Starting /dee2/code/volunteer_pipeline.sh SRR9668904 current disk space = 3051706482688 free memory = 1469409584 SRR9668904 SRAfilesize 44e71dfcb54306aaaf859828261d8f49 SRR9668904.sra SRR9668904.sra file validated SRR9668904 is paired end SRR9668904 is conventional basespace SRR9668904 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668904_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.72775 32.0 32.0 32.0 32.0 32.0 2 31.67075 32.0 32.0 32.0 32.0 32.0 3 31.73575 32.0 32.0 32.0 32.0 32.0 4 31.73975 32.0 32.0 32.0 32.0 32.0 5 31.79175 32.0 32.0 32.0 32.0 32.0 6 35.41025 36.0 36.0 36.0 36.0 36.0 7 35.49675 36.0 36.0 36.0 36.0 36.0 8 35.5205 36.0 36.0 36.0 36.0 36.0 9 35.45825 36.0 36.0 36.0 36.0 36.0 10-11 35.4015 36.0 36.0 36.0 36.0 36.0 12-13 35.456875 36.0 36.0 36.0 36.0 36.0 14-15 35.418125 36.0 36.0 36.0 36.0 36.0 16-17 35.375 36.0 36.0 36.0 36.0 36.0 18-19 35.3955 36.0 36.0 36.0 36.0 36.0 20-21 35.424875 36.0 36.0 36.0 36.0 36.0 22-23 35.302125000000004 36.0 36.0 36.0 36.0 36.0 24-25 35.341 36.0 36.0 36.0 36.0 36.0 26-27 35.28125 36.0 36.0 36.0 36.0 36.0 28-29 35.266999999999996 36.0 36.0 36.0 36.0 36.0 30-31 35.34325 36.0 36.0 36.0 36.0 36.0 32-33 35.24225 36.0 36.0 36.0 36.0 36.0 34-35 35.2785 36.0 36.0 36.0 36.0 36.0 36-37 35.27081770442611 36.0 36.0 36.0 36.0 36.0 38-39 35.26456614153538 36.0 36.0 36.0 36.0 36.0 40-41 35.2283070767692 36.0 36.0 36.0 36.0 36.0 42-43 35.25456364091023 36.0 36.0 36.0 36.0 36.0 44-45 35.15056634343678 36.0 36.0 36.0 36.0 36.0 46-47 35.15832916458229 36.0 36.0 36.0 36.0 36.0 48-49 35.13044022011005 36.0 36.0 36.0 36.0 36.0 50-51 35.07943457593195 36.0 36.0 36.0 36.0 36.0 52-53 35.01689189189189 36.0 36.0 36.0 34.0 36.0 54-55 35.0223973973974 36.0 36.0 36.0 34.0 36.0 56-57 35.01326326326326 36.0 36.0 36.0 36.0 36.0 58-59 34.858823529411765 36.0 36.0 36.0 32.0 36.0 60-61 34.8933584983232 36.0 36.0 36.0 32.0 36.0 62-63 34.946907087402955 36.0 36.0 36.0 34.0 36.0 64-65 34.90594804058405 36.0 36.0 36.0 34.0 36.0 66-67 34.84062510986886 36.0 36.0 36.0 32.0 36.0 68-69 34.695999756602475 36.0 36.0 36.0 32.0 36.0 70-71 34.636945071482316 36.0 36.0 36.0 32.0 36.0 72-73 34.701413885813494 36.0 36.0 36.0 32.0 36.0 74-75 34.759898975682745 36.0 36.0 36.0 32.0 36.0 76 33.67917819043856 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 0.0 21 1.0 22 1.0 23 2.0 24 5.0 25 9.0 26 10.0 27 19.0 28 29.0 29 43.0 30 58.0 31 87.0 32 93.0 33 171.0 34 391.0 35 3079.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.70867716929232 10.777694423605903 12.42810702675669 42.085521380345085 2 20.555138784696176 16.454113528382095 36.48412103025757 26.506626656664167 3 19.80495123780945 20.305076269067268 24.056014003500874 35.83395848962241 4 22.230557639409852 29.40735183795949 22.50562640660165 25.85646411602901 5 23.40585146286572 34.38359589897475 22.80570142535634 19.4048512128032 6 19.279819954988746 34.25856464116029 25.506376594148538 20.955238809702426 7 15.003750937734434 24.8062015503876 42.335583895974 17.854463615903978 8 19.679919979995 21.955488872218055 31.98299574893723 26.38159539884971 9 18.27956989247312 22.655663915978995 34.03350837709427 25.03125781445361 10-11 20.86771692923231 32.75818954738685 24.006001500375092 22.36809202300575 12-13 20.367591897974492 24.406101525381345 29.21980495123781 26.006501625406354 14-15 19.94248562140535 27.369342335583895 28.294573643410853 24.3935983995999 16-17 20.390292719539655 27.370527895921942 27.77082812109082 24.468351263447584 18-19 