 32.0 3 31.7505 32.0 32.0 32.0 32.0 32.0 4 31.73025 32.0 32.0 32.0 32.0 32.0 5 31.7295 32.0 32.0 32.0 32.0 32.0 6 35.40675 36.0 36.0 36.0 36.0 36.0 7 35.36075 36.0 36.0 36.0 36.0 36.0 8 35.41425 36.0 36.0 36.0 36.0 36.0 9 35.473 36.0 36.0 36.0 36.0 36.0 10-11 35.338375 36.0 36.0 36.0 36.0 36.0 12-13 35.398875000000004 36.0 36.0 36.0 36.0 36.0 14-15 35.3985 36.0 36.0 36.0 36.0 36.0 16-17 35.329625 36.0 36.0 36.0 36.0 36.0 18-19 35.407125 36.0 36.0 36.0 36.0 36.0 20-21 35.41575 36.0 36.0 36.0 36.0 36.0 22-23 35.333749999999995 36.0 36.0 36.0 36.0 36.0 24-25 35.317750000000004 36.0 36.0 36.0 36.0 36.0 26-27 35.325874999999996 36.0 36.0 36.0 36.0 36.0 28-29 35.35325 36.0 36.0 36.0 36.0 36.0 30-31 35.264125 36.0 36.0 36.0 36.0 36.0 32-33 35.216625 36.0 36.0 36.0 36.0 36.0 34-35 35.234 36.0 36.0 36.0 36.0 36.0 36-37 35.283625 36.0 36.0 36.0 36.0 36.0 38-39 35.265625 36.0 36.0 36.0 36.0 36.0 40-41 35.234375 36.0 36.0 36.0 36.0 36.0 42-43 35.18475 36.0 36.0 36.0 36.0 36.0 44-45 35.147999999999996 36.0 36.0 36.0 36.0 36.0 46-47 35.147625000000005 36.0 36.0 36.0 36.0 36.0 48-49 35.118624999999994 36.0 36.0 36.0 36.0 36.0 50-51 35.158500000000004 36.0 36.0 36.0 36.0 36.0 52-53 34.981375 36.0 36.0 36.0 34.0 36.0 54-55 35.04325 36.0 36.0 36.0 34.0 36.0 56-57 35.007125 36.0 36.0 36.0 36.0 36.0 58-59 34.936625 36.0 36.0 36.0 32.0 36.0 60-61 34.87175 36.0 36.0 36.0 32.0 36.0 62-63 34.88525 36.0 36.0 36.0 34.0 36.0 64-65 34.92735683920981 36.0 36.0 36.0 34.0 36.0 66-67 34.799292025357516 36.0 36.0 36.0 32.0 36.0 68-69 34.722486243121566 36.0 36.0 36.0 32.0 36.0 70-71 34.67203472065877 36.0 36.0 36.0 32.0 36.0 72-73 34.60200565647851 36.0 36.0 36.0 32.0 36.0 74-75 34.61684453943977 36.0 36.0 36.0 32.0 36.0 76 33.78369065849923 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 2.0 25 8.0 26 12.0 27 24.0 28 40.0 29 55.0 30 59.0 31 65.0 32 110.0 33 167.0 34 430.0 35 3027.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.8 13.750000000000002 10.925 40.525 2 21.55 18.25 38.324999999999996 21.875 3 18.15 21.725 25.55 34.575 4 21.625 31.8 22.15 24.425 5 21.15 34.625 25.275 18.95 6 19.45 34.699999999999996 25.55 20.3 7 14.799999999999999 22.55 44.074999999999996 18.575 8 17.525 24.075 31.45 26.950000000000003 9 18.025 23.95 32.074999999999996 25.95 10-11 21.462500000000002 32.587500000000006 23.7375 22.2125 12-13 21.45 25.0 27.8375 25.7125 14-15 20.2125 26.9125 28.1125 24.762500000000003 16-17 20.795298236838814 28.373139927472803 26.39739902463424 24.434162811054144 18-19 21.224999999999998 28.262500000000003 26.724999999999998 23.7875 20-21 21.0 28.050000000000004 27.5125 23.4375 22-23 19.9625 28.799999999999997 26.8375 24.4 24-25 20.4875 28.975 26.187500000000004 24.349999999999998 26-27 20.1375 28.4375 27.5125 23.9125 28-29 20.825 27.575 26.937499999999996 24.6625 30-31 20.222611305652826 27.763881940970485 27.238619309654826 24.77488744372186 32-33 19.9875 28.5625 27.55 23.9 34-35 20.5875 29.45 26.775 23.1875 36-37 20.525 28.475 26.825 24.175 38-39 20.65 27.737499999999997 27.875 23.7375 40-41 20.5375 28.925 27.025 23.5125 42-43 20.125 28.575 26.575 24.725 44-45 20.4375 27.725 27.1 24.7375 46-47 21.375 27.525 27.1125 23.9875 48-49 21.0625 28.749999999999996 26.2125 23.974999999999998 50-51 19.975 28.4 27.175 24.45 52-53 21.325 27.8125 27.425 23.4375 54-55 20.849999999999998 28.275 26.25 24.625 56-57 21.2375 27.6375 26.974999999999998 24.15 58-59 21.512500000000003 28.012500000000003 26.650000000000002 23.825 60-61 