Starting /dee2/code/volunteer_pipeline.sh SRR9668907 current disk space = 3051838435328 free memory = 1496685056 SRR9668907 SRAfilesize 973bfa4f9672f474265cc3e28780ef89 SRR9668907.sra SRR9668907.sra file validated SRR9668907 is paired end SRR9668907 is conventional basespace SRR9668907 read1 length is 49-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668907_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 49-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6425 32.0 32.0 32.0 32.0 32.0 2 31.598 32.0 32.0 32.0 32.0 32.0 3 31.727 32.0 32.0 32.0 32.0 32.0 4 31.794 32.0 32.0 32.0 32.0 32.0 5 31.7135 32.0 32.0 32.0 32.0 32.0 6 35.3065 36.0 36.0 36.0 36.0 36.0 7 35.45375 36.0 36.0 36.0 36.0 36.0 8 35.428 36.0 36.0 36.0 36.0 36.0 9 35.4265 36.0 36.0 36.0 36.0 36.0 10-11 35.32925 36.0 36.0 36.0 36.0 36.0 12-13 35.377875 36.0 36.0 36.0 36.0 36.0 14-15 35.414625 36.0 36.0 36.0 36.0 36.0 16-17 35.28225 36.0 36.0 36.0 36.0 36.0 18-19 35.336875 36.0 36.0 36.0 36.0 36.0 20-21 35.3595 36.0 36.0 36.0 36.0 36.0 22-23 35.325375 36.0 36.0 36.0 36.0 36.0 24-25 35.256875 36.0 36.0 36.0 36.0 36.0 26-27 35.30775 36.0 36.0 36.0 36.0 36.0 28-29 35.313 36.0 36.0 36.0 36.0 36.0 30-31 35.207875 36.0 36.0 36.0 36.0 36.0 32-33 35.23175 36.0 36.0 36.0 36.0 36.0 34-35 35.155375 36.0 36.0 36.0 36.0 36.0 36-37 35.14975 36.0 36.0 36.0 36.0 36.0 38-39 35.207625 36.0 36.0 36.0 36.0 36.0 40-41 35.25 36.0 36.0 36.0 36.0 36.0 42-43 35.22325 36.0 36.0 36.0 36.0 36.0 44-45 35.162499999999994 36.0 36.0 36.0 36.0 36.0 46-47 35.103624999999994 36.0 36.0 36.0 36.0 36.0 48-49 35.089375 36.0 36.0 36.0 36.0 36.0 50-51 35.06914228557139 36.0 36.0 36.0 36.0 36.0 52-53 34.96311577894474 36.0 36.0 36.0 34.0 36.0 54-55 34.926106526631656 36.0 36.0 36.0 34.0 36.0 56-57 34.93221610805402 36.0 36.0 36.0 36.0 36.0 58-59 34.84504752376188 36.0 36.0 36.0 32.0 36.0 60-61 34.836918459229615 36.0 36.0 36.0 32.0 36.0 62-63 34.81285964473355 36.0 36.0 36.0 34.0 36.0 64-65 34.831831831831835 36.0 36.0 36.0 34.0 36.0 66-67 34.88510638297872 36.0 36.0 36.0 32.0 36.0 68-69 34.60536233852406 36.0 36.0 36.0 32.0 36.0 70-71 34.71564090973227 36.0 36.0 36.0 32.0 36.0 72-73 34.66012441004304 36.0 36.0 36.0 32.0 36.0 74-75 34.583045325066436 36.0 36.0 36.0 32.0 36.0 76 33.8721568627451 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 2.0 20 1.0 21 0.0 22 0.0 23 2.0 24 9.0 25 7.0 26 20.0 27 23.0 28 43.0 29 42.0 30 49.0 31 79.0 32 110.0 33 162.0 34 392.0 35 3058.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.6 14.549999999999999 7.6499999999999995 31.2 2 22.175 17.65 35.425000000000004 24.75 3 18.95 23.549999999999997 26.075 31.424999999999997 4 23.7 31.324999999999996 22.175 22.8 5 22.525000000000002 36.5 22.025 18.95 6 19.8 35.325 23.75 21.125 7 16.3 23.25 41.9 18.55 8 17.125 23.974999999999998 31.574999999999996 27.325 9 18.35 23.0 31.775 26.875 10-11 21.2875 31.887500000000003 23.3 23.525 12-13 20.962500000000002 25.337500000000002 28.1875 25.5125 14-15 21.15 26.5625 27.275 25.0125 16-17 21.013133208255162 26.31644777986241 27.929956222639152 24.740462789243278 18-19 21.0625 27.537499999999998 27.450000000000003 23.95 20-21 21.4875 27.462500000000002 27.05 24.0 22-23 21.1375 29.212500000000002 25.412499999999998 24.2375 24-25 21.1625 27.762500000000003 26.3 24.775 26-27 21.4 27.875 25.85 24.875 28-29 21.337500000000002 28.125 25.9625 24.575 30-31 21.393719504566498 28.1120980858251 26.53571875390967 23.958463655698736 32-33 20.225 27.9375 26.637499999999996 25.2 34-35 