Starting /dee2/code/volunteer_pipeline.sh SRR9668905 current disk space = 3051557535744 free memory = 1443888148 SRR9668905 SRAfilesize 15a907f0b19d6e533c1ee192b44e1baf SRR9668905.sra SRR9668905.sra file validated SRR9668905 is paired end SRR9668905 is conventional basespace SRR9668905 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668905_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.71975 32.0 32.0 32.0 32.0 32.0 2 31.579 32.0 32.0 32.0 32.0 32.0 3 31.793 32.0 32.0 32.0 32.0 32.0 4 31.76825 32.0 32.0 32.0 32.0 32.0 5 31.7915 32.0 32.0 32.0 32.0 32.0 6 35.418 36.0 36.0 36.0 36.0 36.0 7 35.526 36.0 36.0 36.0 36.0 36.0 8 35.4805 36.0 36.0 36.0 36.0 36.0 9 35.564 36.0 36.0 36.0 36.0 36.0 10-11 35.379875 36.0 36.0 36.0 36.0 36.0 12-13 35.430499999999995 36.0 36.0 36.0 36.0 36.0 14-15 35.470875 36.0 36.0 36.0 36.0 36.0 16-17 35.348875 36.0 36.0 36.0 36.0 36.0 18-19 35.401125 36.0 36.0 36.0 36.0 36.0 20-21 35.440625 36.0 36.0 36.0 36.0 36.0 22-23 35.381625 36.0 36.0 36.0 36.0 36.0 24-25 35.391125 36.0 36.0 36.0 36.0 36.0 26-27 35.364125 36.0 36.0 36.0 36.0 36.0 28-29 35.386125 36.0 36.0 36.0 36.0 36.0 30-31 35.309875000000005 36.0 36.0 36.0 36.0 36.0 32-33 35.31625 36.0 36.0 36.0 36.0 36.0 34-35 35.31125 36.0 36.0 36.0 36.0 36.0 36-37 35.31545386346586 36.0 36.0 36.0 36.0 36.0 38-39 35.298449612403104 36.0 36.0 36.0 36.0 36.0 40-41 35.25818954738685 36.0 36.0 36.0 36.0 36.0 42-43 35.323955988997255 36.0 36.0 36.0 36.0 36.0 44-45 35.22555638909728 36.0 36.0 36.0 36.0 36.0 46-47 35.22333056375649 36.0 36.0 36.0 36.0 36.0 48-49 35.15285006776593 36.0 36.0 36.0 36.0 36.0 50-51 35.16349762321741 36.0 36.0 36.0 36.0 36.0 52-53 35.039414414414416 36.0 36.0 36.0 34.0 36.0 54-55 34.997496871088856 36.0 36.0 36.0 34.0 36.0 56-57 35.08525287931898 36.0 36.0 36.0 36.0 36.0 58-59 35.03329994992489 36.0 36.0 36.0 32.0 36.0 60-61 34.958312468703056 36.0 36.0 36.0 32.0 36.0 62-63 34.95494067754939 36.0 36.0 36.0 34.0 36.0 64-65 34.97593576775816 36.0 36.0 36.0 34.0 36.0 66-67 34.95238095238095 36.0 36.0 36.0 32.0 36.0 68-69 34.824043280675994 36.0 36.0 36.0 32.0 36.0 70-71 34.80032589621459 36.0 36.0 36.0 32.0 36.0 72-73 34.76159728526109 36.0 36.0 36.0 32.0 36.0 74-75 34.771865843824756 36.0 36.0 36.0 32.0 36.0 76 33.85648148148148 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 0.0 21 0.0 22 1.0 23 0.0 24 2.0 25 10.0 26 7.0 27 18.0 28 32.0 29 35.0 30 66.0 31 70.0 32 104.0 33 151.0 34 381.0 35 3121.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.33433358339585 12.128032008002 9.802450612653162 40.735183795948984 2 20.455113778444613 16.479119779944988 36.55913978494624 26.506626656664167 3 19.879969992498125 21.280320080020005 26.156539134783696 32.68317079269817 4 24.20605151287822 28.582145536384097 22.18054513628407 25.03125781445361 5 22.18054513628407 33.558389597399355 23.80595148787197 20.455113778444613 6 18.879719929982496 35.50887721930482 25.28132033008252 20.330082520630157 7 15.178794698674668 22.255563890972745 43.53588397099275 19.02975743935984 8 18.154538634658664 23.380845211302827 31.882970742685675 26.581645411352838 9 17.62940735183796 23.88097024256064 33.88347086771693 24.60615153788447 10-11 22.080520130032507 31.895473868467118 23.843460865216304 22.18054513628407 12-13 20.54263565891473 25.70642660665166 28.694673668417103 25.056264066016503 14-15 19.579894973743436 27.819454863715933 28.19454863715929 24.406101525381345 16-17 20.87293646823412 26.825912956478238 27.763881940970485 24.537268634317158 18-19 21.43035758939735 27.994498624656167 