Starting /dee2/code/volunteer_pipeline.sh SRR9668906 current disk space = 3051882774528 free memory = 1464775824 SRR9668906 SRAfilesize a00a4b4f3fd4105a60dceabdbcae4e4a SRR9668906.sra SRR9668906.sra file validated SRR9668906 is paired end SRR9668906 is conventional basespace SRR9668906 read1 length is 40-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668906_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 40-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7535 32.0 32.0 32.0 32.0 32.0 2 31.66025 32.0 32.0 32.0 32.0 32.0 3 31.7285 32.0 32.0 32.0 32.0 32.0 4 31.75 32.0 32.0 32.0 32.0 32.0 5 31.75775 32.0 32.0 32.0 32.0 32.0 6 35.3615 36.0 36.0 36.0 36.0 36.0 7 35.53125 36.0 36.0 36.0 36.0 36.0 8 35.44625 36.0 36.0 36.0 36.0 36.0 9 35.466 36.0 36.0 36.0 36.0 36.0 10-11 35.31425 36.0 36.0 36.0 36.0 36.0 12-13 35.391875 36.0 36.0 36.0 36.0 36.0 14-15 35.385999999999996 36.0 36.0 36.0 36.0 36.0 16-17 35.275 36.0 36.0 36.0 36.0 36.0 18-19 35.363625 36.0 36.0 36.0 36.0 36.0 20-21 35.38175 36.0 36.0 36.0 36.0 36.0 22-23 35.2815 36.0 36.0 36.0 36.0 36.0 24-25 35.28325 36.0 36.0 36.0 36.0 36.0 26-27 35.247875 36.0 36.0 36.0 36.0 36.0 28-29 35.302499999999995 36.0 36.0 36.0 36.0 36.0 30-31 35.164125 36.0 36.0 36.0 36.0 36.0 32-33 35.208375000000004 36.0 36.0 36.0 36.0 36.0 34-35 35.13975 36.0 36.0 36.0 36.0 36.0 36-37 35.215374999999995 36.0 36.0 36.0 36.0 36.0 38-39 35.1625 36.0 36.0 36.0 36.0 36.0 40-41 35.18565097524381 36.0 36.0 36.0 36.0 36.0 42-43 35.130782695673915 36.0 36.0 36.0 36.0 36.0 44-45 35.105151287821954 36.0 36.0 36.0 36.0 36.0 46-47 34.95161290322581 36.0 36.0 36.0 36.0 36.0 48-49 35.07214303575894 36.0 36.0 36.0 36.0 36.0 50-51 35.04163975586192 36.0 36.0 36.0 36.0 36.0 52-53 34.941720860430216 36.0 36.0 36.0 34.0 36.0 54-55 34.8936890261493 36.0 36.0 36.0 34.0 36.0 56-57 34.85862410446474 36.0 36.0 36.0 34.0 36.0 58-59 34.75807259073842 36.0 36.0 36.0 32.0 36.0 60-61 34.71722543138864 36.0 36.0 36.0 32.0 36.0 62-63 34.78302774803488 36.0 36.0 36.0 34.0 36.0 64-65 34.79441242796291 36.0 36.0 36.0 32.0 36.0 66-67 34.68601153171221 36.0 36.0 36.0 32.0 36.0 68-69 34.580345951366255 36.0 36.0 36.0 32.0 36.0 70-71 34.61939164196022 36.0 36.0 36.0 32.0 36.0 72-73 34.57174158239667 36.0 36.0 36.0 32.0 36.0 74-75 34.500517151808175 36.0 36.0 36.0 32.0 36.0 76 33.67070401211203 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 1.0 24 4.0 25 16.0 26 20.0 27 24.0 28 24.0 29 48.0 30 72.0 31 76.0 32 97.0 33 193.0 34 449.0 35 2972.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.1 11.95 10.549999999999999 40.400000000000006 2 19.75 15.875 37.15 27.224999999999998 3 19.875 19.2 24.775 36.15 4 24.275 28.499999999999996 21.45 25.775 5 23.075000000000003 32.85 24.275 19.8 6 20.575 33.725 25.025 20.674999999999997 7 15.75 22.1 43.0 19.15 8 18.4 22.275 33.15 26.174999999999997 9 19.275000000000002 22.625 34.075 24.025 10-11 22.075 30.9875 22.9375 24.0 12-13 21.4 24.125 28.175 26.3 14-15 20.875 26.3 27.375 25.45 16-17 21.488430268918073 26.67917448405253 26.7667292057536 25.065666041275797 18-19 21.087500000000002 26.9125 27.05 24.95 20-21 21.099999999999998 26.55 27.537499999999998 24.8125 22-23 21.15 26.224999999999998 27.55 25.074999999999996 24-25 21.775 26.2625 25.9875 25.974999999999998 26-27 21.5375 27.1 26.650000000000002 24.712500000000002 28-29 22.05 26.437500000000004 26.474999999999998 25.0375 30-31 21.125703564727953 26.866791744840523 26.7667292057536 25.240775484677926 32-33 20.825 