21.099999999999998 27.5125 27.275 24.1125 36-37 20.5625 28.3125 27.3 23.825 38-39 20.625 27.6625 27.35 24.3625 40-41 21.125 28.075 26.724999999999998 24.075 42-43 21.2875 27.500000000000004 27.187499999999996 24.025 44-45 21.212500000000002 27.500000000000004 26.337500000000002 24.95 46-47 21.325 27.875 27.1375 23.6625 48-49 20.7125 28.287499999999998 26.400000000000002 24.6 50-51 20.830207551887973 27.656914228557138 27.319329832458116 24.193548387096776 52-53 21.255313828457115 28.557139284821204 25.406351587896975 24.781195298824706 54-55 20.505126281570394 27.631907976994246 26.906726681670417 24.956239059764943 56-57 20.69784892446223 28.38919459729865 26.93846923461731 23.974487243621812 58-59 20.597798899449725 27.213606803401703 26.988494247123562 25.200100050025014 60-61 20.735367683841922 28.489244622311155 26.113056528264135 24.662331165582792 62-63 21.778834125594194 27.08281210908181 27.708281210908183 23.430072554415812 64-65 21.70920920920921 27.314814814814813 26.876876876876878 24.0990990990991 66-67 20.926157697121404 27.15894868585732 27.55944931163955 24.355444305381727 68-69 20.082634280706145 27.72004507324402 27.419556779767124 24.777763866282708 70-71 21.721157459601653 27.746461230113994 26.205687085055747 24.32669422522861 72-73 21.44832788534071 27.520744279607744 27.093286396781497 23.937641438270052 74-75 20.62158196611978 23.422702414299053 28.63812191543284 27.317593704148322 76 22.823529411764707 0.0 41.13725490196079 36.03921568627451 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 2.0 20 3.0 21 3.5 22 6.0 23 7.0 24 6.0 25 5.5 26 10.0 27 14.0 28 17.0 29 21.5 30 32.5 31 42.5 32 45.0 33 52.0 34 65.0 35 99.5 36 129.0 37 135.5 38 152.5 39 160.0 40 170.0 41 206.5 42 218.5 43 248.5 44 290.0 45 301.0 46 313.5 47 308.5 48 298.5 49 273.0 50 253.5 51 240.5 52 217.5 53 185.5 54 147.5 55 122.5 56 100.0 57 81.5 58 68.0 59 61.0 60 50.0 61 31.5 62 20.0 63 14.5 64 8.0 65 8.0 66 6.0 67 4.0 68 3.0 69 3.0 70 4.5 71 4.0 72 1.5 73 1.0 74 1.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0625 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.08750000000000001 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 49 1.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 1.0 64 0.0 65 1.0 66 0.0 67 1.0 68 1.0 69 1.0 70 1.0 71 3.0 72 22.0 73 83.0 74 269.0 75 1064.0 76 2550.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.3 #Duplication Level Percentage of deduplicated Percentage of total 1 97.84172661870504 95.19999999999999 2 1.644398766700925 3.2 3 0.43679342240493313 1.275 4 0.051387461459403906 0.2 5 0.025693730729701953 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGAATACATCAGTGTAGCGCGCGTGCGGCCCAGAACATCTAAGGGCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668907 read2 length is 49-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668907_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 49-76 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.201 32.0 32.0 32.0 32.0 32.0 2 31.08825 32.0 32.0 32.0 32.0 32.0 3 31.177 32.0 32.0 32.0 32.0 32.0 4 31.12 32.0 32.0 32.0 32.0 32.0 5 31.12575 32.0 32.0 32.0 32.0 32.0 6 34.69975 36.0 36.0 36.0 32.0 36.0 7 34.75025 36.0 36.0 36.0 36.0 36.0 8 34.51275 36.0 36.0 36.0 32.0 36.0 9 34.542 36.0 36.0 36.0 32.0 36.0 10-11 34.545874999999995 36.0 36.0 36.0 32.0 36.0 12-13 34.50375 36.0 36.0 36.0 32.0 36.0 14-15 34.5265 36.0 36.0 36.0 34.0 36.0 16-17 34.410875000000004 36.0 36.0 36.0 32.0 36.0 18-19 34.378875 36.0 36.0 36.0 32.0 36.0 20-21 