26.65666416604151 23.918479619904975 20-21 20.54263565891473 27.66941735433858 27.19429857464366 24.593648412103025 22-23 20.4801200300075 26.93173293323331 27.619404851212803 24.968742185546386 24-25 20.517629407351837 28.68217054263566 26.456614153538382 24.343585896474117 26-27 20.80520130032508 28.14453613403351 27.031757939484873 24.01850462615654 28-29 21.605401350337583 28.044511127781945 25.993998499624904 24.356089022255563 30-31 20.500312695434648 28.242651657285805 27.692307692307693 23.564727954971858 32-33 21.13028257064266 28.08202050512628 27.081770442610654 23.705926481620406 34-35 21.442860715178792 27.719429857464366 26.6816704176044 24.15603900975244 36-37 20.16754188547137 28.28207051762941 27.619404851212803 23.93098274568642 38-39 20.64266066516629 27.569392348087025 27.181795448862218 24.60615153788447 40-41 20.99274818704676 27.906976744186046 26.79419854963741 24.306076519129782 42-43 21.10527631907977 27.881970492623154 26.456614153538382 24.55613903475869 44-45 21.8304576144036 27.33183295823956 27.04426106526632 23.793448362090523 46-47 21.408028010503937 27.560335125672125 26.49743653870201 24.534200325121923 48-49 20.312695434646656 28.380237648530333 26.929330831769853 24.377736085053158 50-51 20.815611708781585 27.670753064798596 27.60820615461596 23.90542907180385 52-53 20.25775775775776 28.27827827827828 27.114614614614613 24.34934934934935 54-55 21.614518147684606 27.684605757196497 26.5081351689612 24.192740926157697 56-57 20.530796194291437 28.254882323485226 27.44116174261392 23.773159739609415 58-59 21.44466700050075 27.32849273910866 27.578868302453678 23.647971957936907 60-61 21.41962944416625 26.727591387080622 27.45368052078117 24.399098647971957 62-63 21.850738792887554 27.034810919108438 27.0473328324568 24.06711745554721 64-65 21.588773336674603 27.23969427390051 26.199724345320135 24.971808044104748 66-67 20.93984962406015 27.681704260651628 27.092731829573935 24.285714285714285 68-69 21.180599072565485 27.058528637673895 27.559844592054144 24.20102769770648 70-71 21.02030584106292 27.575833542241163 27.19979944848333 24.204061168212583 72-73 21.460957178841312 27.204030226700255 26.813602015113354 24.521410579345087 74-75 21.006036217303823 24.050972501676725 29.014084507042252 25.928906773977197 76 22.916666666666664 0.0 39.31327160493827 37.77006172839506 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 3.0 23 4.5 24 4.5 25 5.5 26 7.5 27 10.0 28 14.5 29 21.0 30 29.0 31 41.5 32 59.5 33 72.5 34 70.5 35 86.5 36 114.0 37 121.5 38 138.0 39 161.5 40 191.0 41 247.0 42 277.0 43 284.0 44 292.5 45 304.0 46 317.5 47 312.0 48 291.0 49 280.5 50 266.5 51 236.0 52 201.0 53 157.5 54 133.0 55 124.5 56 109.0 57 78.5 58 58.0 59 52.5 60 38.0 61 22.0 62 17.5 63 14.5 64 10.5 65 7.0 66 2.0 67 1.5 68 4.0 69 3.0 70 0.5 71 0.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.05 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.0625 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 1.0 47 0.0 48 1.0 49 0.0 50 0.0 51 1.0 52 0.0 53 1.0 54 0.0 55 1.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 2.0 63 1.0 64 1.0 65 0.0 66 0.0 67 0.0 68 1.0 69 0.0 70 0.0 71 8.0 72 22.0 73 91.0 74 281.0 75 995.0 76 2592.