25.95 28.15 25.074999999999996 34-35 22.0625 26.3625 26.974999999999998 24.6 36-37 20.5 27.450000000000003 26.474999999999998 25.575 38-39 21.0 26.525 25.775 26.700000000000003 40-41 21.990248781097637 27.55344418052256 25.828228528566072 24.62807850981373 42-43 21.642910727681922 26.544136034008503 27.181795448862218 24.63115778944736 44-45 21.85546386596649 26.319079769942487 27.494373593398347 24.33108277069267 46-47 22.06801700425106 26.6816704176044 26.63165791447862 24.618654663665918 48-49 21.005251312828207 27.019254813703427 27.206801700425103 24.76869217304326 50-51 20.94535450794048 26.985119419782418 26.50994122796049 25.559584844316618 52-53 21.448224112056028 26.638319159579787 26.813406703351678 25.100050025012504 54-55 21.776110068792995 26.85428392745466 26.6541588492808 24.715447154471544 56-57 20.755661203553107 25.810083823345426 27.82434630301514 25.609908670086323 58-59 20.425531914893615 27.183979974968707 27.63454317897372 24.755944931163956 60-61 20.6784328451621 26.761797471523348 26.98710727249969 25.57266241081487 62-63 22.426746806912096 26.70924117205109 25.88279489105935 24.98121712997746 64-65 20.821849160611375 27.211225256827866 26.259082936607363 25.707842645953395 66-67 21.27099523690148 27.01178240160441 25.758335422411633 25.958886939082475 68-69 21.358736525444975 26.10930057658561 27.488092253697673 25.04387064427175 70-71 21.61213488780243 26.93995236304375 26.26300614266015 25.18490660649367 72-73 21.707961262734248 25.996729971072817 26.927430511885298 25.367878254307634 74-75 22.29738692134235 23.013662289428304 28.412256267409468 26.27669452181987 76 23.126419379258138 0.0 40.76457229371688 36.10900832702498 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 2.5 20 2.0 21 1.0 22 2.0 23 4.0 24 4.5 25 4.0 26 4.5 27 9.0 28 18.0 29 22.5 30 20.5 31 29.0 32 40.0 33 46.5 34 59.0 35 86.5 36 112.0 37 118.5 38 125.0 39 140.5 40 186.0 41 216.5 42 218.5 43 242.5 44 266.5 45 273.0 46 274.5 47 292.0 48 304.0 49 285.0 50 272.0 51 251.0 52 215.0 53 179.5 54 158.0 55 141.5 56 128.0 57 120.0 58 106.0 59 92.5 60 71.0 61 48.0 62 34.5 63 27.5 64 17.0 65 12.5 66 11.0 67 9.5 68 7.0 69 3.5 70 3.0 71 3.5 72 4.0 73 6.0 74 4.0 75 1.5 76 1.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0625 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0625 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 40 1.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 1.0 51 0.0 52 0.0 53 0.0 54 1.0 55 0.0 56 1.0 57 1.0 58 0.0 59 0.0 60 1.0 61 0.0 62 2.0 63 1.0 64 0.0 65 2.0 66 0.0 67 0.0 68 0.0 69 0.0 70 1.0 71 6.0 72 13.0 73 62.0 74 275.0 75 990.0 76 2642.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.7 #Duplication Level Percentage of deduplicated Percentage of total 1 96.36886102403344 92.225 2 3.0564263322884013 5.8500000000000005 3 0.3657262277951933 1.05 4 0.1567398119122257 0.6 5 0.026123301985370953 0.125 6 0.026123301985370953 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCAGAACCCAAAAACTTTGATTTCTCATAAGGTGCTGGCGGAGTCCTAAA 6 0.15 No Hit CCCGTGTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668906 read2 length is 40-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668906_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 40-76 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.35375 32.0 32.0 32.0 32.0 32.0 2 31.185 32.0 32.0 32.0 32.0 32.0 3 31.34075 32.0 32.0 32.0 32.0 32.0 4 31.2635 32.0 32.0 32.0 32.0 32.0 5 31.1455 32.0 32.0 32.0 32.0 32.0 6 34.78925 