34.264624999999995 36.0 36.0 36.0 32.0 36.0 22-23 34.2425 36.0 36.0 36.0 32.0 36.0 24-25 34.22075 36.0 36.0 36.0 32.0 36.0 26-27 34.15975 36.0 36.0 36.0 32.0 36.0 28-29 34.092625 36.0 36.0 36.0 32.0 36.0 30-31 34.10375 36.0 36.0 36.0 32.0 36.0 32-33 34.047375 36.0 36.0 36.0 32.0 36.0 34-35 33.99025 36.0 36.0 36.0 32.0 36.0 36-37 34.028000000000006 36.0 36.0 36.0 32.0 36.0 38-39 34.059 36.0 36.0 36.0 32.0 36.0 40-41 34.002125 36.0 36.0 36.0 32.0 36.0 42-43 33.98225 36.0 36.0 36.0 32.0 36.0 44-45 33.947 36.0 36.0 36.0 29.5 36.0 46-47 33.877625 36.0 36.0 36.0 29.5 36.0 48-49 33.803625 36.0 36.0 36.0 29.5 36.0 50-51 33.794698674668666 36.0 36.0 36.0 27.0 36.0 52-53 33.82533133283321 36.0 36.0 36.0 29.5 36.0 54-55 33.683045761440354 36.0 36.0 36.0 27.0 36.0 56-57 33.739369684842416 36.0 36.0 36.0 27.0 36.0 58-59 33.69009504752376 36.0 36.0 36.0 27.0 36.0 60-61 33.620810405202604 36.0 36.0 36.0 27.0 36.0 62-63 33.61458593945459 36.0 36.0 36.0 27.0 36.0 64-65 33.59597097097097 36.0 36.0 36.0 27.0 36.0 66-67 33.54130162703379 36.0 36.0 36.0 27.0 36.0 68-69 33.53725062195515 36.0 36.0 36.0 27.0 36.0 70-71 33.48796888763066 36.0 36.0 36.0 27.0 36.0 72-73 33.534324717921876 36.0 36.0 36.0 27.0 36.0 74-75 33.35720127592408 36.0 36.0 36.0 24.0 36.0 76 32.855828220858896 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 6.0 15 28.0 16 37.0 17 34.0 18 29.0 19 23.0 20 15.0 21 10.0 22 11.0 23 19.0 24 12.0 25 27.0 26 25.0 27 35.0 28 43.0 29 54.0 30 76.0 31 85.0 32 105.0 33 183.0 34 499.0 35 2644.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.99398194583751 20.887662988966902 10.456369107321965 20.661985957873622 2 31.632908227056767 24.20605151287822 28.557139284821204 15.603900975243812 3 25.6 25.924999999999997 28.599999999999998 19.875 4 29.7 32.65 19.475 18.175 5 29.625 34.225 19.900000000000002 16.25 6 25.15 34.775 20.8 19.275000000000002 7 25.525 19.325 35.099999999999994 20.05 8 25.15 24.3 24.55 26.0 9 26.025 24.8 26.525 22.650000000000002 10-11 28.712500000000002 29.049999999999997 21.175 21.0625 12-13 28.299999999999997 24.075 25.4375 22.1875 14-15 26.0375 26.424999999999997 26.0625 21.475 16-17 27.237499999999997 26.8 24.6625 21.3 18-19 27.1375 25.362499999999997 25.9875 21.512500000000003 20-21 26.424999999999997 26.5625 25.900000000000002 21.1125 22-23 27.800000000000004 26.0375 24.6625 21.5 24-25 26.075 27.325 25.7625 20.837500000000002 26-27 27.5125 27.462500000000002 24.7875 20.2375 28-29 27.237499999999997 26.6 25.0125 21.15 30-31 27.025 26.900000000000002 25.224999999999998 20.849999999999998 32-33 26.724999999999998 27.500000000000004 25.4625 20.3125 34-35 27.525 28.275 24.15 20.05 36-37 26.687499999999996 27.425 25.1875 20.7 38-39 25.025 27.650000000000002 25.85 21.475 40-41 26.7125 27.85 24.725 20.7125 42-43 25.95 27.474999999999998 25.324999999999996 21.25 44-45 26.35 27.05 25.7375 20.8625 46-47 26.387500000000003 26.9125 25.275 21.425 48-49 27.1375 27.200000000000003 25.0125 20.65 50-51 25.418854713678417 27.769442360590148 26.231557889472366 20.580145036259065 52-53 27.131782945736433 27.231807951987996 24.981245311327832 20.655163790947736 54-55 25.593898474618655 26.86921730432608 26.25656414103526 21.280320080020005 56-57 26.575787893946973 26.95097548774387 25.975487743871934 20.497748874437217 58-59 25.937968984492244 27.026013006503252 26.750875437718857 20.28514257128564 60-61 26.488244122061033 26.92596298149075 25.86293146573287 20.72286143071536 62-63 24.931198398799097 26.945208906680012 27.032774580935705 