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.70558375634518 97.225 2 1.0913705583756346 2.15 3 0.17766497461928935 0.525 4 0.025380710659898477 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668905 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668905_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3815 32.0 32.0 32.0 32.0 32.0 2 31.27075 32.0 32.0 32.0 32.0 32.0 3 31.30275 32.0 32.0 32.0 32.0 32.0 4 31.2965 32.0 32.0 32.0 32.0 32.0 5 31.2345 32.0 32.0 32.0 32.0 32.0 6 34.81525 36.0 36.0 36.0 36.0 36.0 7 34.9165 36.0 36.0 36.0 36.0 36.0 8 34.68975 36.0 36.0 36.0 32.0 36.0 9 34.839 36.0 36.0 36.0 36.0 36.0 10-11 34.687125 36.0 36.0 36.0 32.0 36.0 12-13 34.6835 36.0 36.0 36.0 36.0 36.0 14-15 34.643625 36.0 36.0 36.0 34.0 36.0 16-17 34.677375 36.0 36.0 36.0 36.0 36.0 18-19 34.593875 36.0 36.0 36.0 34.0 36.0 20-21 34.476 36.0 36.0 36.0 32.0 36.0 22-23 34.486625000000004 36.0 36.0 36.0 32.0 36.0 24-25 34.501000000000005 36.0 36.0 36.0 32.0 36.0 26-27 34.462374999999994 36.0 36.0 36.0 32.0 36.0 28-29 34.444625 36.0 36.0 36.0 32.0 36.0 30-31 34.436 36.0 36.0 36.0 32.0 36.0 32-33 34.308499999999995 36.0 36.0 36.0 32.0 36.0 34-35 34.314 36.0 36.0 36.0 32.0 36.0 36-37 34.27806951737934 36.0 36.0 36.0 32.0 36.0 38-39 34.33833458364592 36.0 36.0 36.0 32.0 36.0 40-41 34.29544886221555 36.0 36.0 36.0 32.0 36.0 42-43 34.194048512128035 36.0 36.0 36.0 32.0 36.0 44-45 34.16479119779945 36.0 36.0 36.0 32.0 36.0 46-47 34.17943611715835 36.0 36.0 36.0 32.0 36.0 48-49 34.134569442589694 36.0 36.0 36.0 32.0 36.0 50-51 34.056292219164376 36.0 36.0 36.0 32.0 36.0 52-53 34.13713713713713 36.0 36.0 36.0 32.0 36.0 54-55 33.91526908635795 36.0 36.0 36.0 32.0 36.0 56-57 34.11955433149725 36.0 36.0 36.0 32.0 36.0 58-59 34.003880821231846 36.0 36.0 36.0 32.0 36.0 60-61 33.89934902353531 36.0 36.0 36.0 32.0 36.0 62-63 33.86689321306609 36.0 36.0 36.0 32.0 36.0 64-65 33.80191361013408 36.0 36.0 36.0 27.0 36.0 66-67 33.852380952380955 36.0 36.0 36.0 27.0 36.0 68-69 33.87090407140941 36.0 36.0 36.0 29.5 36.0 70-71 33.807074834430594 36.0 36.0 36.0 27.0 36.0 72-73 33.92117865708163 36.0 36.0 36.0 32.0 36.0 74-75 34.00622073984043 36.0 36.0 36.0 32.0 36.0 76 32.9295137580098 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 19.0 16 25.0 17 25.0 18 15.0 19 13.0 20 13.0 21 17.0 22 18.0 23 14.0 24 17.0 25 23.0 26 25.0 27 29.0 28 47.0 29 59.0 30 73.0 31 72.0 32 119.0 33 170.0 34 415.0 35 2789.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.5161613630669 19.09295915810574 13.455274367326483 26.935605111500877 2 30.16508254127064 24.637318659329665 31.065532766383193 14.132066033016507 3 26.063031515757878 25.76288144072036 27.763881940970485 20.410205102551277 4 28.40710177544386 31.407851962990748 21.155288822205552 19.02975743935984 5 29.732433108277068 34.433608402100525 19.904976244061015 15.928982245561391 6 24.306076519129782 33.58339584896224 22.13053263315829 19.979994998749685 7 23.25581395348837 18.454613653413354 37.98449612403101 20.305076269067268 8 25.656414103525883 22.50562640660165 26.406601650412604 25.431357839459867 9 26.456614153538382 23.40585146286572 26.406601650412604 23.730932733183295 10-11 27.569392348087025 30.132533133283324 21.66791697924481 20.630157539384847 12-13 28.232058014503625 24.681170292573142 24.93123280820205 22.155538884721178 14-15 27.46936734183546 26.356589147286826 25.993998499624904 20.180045011252815 16-17 25.656414103525883 27.294323580895224 25.28132033008252 21.767941985496375 18-19 26.84421105276319 25.818954738684667 25.568892223055762 21.767941985496375 20-21 26.469117279319832 26.244061015253813 26.03150787696924 21.255313828457115 22-23 27.056764191047762 26.63165791447862 24.88122030507627 21.43035758939735 24-25 25.418854713678417 28.207051762940733 25.218804701175294 21.155288822205552 26-27 26.544136034008503 27.11927981995499 