21.080270067516878 27.46936734183546 27.306826706676667 24.143535883970994 20-21 21.267816954238562 27.28182045511378 27.069267316829208 24.381095273818453 22-23 21.392848212053014 27.53188297074269 26.91922980745186 24.15603900975244 24-25 20.84271067766942 27.66941735433858 27.056764191047762 24.431107776944234 26-27 21.655413853463365 27.081770442610654 27.294323580895224 23.968492123030757 28-29 21.030257564391096 27.306826706676667 27.556889222305575 24.10602650662666 30-31 20.61546159619715 28.709031773830375 26.26970227670753 24.405804353264948 32-33 22.2430607651913 27.569392348087025 26.831707926981746 23.355838959739934 34-35 20.967741935483872 27.25681420355089 27.769442360590148 24.006001500375092 36-37 21.355338834708675 26.85671417854464 26.79419854963741 24.99374843710928 38-39 20.930232558139537 28.482120530132534 26.36909227306827 24.218554638659665 40-41 20.86771692923231 27.26931732933233 27.619404851212803 24.243560890222557 42-43 20.980245061265315 27.394348587146787 27.26931732933233 24.356089022255563 44-45 20.720270101287984 27.872952357133922 26.722520945354507 24.684256596223584 46-47 20.822911455727862 28.27663831915958 27.03851925962982 23.861930965482742 48-49 19.78489244622311 27.62631315657829 27.738869434717362 24.84992496248124 50-51 21.978984238178633 27.09532149111834 27.52064048036027 23.405053790342755 52-53 20.62062062062062 28.32832832832833 27.38988988988989 23.66116116116116 54-55 20.432932932932932 28.203203203203202 26.739239239239236 24.624624624624623 56-57 21.30880880880881 27.37737737737738 26.7017017017017 24.61211211211211 58-59 21.501877346683354 27.77221526908636 26.958698372966204 23.76720901126408 60-61 20.54074352234322 27.099762172987855 27.400175240956315 24.959319063712606 62-63 21.28725269221137 26.984723265715 27.798647633358375 23.929376408715253 64-65 21.828428303068254 27.100814026299314 27.57670632435817 23.494051346274265 66-67 20.83437734903533 27.436732648459035 27.44926083688299 24.27962916562265 68-69 21.57452676444779 26.914880280807317 26.85220007521625 24.658392879528645 70-71 21.44469525959368 27.74015550539253 26.536242789064456 24.278906445949335 72-73 20.556394763343405 27.316213494461227 27.416918429003022 24.710473313192345 74-75 20.026791694574683 25.277963831212325 28.720696584058942 25.974547890154053 76 21.77005136309759 0.0 40.10272619517977 38.127222441722644 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.5 19 1.5 20 0.0 21 0.5 22 2.0 23 4.5 24 7.0 25 9.5 26 9.0 27 9.0 28 11.5 29 17.0 30 26.5 31 35.5 32 45.0 33 51.0 34 71.5 35 103.0 36 117.5 37 117.0 38 150.0 39 192.0 40 206.0 41 221.0 42 235.5 43 270.5 44 303.0 45 304.0 46 299.5 47 297.0 48 289.0 49 278.0 50 275.5 51 233.0 52 187.0 53 169.5 54 149.0 55 126.5 56 101.0 57 80.5 58 67.0 59 61.0 60 43.5 61 24.5 62 18.0 63 14.0 64 8.5 65 6.0 66 6.0 67 7.0 68 4.0 69 1.5 70 0.5 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.075 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.075 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 1.0 45 0.0 46 0.0 47 0.0 48 0.0 49 1.0 50 0.0 51 1.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 1.0 58 0.0 59 0.0 60 1.0 61 1.0 62 0.0 63 0.0 64 1.0 65 0.0 66 2.0 67 1.0 68 1.0 69 1.0 70 0.0 71 4.0 72 22.0 73 89.0 74 279.0 75 1062.0 76 2531.