21.09081811358519 64-65 26.401401401401404 27.464964964964967 25.788288288288285 20.345345345345343 66-67 25.56946182728411 27.071339173967456 26.645807259073845 20.713391739674595 68-69 25.572949279899817 28.027551659361304 25.848465873512836 20.551033187226047 70-71 26.403508771929822 28.18295739348371 25.050125313283207 20.36340852130326 72-73 26.203073822121443 27.70219198790627 25.371630133534893 20.72310405643739 74-75 24.838709677419356 24.838709677419356 27.473118279569892 22.849462365591396 76 29.9079754601227 0.0 39.57055214723926 30.52147239263804 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.5 17 1.5 18 1.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.0 24 2.0 25 3.0 26 3.5 27 4.5 28 5.0 29 9.0 30 15.5 31 20.5 32 30.0 33 40.0 34 49.0 35 66.0 36 90.0 37 111.0 38 128.0 39 162.5 40 210.5 41 234.5 42 243.5 43 273.5 44 306.5 45 315.5 46 309.0 47 310.5 48 307.0 49 268.0 50 236.5 51 222.0 52 196.5 53 155.0 54 126.5 55 118.5 56 97.5 57 79.5 58 71.5 59 56.0 60 43.5 61 37.0 62 29.0 63 20.5 64 12.5 65 11.0 66 11.0 67 8.0 68 7.5 69 10.5 70 7.5 71 5.5 72 6.5 73 6.5 74 5.0 75 4.5 76 6.0 77 4.5 78 2.5 79 1.5 80 2.0 81 2.0 82 2.0 83 2.5 84 3.5 85 4.5 86 5.5 87 5.5 88 2.5 89 2.0 90 2.5 91 1.5 92 1.0 93 1.5 94 2.5 95 3.5 96 4.0 97 5.0 98 6.5 99 28.0 100 49.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 49 1.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 1.0 64 0.0 65 1.0 66 0.0 67 2.0 68 1.0 69 1.0 70 2.0 71 8.0 72 24.0 73 89.0 74 296.0 75 964.0 76 2608.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.55521155830753 95.5 2 1.2899896800825592 2.5 3 0.07739938080495357 0.22499999999999998 4 0.025799793601651185 0.1 5 0.0 0.0 6 0.025799793601651185 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025799793601651185 1.525 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 61 1.525 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1428035 spots for SRR9668907.sra Written 1428035 spots for SRR9668907.sra Read 1428035 spots for SRR9668907.sra Written 1428035 spots for SRR9668907.sra Read 1428035 spots for SRR9668907.sra Written 1428035 spots for SRR9668907.sra Read 1428035 spots for SRR9668907.sra Written 1428035 spots for SRR9668907.sra Read 1428035 spots for SRR9668907.sra Written 1428035 spots for SRR9668907.sra Read 1428035 spots for SRR9668907.sra Written 1428035 spots for SRR9668907.sra Read 1428035 spots for SRR9668907.sra Written 1428035 spots for SRR9668907.sra Read 1428035 spots for SRR9668907.sra Written 1428035 spots for SRR9668907.sra Read 1428035 spots for SRR9668907.sra Written 1428035 spots for SRR9668907.sra Read 1428035 spots for SRR9668907.sra Written 1428035 spots for SRR9668907.sra Read 1428035 spots for SRR9668907.sra Written 1428035 spots for SRR9668907.sra Read 1428035 spots for SRR9668907.sra Written 1428035 spots for SRR9668907.sra Read 1428035 spots for SRR9668907.sra Written 1428035 spots for SRR9668907.sra Read 1428035 spots for SRR9668907.sra Written 1428035 spots for SRR9668907.sra Read 1428035 spots for SRR9668907.sra Written 1428035 spots for SRR9668907.sra Read 1428035 spots for SRR9668907.sra Written 1428035 spots for SRR9668907.sra Read 1428035 spots for SRR9668907.sra Written 1428035 spots for SRR9668907.sra Read 1428035 spots for SRR9668907.sra Written 1428035 spots for SRR9668907.sra Read 1428035 spots for SRR9668907.sra Written 1428035 spots for SRR9668907.sra Read 1428035 spots for SRR9668907.sra Written 1428035 spots for SRR9668907.sra SRR ids: ['SRR9668907.