25.71892973243311 20.6176544136034 28-29 26.219054763690924 27.59439859964991 25.431357839459867 20.7551887971993 30-31 26.806701675418854 27.144286071517882 25.51887971992998 20.530132533133283 32-33 25.756439109777446 26.71917979494874 26.906726681670417 20.6176544136034 34-35 26.906726681670417 27.131782945736433 25.156289072268066 20.80520130032508 36-37 26.406601650412604 26.16904226056514 26.006501625406354 21.417854463615903 38-39 26.16904226056514 26.70667666916729 26.481620405101275 20.64266066516629 40-41 26.93173293323331 26.056514128532132 26.38159539884971 20.630157539384847 42-43 25.55638909727432 26.30657664416104 26.39409852463116 21.742935733933482 44-45 26.069017254313575 27.306826706676667 25.468867216804203 21.155288822205552 46-47 26.710016256096036 27.83543828935851 25.734650493935224 19.71989496061023 48-49 25.7661038148843 27.19199499687305 26.42901813633521 20.612883051907442 50-51 26.157117838378785 27.670753064798596 25.894420815611706 20.277708281210906 52-53 26.313813813813812 27.164664664664667 25.575575575575577 20.945945945945947 54-55 26.23279098873592 27.359198998748436 25.832290362953692 20.575719649561954 56-57 26.214321482223333 26.965448172258387 25.926389584376565 20.893840761141714 58-59 26.552328492739107 26.10165247871808 26.039058587881826 21.30696044066099 60-61 25.30045067601402 26.977966950425635 26.22684026039059 21.494742113169753 62-63 26.296018031555224 26.746806912096165 25.607312797395444 21.349862258953166 64-65 26.112016038090463 26.76356346322516 26.525498057887482 20.598922440796894 66-67 25.75187969924812 26.81704260651629 26.42857142857143 21.002506265664163 68-69 25.667376864268704 26.557212683293645 27.020929941095375 20.754480511342273 70-71 25.159834524257242 27.47900213112699 26.03735740253228 21.32380594208349 72-73 25.547445255474454 26.96954442486786 26.289957211175434 21.193053108482253 74-75 25.803440458727827 24.029870649419923 27.81704227230297 22.349646619549272 76 29.287598944591032 0.0 39.502450056539764 31.209950998869207 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 1.0 23 1.5 24 1.5 25 2.0 26 3.5 27 4.0 28 6.0 29 15.0 30 18.0 31 22.0 32 39.5 33 45.0 34 49.0 35 74.0 36 96.0 37 102.5 38 129.5 39 177.0 40 207.5 41 250.5 42 286.5 43 289.0 44 296.5 45 318.0 46 338.5 47 324.0 48 300.0 49 265.0 50 225.0 51 200.0 52 175.5 53 151.0 54 128.5 55 117.0 56 93.5 57 68.0 58 58.5 59 57.0 60 53.5 61 37.5 62 25.0 63 19.0 64 10.5 65 7.0 66 7.0 67 6.5 68 5.0 69 2.5 70 3.0 71 6.0 72 7.0 73 5.5 74 5.0 75 4.5 76 2.5 77 2.5 78 3.0 79 3.5 80 3.5 81 1.5 82 0.0 83 0.5 84 1.5 85 1.0 86 1.0 87 3.5 88 4.0 89 1.5 90 3.5 91 4.5 92 2.0 93 3.0 94 3.5 95 2.0 96 1.0 97 1.5 98 3.0 99 40.5 100 77.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.05 3 0.05 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 1.0 47 0.0 48 1.0 49 0.0 50 0.0 51 1.0 52 0.0 53 1.0 54 0.0 55 1.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 2.0 63 1.0 64 1.0 65 0.0 66 0.0 67 0.0 68 1.0 69 0.0 70 1.0 71 4.0 72 22.0 73 74.0 74 277.0 75 958.0 76 2653.