36.0 36.0 36.0 36.0 36.0 7 34.75725 36.0 36.0 36.0 36.0 36.0 8 34.78725 36.0 36.0 36.0 36.0 36.0 9 34.74475 36.0 36.0 36.0 36.0 36.0 10-11 34.748125 36.0 36.0 36.0 36.0 36.0 12-13 34.7695 36.0 36.0 36.0 36.0 36.0 14-15 34.744749999999996 36.0 36.0 36.0 36.0 36.0 16-17 34.6685 36.0 36.0 36.0 34.0 36.0 18-19 34.7315 36.0 36.0 36.0 34.0 36.0 20-21 34.584375 36.0 36.0 36.0 34.0 36.0 22-23 34.502624999999995 36.0 36.0 36.0 32.0 36.0 24-25 34.566 36.0 36.0 36.0 32.0 36.0 26-27 34.536125 36.0 36.0 36.0 32.0 36.0 28-29 34.4125 36.0 36.0 36.0 32.0 36.0 30-31 34.39625 36.0 36.0 36.0 32.0 36.0 32-33 34.335375 36.0 36.0 36.0 32.0 36.0 34-35 34.320750000000004 36.0 36.0 36.0 32.0 36.0 36-37 34.447874999999996 36.0 36.0 36.0 32.0 36.0 38-39 34.37025 36.0 36.0 36.0 32.0 36.0 40-41 34.388675731432855 36.0 36.0 36.0 32.0 36.0 42-43 34.36109027256814 36.0 36.0 36.0 32.0 36.0 44-45 34.15791447861966 36.0 36.0 36.0 32.0 36.0 46-47 34.21517879469867 36.0 36.0 36.0 32.0 36.0 48-49 34.257439359839964 36.0 36.0 36.0 32.0 36.0 50-51 34.09254255159588 36.0 36.0 36.0 32.0 36.0 52-53 34.10792896448224 36.0 36.0 36.0 32.0 36.0 54-55 34.07055138152013 36.0 36.0 36.0 32.0 36.0 56-57 34.08632365790859 36.0 36.0 36.0 32.0 36.0 58-59 34.02528160200251 36.0 36.0 36.0 32.0 36.0 60-61 33.909866928051656 36.0 36.0 36.0 29.5 36.0 62-63 33.97433637931847 36.0 36.0 36.0 32.0 36.0 64-65 34.03420195439739 36.0 36.0 36.0 32.0 36.0 66-67 33.838305339684126 36.0 36.0 36.0 27.0 36.0 68-69 33.92115818500878 36.0 36.0 36.0 32.0 36.0 70-71 33.86800681563366 36.0 36.0 36.0 29.5 36.0 72-73 33.801592802719654 36.0 36.0 36.0 27.0 36.0 74-75 33.75146204290367 36.0 36.0 36.0 27.0 36.0 76 33.04112221368178 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 10.0 16 20.0 17 19.0 18 20.0 19 9.0 20 4.0 21 10.0 22 15.0 23 17.0 24 16.0 25 26.0 26 28.0 27 39.0 28 53.0 29 53.0 30 63.0 31 102.0 32 136.0 33 230.0 34 521.0 35 2609.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.67935871743487 18.887775551102205 12.600200400801603 28.83266533066132 2 30.86543271635818 24.337168584292147 29.48974487243622 15.307653826913455 3 25.275 25.124999999999996 27.250000000000004 22.35 4 28.275 32.65 19.625 19.45 5 29.599999999999998 34.75 18.875 16.775000000000002 6 23.925 35.6 20.424999999999997 20.05 7 23.799999999999997 17.875 36.275 22.05 8 25.95 22.975 25.624999999999996 25.45 9 25.900000000000002 24.55 26.674999999999997 22.875 10-11 27.787499999999998 29.912499999999998 20.65 21.65 12-13 27.224999999999998 24.05 25.3125 23.4125 14-15 26.775 25.9625 26.5 20.7625 16-17 26.9125 26.724999999999998 25.412499999999998 20.95 18-19 27.3 25.25 25.412499999999998 22.037499999999998 20-21 26.787499999999998 26.724999999999998 25.1 21.3875 22-23 27.474999999999998 25.45 24.1625 22.912499999999998 24-25 27.187499999999996 25.912499999999998 25.087500000000002 21.8125 26-27 26.900000000000002 25.874999999999996 25.5625 21.6625 28-29 25.662499999999998 27.0 25.174999999999997 22.162499999999998 30-31 27.075 26.0125 25.224999999999998 21.6875 32-33 26.787499999999998 26.6625 25.0375 21.512500000000003 34-35 26.4625 26.3625 25.624999999999996 21.55 36-37 26.55 26.437500000000004 25.162499999999998 21.85 38-39 25.825 26.8625 26.737499999999997 20.575 40-41 26.89086135766971 26.24078009751219 25.378172271533945 21.49018627328416 42-43 26.569142285571395 27.35683920980245 25.168792198049513 20.905226306576644 44-45 26.644161040260066 27.019254813703427 25.206301575393848 21.13028257064266 46-47 