20.962500000000002 28.287499999999998 26.787499999999998 23.962500000000002 62-63 21.3125 27.025 27.875 23.7875 64-65 21.31782945736434 28.644661165291325 26.206551637909474 23.830957739434858 66-67 20.30761535575841 28.998374390396396 26.32237088908341 24.371639364761783 68-69 21.710855427713856 28.176588294147077 25.83791895947974 24.274637318659327 70-71 20.733233233233232 28.89139139139139 26.68918918918919 23.686186186186188 72-73 21.220492214967354 27.134605725765947 27.373179306880964 24.271722752385735 74-75 20.955295369877593 24.414582224587548 28.99148483235764 25.63863757317722 76 23.392036753445637 0.0 39.931087289433385 36.67687595712098 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 2.0 22 3.5 23 4.5 24 7.5 25 10.0 26 12.0 27 14.5 28 19.5 29 28.5 30 36.5 31 47.5 32 63.5 33 66.5 34 83.0 35 104.0 36 121.0 37 143.5 38 157.0 39 186.5 40 229.0 41 231.0 42 226.0 43 252.5 44 276.0 45 288.5 46 294.0 47 303.5 48 319.0 49 289.5 50 249.0 51 226.5 52 186.0 53 150.5 54 128.0 55 106.5 56 98.0 57 79.5 58 52.5 59 47.0 60 37.0 61 25.5 62 19.5 63 15.5 64 9.5 65 7.5 66 6.5 67 5.0 68 2.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0375 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.05 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 63 1.0 64 0.0 65 0.0 66 1.0 67 0.0 68 0.0 69 1.0 70 2.0 71 0.0 72 26.0 73 70.0 74 282.0 75 1005.0 76 2612.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.57615052123062 96.925 2 1.1950165268243071 2.35 3 0.17798118484617342 0.525 4 0.05085176709890668 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668902 read2 length is 63-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668902_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 63-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3875 32.0 32.0 32.0 32.0 32.0 2 31.28475 32.0 32.0 32.0 32.0 32.0 3 31.34475 32.0 32.0 32.0 32.0 32.0 4 31.33975 32.0 32.0 32.0 32.0 32.0 5 31.40425 32.0 32.0 32.0 32.0 32.0 6 35.06275 36.0 36.0 36.0 36.0 36.0 7 35.034 36.0 36.0 36.0 36.0 36.0 8 34.9395 36.0 36.0 36.0 36.0 36.0 9 35.011 36.0 36.0 36.0 36.0 36.0 10-11 34.950125 36.0 36.0 36.0 36.0 36.0 12-13 35.070125000000004 36.0 36.0 36.0 36.0 36.0 14-15 34.9785 36.0 36.0 36.0 36.0 36.0 16-17 34.87025 36.0 36.0 36.0 36.0 36.0 18-19 34.920625 36.0 36.0 36.0 36.0 36.0 20-21 34.893125 36.0 36.0 36.0 36.0 36.0 22-23 34.86 36.0 36.0 36.0 36.0 36.0 24-25 34.84125 36.0 36.0 36.0 36.0 36.0 26-27 34.8395 36.0 36.0 36.0 36.0 36.0 28-29 34.789625 36.0 36.0 36.0 36.0 36.0 30-31 34.803375 36.0 36.0 36.0 36.0 36.0 32-33 34.71275 36.0 36.0 36.0 36.0 36.0 34-35 34.724625 36.0 36.0 36.0 36.0 36.0 36-37 34.637125 36.0 36.0 36.0 36.0 36.0 38-39 34.68662500000001 36.0 36.0 36.0 36.0 36.0 40-41 34.676375 36.0 36.0 36.0 36.0 36.0 42-43 34.632374999999996 36.0 36.0 36.0 34.0 36.0 44-45 34.562375 36.0 36.0 36.0 34.0 36.0 46-47 34.562625 36.0 36.0 36.0 36.0 36.0 48-49 34.491 36.0 36.0 36.0 34.0 36.0 50-51 34.49225 36.0 36.0 36.0 32.0 36.0 52-53 34.5105 36.0 36.0 36.0 32.0 36.0 54-55 34.460625 36.0 36.0 36.0 32.0 36.0 56-57 34.42125 36.0 36.0 36.0 32.0 36.0 58-59 34.412875 36.0 36.0 36.0 32.0 36.0 60-61 34.331999999999994 36.0 36.0 36.0 32.0 36.0 62-63 34.248625000000004 36.0 36.0 36.0 32.0 36.0 64-65 34.30057514378595 36.0 36.0 36.0 32.0 36.0 66-67 34.27485798413085 36.0 36.0 36.0 32.0 36.0 68-69 34.17558779389695 36.0 36.0 36.0 32.0 36.0 70-71 34.21480471589929 36.0 36.0 36.0 32.0 36.0 72-73 34.181838673840424 36.0 36.0 36.0 32.0 36.0 74-75 34.21586275752373 36.0 36.0 36.0 32.0 36.0 76 33.39849056603774 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 8.0 16 7.0 17 5.0 18 7.0 19 11.0 20 7.0 21 5.0 22 8.0 23 8.0 24 14.0 25 19.0 26 24.0 27 41.0 28 48.0 29 50.0 30 61.0 31 95.0 32 124.0 33 209.0 34 524.0 35 2723.