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.95 #Duplication Level Percentage of deduplicated Percentage of total 1 98.28994384890251 96.275 2 1.4293006636038794 2.8000000000000003 3 0.22970903522205208 0.675 4 0.025523226135783564 0.1 5 0.0 0.0 6 0.025523226135783564 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668904 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668904_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.408 32.0 32.0 32.0 32.0 32.0 2 31.167 32.0 32.0 32.0 32.0 32.0 3 31.201 32.0 32.0 32.0 32.0 32.0 4 31.1805 32.0 32.0 32.0 32.0 32.0 5 31.20475 32.0 32.0 32.0 32.0 32.0 6 34.59525 36.0 36.0 36.0 32.0 36.0 7 34.7115 36.0 36.0 36.0 32.0 36.0 8 34.70075 36.0 36.0 36.0 32.0 36.0 9 34.55325 36.0 36.0 36.0 32.0 36.0 10-11 34.574250000000006 36.0 36.0 36.0 32.0 36.0 12-13 34.631375 36.0 36.0 36.0 32.0 36.0 14-15 34.62712500000001 36.0 36.0 36.0 32.0 36.0 16-17 34.506 36.0 36.0 36.0 32.0 36.0 18-19 34.56575 36.0 36.0 36.0 32.0 36.0 20-21 34.35575 36.0 36.0 36.0 32.0 36.0 22-23 34.428375 36.0 36.0 36.0 32.0 36.0 24-25 34.47225 36.0 36.0 36.0 32.0 36.0 26-27 34.43125 36.0 36.0 36.0 32.0 36.0 28-29 34.287625 36.0 36.0 36.0 32.0 36.0 30-31 34.1465 36.0 36.0 36.0 32.0 36.0 32-33 34.288624999999996 36.0 36.0 36.0 32.0 36.0 34-35 34.306875000000005 36.0 36.0 36.0 32.0 36.0 36-37 34.27706926731683 36.0 36.0 36.0 32.0 36.0 38-39 34.18917229307327 36.0 36.0 36.0 32.0 36.0 40-41 34.1375343835959 36.0 36.0 36.0 32.0 36.0 42-43 34.12865716429107 36.0 36.0 36.0 32.0 36.0 44-45 34.12653804396572 36.0 36.0 36.0 32.0 36.0 46-47 34.06140570285143 36.0 36.0 36.0 32.0 36.0 48-49 34.05652826413207 36.0 36.0 36.0 32.0 36.0 50-51 33.88441330998249 36.0 36.0 36.0 32.0 36.0 52-53 34.066191191191194 36.0 36.0 36.0 32.0 36.0 54-55 33.90715715715716 36.0 36.0 36.0 32.0 36.0 56-57 34.01238738738739 36.0 36.0 36.0 32.0 36.0 58-59 33.83554443053818 36.0 36.0 36.0 32.0 36.0 60-61 33.80322787059187 36.0 36.0 36.0 29.5 36.0 62-63 33.74668169296268 36.0 36.0 36.0 27.0 36.0 64-65 33.72524017481494 36.0 36.0 36.0 27.0 36.0 66-67 33.746054138351894 36.0 36.0 36.0 27.0 36.0 68-69 33.73422599209008 36.0 36.0 36.0 27.0 36.0 70-71 33.678204163531476 36.0 36.0 36.0 27.0 36.0 72-73 33.641040506976644 36.0 36.0 36.0 27.0 36.0 74-75 33.61587781373093 36.0 36.0 36.0 27.0 36.0 76 32.85253456221198 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 3.0 15 17.0 16 21.0 17 17.0 18 11.0 19 8.0 20 11.0 21 13.0 22 14.0 23 11.0 24 20.0 25 31.0 26 36.0 27 41.0 28 39.0 29 67.0 30 77.0 31 103.0 32 137.0 33 239.0 34 670.0 35 2413.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.06661657901327 15.902829952416731 16.478837966441272 29.551715502128722 2 30.665332666333168 23.036518259129565 29.864932466233117 16.433216608304154 3 26.413206603301653 24.81240620310155 27.313656828414207 21.46073036518259 4 30.282570642660666 30.357589397349336 20.205051262815704 19.154788697174293 5 29.982495623905976 33.23330832708177 19.879969992498125 16.90422605651413 6 25.6064016004001 34.93373343335834 20.68017004251063 18.779694923730933 7 24.93123280820205 18.204551137784446 36.58414603650913 20.280070017504375 8 26.406601650412604 23.730932733183295 24.60615153788447 25.256314078519633 9 26.231557889472366 23.53088272068017 28.157039259814955 22.080520130032507 10-11 28.34458614653663 28.94473618404601 21.630407601900476 21.080270067516878 12-13 27.781945486371594 23.793448362090523 26.019004751187797 22.405601400350086 14-15 27.544386096524132 26.71917979494874 25.36884221055264 20.367591897974492 16-17 28.907226806701676 25.30632658164541 25.318829707426854 20.46761690422606 18-19 27.94448612153038 25.35633908477119 25.11877969492373 21.580395098774694 