26.944236059014752 26.456614153538382 25.068767191797946 21.530382595648913 48-49 26.93173293323331 26.056514128532132 24.981245311327832 22.030507626906726 50-51 26.79754908090534 26.860072527197698 25.32199574840565 21.02038264349131 52-53 26.76338169084542 26.275637818909452 26.20060030015007 20.76038019009505 54-55 26.804252657911192 26.779237023139462 25.240775484677926 21.17573483427142 56-57 26.86100337795571 27.236331790316527 24.996872263230326 20.905792568497436 58-59 27.384230287859822 25.882352941176475 26.020025031289112 20.713391739674595 60-61 26.874452372011515 26.42383277005883 24.921767430216548 21.779947427713108 62-63 27.122464312546956 26.82193839218633 25.36939644377661 20.686200851490106 64-65 26.55975945878226 26.07116011024806 25.532448008018036 21.83663242295164 66-67 26.29731762346453 27.14966156931562 25.294560040110305 21.25846076710955 68-69 25.846076710955128 27.500626723489596 25.294560040110305 21.358736525444975 70-71 26.36329447160587 26.701767581797668 25.31026701767582 21.624670928920647 72-73 27.019884218474704 26.289957211175434 24.565819280140953 22.124339290208912 74-75 25.845249231591605 24.522250434317787 26.780702926633705 22.851797407456903 76 30.3228285933897 0.0 37.62490392006149 32.05226748654881 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 1.0 24 1.5 25 2.5 26 3.5 27 4.5 28 5.5 29 8.0 30 13.5 31 20.5 32 30.5 33 37.0 34 42.0 35 65.5 36 93.5 37 101.5 38 123.0 39 155.5 40 177.0 41 211.5 42 244.5 43 260.0 44 285.5 45 298.5 46 301.0 47 314.5 48 286.5 49 239.0 50 229.0 51 213.5 52 176.0 53 155.0 54 152.0 55 155.0 56 146.5 57 118.5 58 98.5 59 84.5 60 65.0 61 55.0 62 51.0 63 33.0 64 15.0 65 17.0 66 17.0 67 13.0 68 12.5 69 11.5 70 8.0 71 7.0 72 10.5 73 10.5 74 5.5 75 3.0 76 2.5 77 3.5 78 4.5 79 3.5 80 3.5 81 2.0 82 0.0 83 0.0 84 1.0 85 2.0 86 2.0 87 2.0 88 1.0 89 0.5 90 1.5 91 1.0 92 0.0 93 0.5 94 1.5 95 1.5 96 1.0 97 1.5 98 4.5 99 35.0 100 63.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 40 1.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 1.0 51 0.0 52 0.0 53 0.0 54 1.0 55 0.0 56 1.0 57 1.0 58 0.0 59 0.0 60 1.0 61 0.0 62 2.0 63 1.0 64 0.0 65 2.0 66 0.0 67 0.0 68 0.0 69 0.0 70 1.0 71 5.0 72 20.0 73 75.0 74 293.0 75 993.0 76 2602.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.45 #Duplication Level Percentage of deduplicated Percentage of total 1 96.7443091582848 91.375 2 2.6998411858125992 5.1 3 0.42350449973530974 1.2 4 0.07940709370037057 0.3 5 0.0 0.0 6 0.0 0.0 7 0.02646903123345686 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02646903123345686 1.8499999999999999 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 74 1.8499999999999999 No Hit GTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTCG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1428976 spots for SRR9668906.sra Written 1428976 spots for SRR9668906.sra Read 1428976 spots for SRR9668906.sra Written 1428976 spots for SRR9668906.sra Read 1428976 spots for SRR9668906.sra Written 1428976 spots for SRR9668906.sra Read 1428976 spots for SRR9668906.sra Written 1428976 spots for SRR9668906.sra Read 1428976 spots for SRR9668906.sra Written 1428976 spots for SRR9668906.sra Read 1428976 spots for SRR9668906.sra Written 1428976 spots for SRR9668906.sra Read 1428976 spots for SRR9668906.sra Written 1428976 spots for SRR9668906.sra Read 1428976 spots for SRR9668906.sra Written 1428976 spots for SRR9668906.sra Read 1428976 spots for SRR9668906.sra Written 1428976 spots