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.31116687578419 21.555834378920956 14.454203262233376 27.67879548306148 2 29.326321061858252 27.147508139243676 30.052592036063107 13.473578762834961 3 24.143107330497873 26.419814861145856 27.9459594696022 21.491118338754063 4 24.55 35.75 21.025 18.675 5 26.950000000000003 34.675 20.474999999999998 17.9 6 22.375 35.825 21.925 19.875 7 21.8 18.35 39.25 20.599999999999998 8 23.7 24.05 26.450000000000003 25.8 9 23.1 23.575 29.5 23.825 10-11 25.074999999999996 30.275000000000002 22.5875 22.0625 12-13 24.975 24.925 26.9625 23.1375 14-15 25.0 27.0875 27.35 20.5625 16-17 25.687500000000004 26.900000000000002 25.912499999999998 21.5 18-19 24.587500000000002 26.6125 26.787499999999998 22.0125 20-21 24.725 26.987499999999997 26.575 21.712500000000002 22-23 25.2375 27.3 25.7625 21.7 24-25 24.2875 28.075 26.075 21.5625 26-27 24.4375 27.55 26.2125 21.8 28-29 25.424999999999997 26.325 25.974999999999998 22.275 30-31 25.15 27.5625 26.174999999999997 21.1125 32-33 24.5 26.6125 26.6625 22.225 34-35 25.474999999999998 26.275 27.775 20.474999999999998 36-37 25.025 27.275 25.5375 22.162499999999998 38-39 23.875 27.55 26.6 21.975 40-41 25.35 26.6625 25.95 22.037499999999998 42-43 24.825 26.775 26.724999999999998 21.675 44-45 24.725 28.1375 26.275 20.8625 46-47 24.3125 27.150000000000002 25.412499999999998 23.125 48-49 23.7375 28.012500000000003 26.0375 22.2125 50-51 24.962500000000002 27.237499999999997 26.887499999999996 20.9125 52-53 24.9125 27.35 26.8375 20.9 54-55 24.462500000000002 26.375 26.6 22.5625 56-57 23.625 27.474999999999998 26.2875 22.6125 58-59 24.3 26.75 27.237499999999997 21.712500000000002 60-61 25.412499999999998 26.474999999999998 26.55 21.5625 62-63 24.7 28.475 25.55 21.275 64-65 24.76869217304326 27.206801700425103 26.019004751187797 22.005501375343837 66-67 24.446667500312618 27.76041015380768 26.00975365762161 21.783168688258097 68-69 24.23711855927964 27.538769384692348 27.03851925962982 21.1855927963982 70-71 24.38383585637433 28.14963092706118 25.84761666458151 21.618916551982988 72-73 25.0 27.312719959778782 26.21920563097034 21.468074409250878 74-75 25.093432995194874 23.451681793913508 28.45702082221036 22.99786438868126 76 28.566037735849058 0.0 40.0 31.433962264150946 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 1.0 9 1.0 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 1.5 19 0.5 20 0.5 21 1.5 22 1.5 23 2.0 24 2.0 25 1.0 26 2.5 27 5.0 28 8.5 29 12.0 30 16.5 31 22.0 32 35.0 33 48.0 34 52.0 35 66.5 36 99.0 37 119.5 38 149.0 39 188.5 40 209.0 41 241.5 42 263.5 43 280.0 44 300.0 45 306.5 46 319.0 47 311.0 48 295.5 49 273.5 50 246.0 51 226.5 52 189.5 53 155.0 54 131.5 55 117.5 56 105.5 57 86.0 58 72.0 59 55.0 60 33.5 61 26.0 62 23.5 63 20.0 64 13.0 65 10.5 66 10.0 67 6.0 68 5.0 69 3.0 70 4.0 71 6.0 72 4.0 73 2.0 74 1.0 75 1.0 76 3.0 77 2.0 78 0.5 79 1.5 80 1.0 81 1.0 82 2.0 83 2.0 84 1.5 85 1.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 1.0 99 16.5 100 32.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.17500000000000002 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 63 1.0 64 0.0 65 0.0 66 1.0 67 0.0 68 0.0 69 1.0 70 1.0 71 6.0 72 24.0 73 85.0 74 270.0 75 961.0 76 2650.