20-21 27.68192048012003 25.28132033008252 26.219054763690924 20.817704426106527 22-23 27.781945486371594 27.419354838709676 24.418604651162788 20.38009502375594 24-25 27.35683920980245 26.494123530882717 25.156289072268066 20.99274818704676 26-27 27.294323580895224 26.11902975743936 25.668917229307326 20.91772943235809 28-29 28.719679919979995 26.619154788697173 24.243560890222557 20.417604401100277 30-31 27.506876719179797 26.51912978244561 25.11877969492373 20.855213803450862 32-33 28.032008002000502 27.069267316829208 25.03125781445361 19.86746686671668 34-35 28.094523630907727 26.469117279319832 24.918729682420604 20.517629407351837 36-37 27.494373593398347 27.26931732933233 24.90622655663916 20.330082520630157 38-39 27.481870467616904 26.206551637909474 25.63140785196299 20.68017004251063 40-41 27.894473618404604 26.506626656664167 25.23130782695674 20.367591897974492 42-43 27.131782945736433 26.106526631657918 25.131282820705174 21.630407601900476 44-45 27.335250719019633 26.334875578341876 25.747155183193698 20.582718519444793 46-47 27.01350675337669 26.775887943971988 25.025012506253123 21.1855927963982 48-49 27.688844422211105 26.125562781390695 25.162581290645324 21.023011505752876 50-51 27.570678008506377 26.319739804853644 25.806855141356017 20.302727045283962 52-53 27.515015015015017 25.63813813813814 25.93843843843844 20.90840840840841 54-55 26.351351351351347 27.214714714714717 25.975975975975974 20.45795795795796 56-57 27.314814814814813 27.014514514514516 25.237737737737735 20.432932932932932 58-59 26.858573216520647 26.933667083854818 25.90738423028786 20.30037546933667 60-61 27.275003129302792 25.797972211791215 25.710351733633747 21.21667292527225 62-63 27.61081893313298 26.095667417981467 25.920360631104433 20.373153017781117 64-65 27.814652473387603 25.860989355040704 25.610519724483403 20.71383844708829 66-67 26.960661488348787 26.62240040090203 24.7557003257329 21.661237785016286 68-69 27.102920897580546 26.36329447160587 25.473235552212607 21.060549078600978 70-71 27.915726109857037 26.398294456985198 24.630047654878354 21.055931778279408 72-73 26.63975782038345 27.320887991927346 25.23965691220989 20.799697275479314 74-75 28.181329028786656 23.271455474845304 27.07828894269572 21.468926553672315 76 31.75883256528418 0.0 35.906298003072195 32.334869431643625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 0.5 22 1.5 23 1.0 24 1.0 25 3.0 26 3.5 27 5.0 28 5.5 29 6.5 30 12.0 31 18.5 32 33.0 33 46.0 34 62.5 35 89.0 36 105.5 37 112.5 38 130.0 39 169.5 40 202.0 41 218.0 42 231.0 43 254.5 44 303.5 45 316.5 46 303.5 47 312.0 48 312.5 49 261.0 50 204.0 51 195.5 52 182.5 53 151.5 54 127.0 55 107.5 56 95.5 57 91.0 58 85.0 59 68.0 60 41.5 61 30.0 62 28.0 63 18.5 64 7.5 65 4.5 66 5.0 67 6.0 68 4.0 69 4.0 70 4.0 71 2.0 72 1.5 73 2.0 74 2.5 75 2.0 76 2.0 77 2.0 78 3.0 79 2.0 80 1.0 81 2.0 82 3.5 83 5.0 84 3.0 85 1.0 86 1.5 87 2.5 88 2.5 89 2.0 90 1.5 91 3.0 92 5.0 93 3.5 94 2.5 95 4.5 96 6.0 97 4.5 98 5.0 99 78.5 100 150.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.05 3 0.05 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 1.0 45 0.0 46 0.0 47 0.0 48 0.0 49 1.0 50 0.0 51 1.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 1.0 58 0.0 59 0.0 60 1.0 61 1.0 62 0.0 63 0.0 64 1.0 65 0.0 66 2.0 67 1.0 68 1.0 69 1.0 70 0.0 71 8.0 72 30.0 73 84.0 74 296.0 75 965.0 76 2604.