for SRR9668906.sra Read 1428989 spots for SRR9668906.sra Written 1428989 spots for SRR9668906.sra Read 1428976 spots for SRR9668906.sra Written 1428976 spots for SRR9668906.sra Read 1428976 spots for SRR9668906.sra Written 1428976 spots for SRR9668906.sra Read 1428976 spots for SRR9668906.sra Written 1428976 spots for SRR9668906.sra Read 1428976 spots for SRR9668906.sra Written 1428976 spots for SRR9668906.sra Read 1428976 spots for SRR9668906.sra Written 1428976 spots for SRR9668906.sra Read 1428976 spots for SRR9668906.sra Written 1428976 spots for SRR9668906.sra Read 1428976 spots for SRR9668906.sra Written 1428976 spots for SRR9668906.sra Read 1428976 spots for SRR9668906.sra Written 1428976 spots for SRR9668906.sra Read 1428976 spots for SRR9668906.sra Written 1428976 spots for SRR9668906.sra Read 1428976 spots for SRR9668906.sra Written 1428976 spots for SRR9668906.sra SRR ids: ['SRR9668906.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l_rk52q0 SRR9668906.sra spots: 28579533 blocks: [[1, 1428976], [1428977, 2857952], [2857953, 4286928], [4286929, 5715904], [5715905, 7144880], [7144881, 8573856], [8573857, 10002832], [10002833, 11431808], [11431809, 12860784], [12860785, 14289760], [14289761, 15718736], [15718737, 17147712], [17147713, 18576688], [18576689, 20005664], [20005665, 21434640], [21434641, 22863616], [22863617, 24292592], [24292593, 25721568], [25721569, 27150544], [27150545, 28579533]] SRR9668906 file size 5419661 SRR9668906 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668906 SRR9668906_1.fastq SRR9668906_2.fastq Input file: SRR9668906_1.fastq Paired file: SRR9668906_2.fastq trimmed: SRR9668906-trimmed-pair1.fastq, SRR9668906-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:00:21 2025 >> started Wed Feb 12 16:01:01 2025 >> done (39.493s) 28579533 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 11555 ( 0.04%) empty read pairs filtered out after trimming by size control 28567977 (99.96%) read pairs available; of these: 3603 ( 0.01%) trimmed read pairs available after processing 28564374 (99.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 22 2 0.00% 23 4 0.00% 24 5 0.00% 25 2 0.00% 26 1 0.00% 27 11 0.00% 28 8 0.00% 29 9 0.00% 30 8 0.00% 31 14 0.00% 32 13 0.00% 33 14 0.00% 34 16 0.00% 35 111 0.00% 36 132 0.00% 37 172 0.00% 38 195 0.00% 39 284 0.00% 40 360 0.00% 41 422 0.00% 42 438 0.00% 43 539 0.00% 44 652 0.00% 45 697 0.00% 46 769 0.00% 47 936 0.00% 48 1152 0.00% 49 1318 0.00% 50 1468 0.01% 51 1778 0.01% 52 1997 0.01% 53 2207 0.01% 54 2278 0.01% 55 2744 0.01% 56 2939 0.01% 57 3175 0.01% 58 3555 0.01% 59 3944 0.01% 60 4302 0.02% 61 4854 0.02% 62 5064 0.02% 63 5667 0.02% 64 5796 0.02% 65 6270 0.02% 66 6703 0.02% 67 6984 0.02% 68 7429 0.03% 69 8084 0.03% 70 9515 0.03% 71 12094 0.04% 72 25941 0.09% 73 235122 0.82% 74 2241659 7.85% 75 13486958 47.21% 76 12461166 43.62% 28567977 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=28 prefix-density=0.47 prefix-fanout=2.0 sequence=CCGTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCAGAACCCAAAAACTTTGATTTCTCATAAGGTGCTGGCGGAGTCCTAAAAGCAACATCCGCCAATCCCTGGTCGGCATCGTTTATGGTTGAGACTAGGACGGTATCTGATCGTCTTCGAGCCCCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCAAATGCTTTCGCAGTTGTTCGTCTTTCATAAATCCAAGAATTTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAAGGCCAGGAGCGCATCGCCG criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=13.66 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.2 