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.23664122137404 97.5 2 0.6106870229007634 1.2 3 0.07633587786259542 0.22499999999999998 4 0.05089058524173028 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02544529262086514 0.8750000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 35 0.8750000000000001 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1251233 spots for SRR9668902.sra Written 1251233 spots for SRR9668902.sra Read 1251233 spots for SRR9668902.sra Written 1251233 spots for SRR9668902.sra Read 1251233 spots for SRR9668902.sra Written 1251233 spots for SRR9668902.sra Read 1251233 spots for SRR9668902.sra Written 1251233 spots for SRR9668902.sra Read 1251233 spots for SRR9668902.sra Written 1251233 spots for SRR9668902.sra Read 1251233 spots for SRR9668902.sra Written 1251233 spots for SRR9668902.sra Read 1251233 spots for SRR9668902.sra Written 1251233 spots for SRR9668902.sra Read 1251233 spots for SRR9668902.sra Written 1251233 spots for SRR9668902.sra Read 1251233 spots for SRR9668902.sra Written 1251233 spots for SRR9668902.sra Read 1251233 spots for SRR9668902.sra Written 1251233 spots for SRR9668902.sra Read 1251233 spots for SRR9668902.sra Written 1251233 spots for SRR9668902.sra Read 1251233 spots for SRR9668902.sra Written 1251233 spots for SRR9668902.sra Read 1251233 spots for SRR9668902.sra Written 1251233 spots for SRR9668902.sra Read 1251233 spots for SRR9668902.sra Written 1251233 spots for SRR9668902.sra Read 1251233 spots for SRR9668902.sra Written 1251233 spots for SRR9668902.sra Read 1251246 spots for SRR9668902.sra Written 1251246 spots for SRR9668902.sra Read 1251233 spots for SRR9668902.sra Written 1251233 spots for SRR9668902.sra Read 1251233 spots for SRR9668902.sra Written 1251233 spots for SRR9668902.sra Read 1251233 spots for SRR9668902.sra Written 1251233 spots for SRR9668902.sra Read 1251233 spots for SRR9668902.sra Written 1251233 spots for SRR9668902.sra SRR ids: ['SRR9668902.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uh00_wvf SRR9668902.sra spots: 25024673 blocks: [[1, 1251233], [1251234, 2502466], [2502467, 3753699], [3753700, 5004932], [5004933, 6256165], [6256166, 7507398], [7507399, 8758631], [8758632, 10009864], [10009865, 11261097], [11261098, 12512330], [12512331, 13763563], [13763564, 15014796], [15014797, 16266029], [16266030, 17517262], [17517263, 18768495], [18768496, 20019728], [20019729, 21270961], [21270962, 22522194], [22522195, 23773427], [23773428, 25024673]] SRR9668902 file size 4744126 SRR9668902 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668902 SRR9668902_1.fastq SRR9668902_2.fastq Input file: SRR9668902_1.fastq Paired file: SRR9668902_2.fastq trimmed: SRR9668902-trimmed-pair1.fastq, SRR9668902-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:47:43 2025 >> started Wed Feb 12 15:48:04 2025 >> done (21.286s) 25024673 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 2958 ( 0.01%) empty read pairs filtered out after trimming by size control 25021715 (99.99%) read pairs available; of these: 2645 ( 0.01%) trimmed read pairs available after processing 25019070 (99.