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83966244725738 93.7 2 1.0284810126582278 1.95 3 0.10548523206751054 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.026371308016877634 4.05 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 162 4.05 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1405879 spots for SRR9668904.sra Written 1405879 spots for SRR9668904.sra Read 1405879 spots for SRR9668904.sra Written 1405879 spots for SRR9668904.sra Read 1405879 spots for SRR9668904.sra Written 1405879 spots for SRR9668904.sra Read 1405879 spots for SRR9668904.sra Written 1405879 spots for SRR9668904.sra Read 1405879 spots for SRR9668904.sra Written 1405879 spots for SRR9668904.sra Read 1405879 spots for SRR9668904.sra Written 1405879 spots for SRR9668904.sra Read 1405879 spots for SRR9668904.sra Written 1405879 spots for SRR9668904.sra Read 1405879 spots for SRR9668904.sra Written 1405879 spots for SRR9668904.sra Read 1405879 spots for SRR9668904.sra Written 1405879 spots for SRR9668904.sra Read 1405879 spots for SRR9668904.sra Written 1405879 spots for SRR9668904.sra Read 1405879 spots for SRR9668904.sra Written 1405879 spots for SRR9668904.sra Read 1405879 spots for SRR9668904.sra Written 1405879 spots for SRR9668904.sra Read 1405879 spots for SRR9668904.sra Written 1405879 spots for SRR9668904.sra Read 1405879 spots for SRR9668904.sra Written 1405879 spots for SRR9668904.sra Read 1405898 spots for SRR9668904.sra Written 1405898 spots for SRR9668904.sra Read 1405879 spots for SRR9668904.sra Written 1405879 spots for SRR9668904.sra Read 1405879 spots for SRR9668904.sra Written 1405879 spots for SRR9668904.sra Read 1405879 spots for SRR9668904.sra Written 1405879 spots for SRR9668904.sra Read 1405879 spots for SRR9668904.sra Written 1405879 spots for SRR9668904.sra Read 1405879 spots for SRR9668904.sra Written 1405879 spots for SRR9668904.sra SRR ids: ['SRR9668904.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7pufczw5 SRR9668904.sra spots: 28117599 blocks: [[1, 1405879], [1405880, 2811758], [2811759, 4217637], [4217638, 5623516], [5623517, 7029395], [7029396, 8435274], [8435275, 9841153], [9841154, 11247032], [11247033, 12652911], [12652912, 14058790], [14058791, 15464669], [15464670, 16870548], [16870549, 18276427], [18276428, 19682306], [19682307, 21088185], [21088186, 22494064], [22494065, 23899943], [23899944, 25305822], [25305823, 26711701], [26711702, 28117599]] SRR9668904 file size 5331211 SRR9668904 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668904 SRR9668904_1.fastq SRR9668904_2.fastq Input file: SRR9668904_1.fastq Paired file: SRR9668904_2.fastq trimmed: SRR9668904-trimmed-pair1.fastq, SRR9668904-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:43:41 2025 >> started Wed Feb 12 15:44:08 2025 >> done (26.172s) 28117599 read pairs processed; of these: 2 ( 0.00%) short read pairs filtered out after trimming by size control 9623 ( 0.03%) empty read pairs filtered out after trimming by size control 28107974 (99.97%) read pairs available; of these: 4141 ( 0.01%) trimmed read pairs available after processing 28103833 (99.