sequence=CAACTTCCTTGACCTTCCGGCACTGGGCAGGCGTCAGCCCCCATACATGGTCTTACGACTTTGCGGAGACCTGTGTTTTTGGTAAACAGTCGCCCGGGCCTGGTCACTGCGACCCCCTTTGTGAGGAGGCACCCCTTCTCCCGAAGTTACGGGGCTATTTTGCCGAGTTCCTTAGAGAGAGTTGTCTCGCGCCCCTAGGTATTCTCTACCTACCCACCTGTGTCGGTTTCGGGTACAGGTACCCTTTTGT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=34 prefix-density=0.33 prefix-fanout=1.9 sequence=GAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGTCCCTAGCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=14.07 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=1.9 sequence=GGCCGTCGGTGCAGATCTTGGTGGTAGTAGCAAATATTCAAATGAGAACTTTGAAGGCCGAAGAGGGGAAAGGTTCCATGTGAACGGCACTTGCACATGGGTTAGTCGATCCTAAGAGACGGGGGAAGCCCGTCCGACAGCGCGTTCGCGCGCGAGCTTCGAAAGGGAATCGGGTTAAAATTCCTGAACCGGGACGTGGCGGCTGACGGCAACGTTAGGGAGTCCGGAGACGTCGGCGGGGGCCTCGGGAAGAGTTATCTTTTCTGTTTAACAGCCCGCCCACCCTGGAAACGACTTAGTCGGAGGTAGGGTCCAGCGGCTGGAAGAGCACCGCACGTCGCGTGGTGTCCGGTGCGCCCCCGGCGGCCCTTGAAAATCCGGAGGACCGAGTGCCTCCCACGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAACAGCCTCTGGTCGATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTCGGGAAAAGG SRR9668906 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:01:29 Started mapping on | Feb 12 16:01:30 Finished on | Feb 12 16:04:51 Mapping speed, Million of reads per hour | 511.67 Number of input reads | 28567977 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 21724526 Uniquely mapped reads % | 76.05% Average mapped length | 150.31 Number of splices: Total | 9197452 Number of splices: Annotated (sjdb) | 9100149 Number of splices: GT/AG | 9027324 Number of splices: GC/AG | 145802 Number of splices: AT/AC | 6017 Number of splices: Non-canonical | 18309 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.02% Deletion average length | 2.14 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1267086 % of reads mapped to multiple loci | 4.44% Number of reads mapped to too many loci | 3501862 % of reads mapped to too many loci | 12.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.82% % of reads unmapped: other | 0.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5576365 5576365 5576365 N_multimapping 1267086 1267086 1267086 N_noFeature 1449909 21386949 1529539 N_ambiguous 376209 1636 116842 UnstrandedReadsAssigned:19898408 PositiveStrandReadsAssigned:335941 NegativeStrandReadsAssigned:20078145 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668906 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668906-trimmed-pair1.fastq SRR9668906-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,567,977 reads, 23,274,803 reads pseudoaligned [quant] estimated average fragment length: 196.25 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,247 rounds 52401 SRR9668906.ke.tsv 34699 SRR9668906.se.tsv 87100 total ==> SRR9668906.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1822.75 357 6.52742 Potri.005G024800.1.v4.1 1035 839.75 106 4.20685 Potri.004G059700.1.v4.1 961 765.75 54 2.35021 Potri.007G009000.2.v4.1 1416 1220.75 0 0 Potri.003G141000.2.v4.1 2943 2747.75 307.222 3.72628 Potri.016G087400.1.v4.1 270 92.976 1426.54 511.345 Potri.015G069301.1.v4.1 564 368.976 0 0 Potri.010G195200.1.v4.1 1773 1577.75 2 0.0422467 Potri.012G127500.1.v4.1 977 781.75 4964 211.624 ==> SRR9668906.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 16 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 275 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 45 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR9668906 completed mapping pipeline successfully