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 2 0.00% 24 3 0.00% 25 6 0.00% 26 5 0.00% 27 6 0.00% 28 15 0.00% 29 13 0.00% 30 14 0.00% 31 15 0.00% 32 15 0.00% 33 16 0.00% 34 15 0.00% 35 50 0.00% 36 69 0.00% 37 72 0.00% 38 76 0.00% 39 79 0.00% 40 70 0.00% 41 93 0.00% 42 113 0.00% 43 123 0.00% 44 134 0.00% 45 167 0.00% 46 121 0.00% 47 152 0.00% 48 216 0.00% 49 261 0.00% 50 326 0.00% 51 357 0.00% 52 379 0.00% 53 377 0.00% 54 332 0.00% 55 518 0.00% 56 593 0.00% 57 700 0.00% 58 825 0.00% 59 922 0.00% 60 1040 0.00% 61 1034 0.00% 62 1204 0.00% 63 1351 0.01% 64 1391 0.01% 65 1561 0.01% 66 1753 0.01% 67 1966 0.01% 68 2046 0.01% 69 2462 0.01% 70 3286 0.01% 71 4703 0.02% 72 18201 0.07% 73 218864 0.87% 74 2061893 8.24% 75 12106811 48.39% 76 10584896 42.30% 25021715 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=27 prefix-density=0.59 prefix-fanout=2.1 sequence=CTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=45.25 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.8 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCA criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=27 prefix-density=0.40 prefix-fanout=2.1 sequence=CCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=11.09 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.4 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR9668902 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:48:31 Started mapping on | Feb 12 15:48:32 Finished on | Feb 12 15:49:42 Mapping speed, Million of reads per hour | 1286.83 Number of input reads | 25021715 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 21861720 Uniquely mapped reads % | 87.37% Average mapped length | 150.47 Number of splices: Total | 9542766 Number of splices: Annotated (sjdb) | 9437450 Number of splices: GT/AG | 9368975 Number of splices: GC/AG | 147951 Number of splices: AT/AC | 6407 Number of splices: Non-canonical | 19433 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.02% Deletion average length | 2.17 Insertion rate per base | 0.01% Insertion average length | 1.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1014936 % of reads mapped to multiple loci | 4.06% Number of reads mapped to too many loci | 989563 % of reads mapped to too many loci | 3.95% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.49% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2145059 2145059 2145059 N_multimapping 1014936 1014936 1014936 N_noFeature 505188 21583554 586451 N_ambiguous 332933 1033 135248 UnstrandedReadsAssigned:21023599 PositiveStrandReadsAssigned:277133 NegativeStrandReadsAssigned:21140021 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668902 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668902-trimmed-pair1.fastq SRR9668902-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,021,715 reads, 22,408,655 reads pseudoaligned [quant] estimated average fragment length: 202.766 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52401 SRR9668902.ke.tsv 34699 SRR9668902.se.tsv 87100 total ==> SRR9668902.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1816.23 323 6.40936 Potri.005G024800.1.v4.1 1035 833.234 138 5.96892 Potri.004G059700.1.v4.1 961 759.234 51 2.42091 Potri.007G009000.2.v4.1 1416 1214.23 0 0 Potri.003G141000.2.v4.1 2943 2741.23 286.102 3.76148 Potri.016G087400.1.v4.1 270 89.4679 1615.34 650.699 Potri.015G069301.1.v4.1 564 362.503 0 0 Potri.010G195200.1.v4.1 1773 1571.23 4 0.0917494 Potri.012G127500.1.v4.1 977 775.234 5023 233.515 ==> SRR9668902.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 16 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 347 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 69 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR9668902 completed mapping pipeline successfully