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.825 #Duplication Level Percentage of deduplicated Percentage of total 1 98.88974954815389 95.75 2 1.0069713400464757 1.95 3 0.0774593338497289 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02581977794990963 2.075 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 83 2.075 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1429866 spots for SRR9668905.sra Written 1429866 spots for SRR9668905.sra Read 1429866 spots for SRR9668905.sra Written 1429866 spots for SRR9668905.sra Read 1429866 spots for SRR9668905.sra Written 1429866 spots for SRR9668905.sra Read 1429866 spots for SRR9668905.sra Written 1429866 spots for SRR9668905.sra Read 1429866 spots for SRR9668905.sra Written 1429866 spots for SRR9668905.sra Read 1429866 spots for SRR9668905.sra Written 1429866 spots for SRR9668905.sra Read 1429866 spots for SRR9668905.sra Written 1429866 spots for SRR9668905.sra Read 1429866 spots for SRR9668905.sra Written 1429866 spots for SRR9668905.sra Read 1429866 spots for SRR9668905.sra Written 1429866 spots for SRR9668905.sra Read 1429866 spots for SRR9668905.sra Written 1429866 spots for SRR9668905.sra Read 1429866 spots for SRR9668905.sra Written 1429866 spots for SRR9668905.sra Read 1429866 spots for SRR9668905.sra Written 1429866 spots for SRR9668905.sra Read 1429877 spots for SRR9668905.sra Written 1429877 spots for SRR9668905.sra Read 1429866 spots for SRR9668905.sra Written 1429866 spots for SRR9668905.sra Read 1429866 spots for SRR9668905.sra Written 1429866 spots for SRR9668905.sra Read 1429866 spots for SRR9668905.sra Written 1429866 spots for SRR9668905.sra Read 1429866 spots for SRR9668905.sra Written 1429866 spots for SRR9668905.sra Read 1429866 spots for SRR9668905.sra Written 1429866 spots for SRR9668905.sra Read 1429866 spots for SRR9668905.sra Written 1429866 spots for SRR9668905.sra Read 1429866 spots for SRR9668905.sra Written 1429866 spots for SRR9668905.sra SRR ids: ['SRR9668905.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8blkaxpr SRR9668905.sra spots: 28597331 blocks: [[1, 1429866], [1429867, 2859732], [2859733, 4289598], [4289599, 5719464], [5719465, 7149330], [7149331, 8579196], [8579197, 10009062], [10009063, 11438928], [11438929, 12868794], [12868795, 14298660], [14298661, 15728526], [15728527, 17158392], [17158393, 18588258], [18588259, 20018124], [20018125, 21447990], [21447991, 22877856], [22877857, 24307722], [24307723, 25737588], [25737589, 27167454], [27167455, 28597331]] SRR9668905 file size 5422171 SRR9668905 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668905 SRR9668905_1.fastq SRR9668905_2.fastq Input file: SRR9668905_1.fastq Paired file: SRR9668905_2.fastq trimmed: SRR9668905-trimmed-pair1.fastq, SRR9668905-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:33:25 2025 >> started Wed Feb 12 15:33:51 2025 >> done (26.628s) 28597331 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 15277 ( 0.05%) empty read pairs filtered out after trimming by size control 28582053 (99.95%) read pairs available; of these: 4124 ( 0.01%) trimmed read pairs available after processing 28577929 (99.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 2 0.00% 21 2 0.00% 22 4 0.00% 23 3 0.00% 24 8 0.00% 25 7 0.00% 26 10 0.00% 27 16 0.00% 28 17 0.00% 29 16 0.00% 30 23 0.00% 31 18 0.00% 32 25 0.00% 33 25 0.00% 34 32 0.00% 35 92 0.00% 36 152 0.00% 37 187 0.00% 38 215 0.00% 39 285 0.00% 40 401 0.00% 41 433 0.00% 42 461 0.00% 43 516 0.00% 44 602 0.00% 45 669 0.00% 46 745 0.00% 47 944 0.00% 48 1090 0.00% 49 1280 0.00% 50 1423 0.00% 51 1632 0.01% 52 1801 0.01% 53 1876 0.01% 54 1957 0.01% 55 2222 0.01% 56 2558 0.01% 57 2707 0.01% 58 3155 0.01% 59 3462 0.01% 60 3726 0.01% 61 3886 0.01% 62 4201 0.01% 63 4578 0.02% 64 4749 0.02% 65 5012 0.02% 66 5398 0.02% 67 5694 0.02% 68 5939 0.02% 69 6479 0.02% 70 7682 0.03% 71 9357 0.03% 72 24252 0.08% 73 250357 0.88% 74 2350836 8.22% 75 13782952 48.22% 76 12075882 42.25% 28582053 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=28 