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 0 0.00% 21 3 0.00% 22 2 0.00% 23 1 0.00% 24 3 0.00% 25 5 0.00% 26 3 0.00% 27 9 0.00% 28 6 0.00% 29 12 0.00% 30 9 0.00% 31 10 0.00% 32 10 0.00% 33 12 0.00% 34 16 0.00% 35 82 0.00% 36 85 0.00% 37 138 0.00% 38 166 0.00% 39 176 0.00% 40 277 0.00% 41 284 0.00% 42 405 0.00% 43 447 0.00% 44 568 0.00% 45 633 0.00% 46 725 0.00% 47 830 0.00% 48 1043 0.00% 49 1247 0.00% 50 1467 0.01% 51 1670 0.01% 52 1968 0.01% 53 2047 0.01% 54 2166 0.01% 55 2435 0.01% 56 2547 0.01% 57 2903 0.01% 58 3246 0.01% 59 3406 0.01% 60 3847 0.01% 61 4110 0.01% 62 4507 0.02% 63 4787 0.02% 64 5222 0.02% 65 5433 0.02% 66 5580 0.02% 67 5956 0.02% 68 6175 0.02% 69 6627 0.02% 70 8007 0.03% 71 9660 0.03% 72 23754 0.08% 73 243514 0.87% 74 2270027 8.08% 75 13363407 47.54% 76 12106296 43.07% 28107974 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=25 prefix-density=0.68 prefix-fanout=2.1 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.05 sequence-density-rank=30 fanout-score=12.52 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=3.0 sequence=TTTGGCTTGTAGATTGG criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=28 prefix-density=0.45 prefix-fanout=2.1 sequence=CCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=15.07 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.8 sequence=AGGAAAGGCTTACGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGTAAGCGACGAAATGCTTCGGGGAGTTGAAAATAAGCGTAGATCCGGAGATTCCCGAATAGGTCAACCTTTCAAACTGCTGCCGAATCCATGGGCAGGCAAGAGACAACCTGGCGAACTGAAACATCTTAGTAACCAGAGGAAAAGAA SRR9668904 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:44:38 Started mapping on | Feb 12 15:44:39 Finished on | Feb 12 15:46:15 Mapping speed, Million of reads per hour | 1054.05 Number of input reads | 28107974 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 23713140 Uniquely mapped reads % | 84.36% Average mapped length | 150.39 Number of splices: Total | 10693663 Number of splices: Annotated (sjdb) | 10586023 Number of splices: GT/AG | 10499387 Number of splices: GC/AG | 166749 Number of splices: AT/AC | 7096 Number of splices: Non-canonical | 20431 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.02% Deletion average length | 2.16 Insertion rate per base | 0.01% Insertion average length | 1.94 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1107318 % of reads mapped to multiple loci | 3.94% Number of reads mapped to too many loci | 923917 % of reads mapped to too many loci | 3.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.26% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3287516 3287516 3287516 N_multimapping 1107318 1107318 1107318 N_noFeature 618908 23443439 692082 N_ambiguous 326601 1015 129286 UnstrandedReadsAssigned:22767631 PositiveStrandReadsAssigned:268686 NegativeStrandReadsAssigned:22891772 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668904 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668904-trimmed-pair1.fastq SRR9668904-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,107,974 reads, 24,494,129 reads pseudoaligned [quant] estimated average fragment length: 200.53 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52401 SRR9668904.ke.tsv 34699 SRR9668904.se.tsv 87100 total ==> SRR9668904.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1818.47 385 7.53733 Potri.005G024800.1.v4.1 1035 835.47 104 4.43165 Potri.004G059700.1.v4.1 961 761.476 66 3.08568 Potri.007G009000.2.v4.1 1416 1216.47 0 0 Potri.003G141000.2.v4.1 2943 2743.47 394.228 5.11576 Potri.016G087400.1.v4.1 270 91.5592 1684.52 654.995 Potri.015G069301.1.v4.1 564 364.866 0 0 Potri.010G195200.1.v4.1 1773 1573.47 6 0.135755 Potri.012G127500.1.v4.1 977 777.47 5478 250.842 ==> SRR9668904.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 20 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 269 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 72 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 9 SRR9668904 completed mapping pipeline successfully