prefix-density=0.57 prefix-fanout=2.1 sequence=CTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=13.95 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.3 sequence=TATCATCAAGATGTAGCAAATATTTTTCTATCATATATTAATTAATGCCAATATAAATCAGCTTATTTATCACTAATATTCCAGGTAATAGAAGCACTAATTTCATAATCAGAAAGGTTTAGTAAGGTTTTTGCCCAACATAGTTGCCGGGTGGATCATAGTTGCACCCAATGAAGGTTCCTCCGGTGCTACACTTCACTTTAGCACATCCTAGGCGAGCAGAGTTACGCCAAACCACCTGAGTATAGTGCCCACACTGCTGGCCAGCGGCACATGAGTTGGAGTTGTAGTCGTAGTAAGCCTTCTCATCAACCCACAGTTTTACAGCATCTGTACCTGAAAGGTCCGCGCTGCTCCATGCAATGTTCTCCCCATAAGGTCCACCTGAATGGACAAGGTTGCAATCGCCGGCACGTTGGTTAGCATAATTTTGTGCATAGGCTTGCACTGTGGTGTCCCAGGTTAGTGGACCAACACCTACAGCTGCACGAGCTGCATTATGAGCATCAAG criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=34 prefix-density=0.17 prefix-fanout=2.0 sequence=CACCGCCGACCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=15.65 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.9 sequence=AGGAAAGGCTTACGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGTAAGCGACGAAATGCTTCGGGGAGTTGAAAATAAGCGTAGATCCGGAGATTCCCGAATAGGTCAACCTTTCAAACTGCTGCCGAATCCATGGGCAGGCAAGAGACAACCTGGCGAACTGAAACATCTTAGTAACCAGAGGAAAAGAA SRR9668905 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:34:19 Started mapping on | Feb 12 15:34:19 Finished on | Feb 12 15:35:45 Mapping speed, Million of reads per hour | 1196.46 Number of input reads | 28582053 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 24129986 Uniquely mapped reads % | 84.42% Average mapped length | 150.36 Number of splices: Total | 10703411 Number of splices: Annotated (sjdb) | 10584518 Number of splices: GT/AG | 10507248 Number of splices: GC/AG | 167429 Number of splices: AT/AC | 7252 Number of splices: Non-canonical | 21482 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.01% Insertion average length | 1.94 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1156284 % of reads mapped to multiple loci | 4.05% Number of reads mapped to too many loci | 1047942 % of reads mapped to too many loci | 3.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.72% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3295783 3295783 3295783 N_multimapping 1156284 1156284 1156284 N_noFeature 658436 23827580 758139 N_ambiguous 337280 1348 133523 UnstrandedReadsAssigned:23134270 PositiveStrandReadsAssigned:301058 NegativeStrandReadsAssigned:23238324 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668905 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668905-trimmed-pair1.fastq SRR9668905-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,582,053 reads, 24,939,041 reads pseudoaligned [quant] estimated average fragment length: 195.733 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52401 SRR9668905.ke.tsv 34699 SRR9668905.se.tsv 87100 total ==> SRR9668905.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1823.27 444 8.47504 Potri.005G024800.1.v4.1 1035 840.267 125 5.17728 Potri.004G059700.1.v4.1 961 766.267 42 1.90756 Potri.007G009000.2.v4.1 1416 1221.27 0 0 Potri.003G141000.2.v4.1 2943 2748.27 337.094 4.26875 Potri.016G087400.1.v4.1 270 92.5238 1786.67 672.045 Potri.015G069301.1.v4.1 564 369.497 0 0 Potri.010G195200.1.v4.1 1773 1578.27 11.2903 0.248961 Potri.012G127500.1.v4.1 977 782.267 5756 256.08 ==> SRR9668905.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 24 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 320 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 66 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 14 SRR9668905 completed mapping pipeline successfully