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_txglvemv SRR9668907.sra spots: 28560700 blocks: [[1, 1428035], [1428036, 2856070], [2856071, 4284105], [4284106, 5712140], [5712141, 7140175], [7140176, 8568210], [8568211, 9996245], [9996246, 11424280], [11424281, 12852315], [12852316, 14280350], [14280351, 15708385], [15708386, 17136420], [17136421, 18564455], [18564456, 19992490], [19992491, 21420525], [21420526, 22848560], [22848561, 24276595], [24276596, 25704630], [25704631, 27132665], [27132666, 28560700]] SRR9668907 file size 5415845 SRR9668907 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668907 SRR9668907_1.fastq SRR9668907_2.fastq Input file: SRR9668907_1.fastq Paired file: SRR9668907_2.fastq trimmed: SRR9668907-trimmed-pair1.fastq, SRR9668907-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:00:58 2025 >> started Wed Feb 12 16:01:21 2025 >> done (23.212s) 28560700 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 19057 ( 0.07%) empty read pairs filtered out after trimming by size control 28541643 (99.93%) read pairs available; of these: 3630 ( 0.01%) trimmed read pairs available after processing 28538013 (99.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 2 0.00% 23 1 0.00% 24 4 0.00% 25 4 0.00% 26 8 0.00% 27 10 0.00% 28 9 0.00% 29 13 0.00% 30 15 0.00% 31 17 0.00% 32 4 0.00% 33 21 0.00% 34 15 0.00% 35 92 0.00% 36 134 0.00% 37 144 0.00% 38 208 0.00% 39 213 0.00% 40 265 0.00% 41 295 0.00% 42 452 0.00% 43 428 0.00% 44 503 0.00% 45 557 0.00% 46 666 0.00% 47 732 0.00% 48 923 0.00% 49 1112 0.00% 50 1306 0.00% 51 1424 0.00% 52 1491 0.01% 53 1656 0.01% 54 1664 0.01% 55 1914 0.01% 56 2134 0.01% 57 2397 0.01% 58 2675 0.01% 59 2880 0.01% 60 3302 0.01% 61 3441 0.01% 62 3730 0.01% 63 3940 0.01% 64 4338 0.02% 65 4542 0.02% 66 4667 0.02% 67 4859 0.02% 68 5094 0.02% 69 5927 0.02% 70 6856 0.02% 71 8804 0.03% 72 23390 0.08% 73 246476 0.86% 74 2345280 8.22% 75 13729954 48.10% 76 12110654 42.43% 28541643 reads passed initial QC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=17 prefix-density=0.77 prefix-fanout=2.2 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=18.26 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=3.9 sequence=CCATCTTTCGGCTAACCTAGCCTCCTCCGTCCCTCGGGACCAACAAGGGGTAGTACAGGAATATTCGCCTGTTGTCCATCGACTACGCCTTTCGGCCTGATCTTAGGCCCTGACTCACCCTCCGTGGACGAACCTTGCGGAGGAACCCTTAGGTTTTCGGGGCATTGGATTCTCACCAATGTTTGCGTTACTCAAGCCGACATTCTCGCTTCCGCTTCGTCCACCCCCGCTCGCGCGGGTGCTTCCCTCTAAGCGGAACGCTCCCCTACCGATGCATTTTTACATCCCACAGCTTCGGCAGATCGCTTAGCCCCGTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTATTACGCACTCTTTCAAGGGTGGCTGCTTCTAGGCAAACCTCCTGGCTGTCTCTGCACCCCTACCTCCTTTATCACTGAGCGGTCATTTAGGGGCCTTAGCTGGTGATCCGGGCTGTTTCCCTCTCGACGATGAAGCTTATCCCCCACCGTCTCACTGGC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=23 prefix-density=0.55 prefix-fanout=1.9 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=8.36 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.1 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR9668907 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:01:51 Started mapping on | Feb 12 16:01:52 Finished on | Feb 12 16:03:34 Mapping speed, Million of reads per hour | 1007.35 Number of input reads | 28541643 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 22065550 Uniquely mapped reads % | 77.31% Average mapped length | 150.28 Number of splices: Total | 9502279 Number of splices: Annotated (sjdb) | 9402058 Number of splices: GT/AG | 9321158 Number of splices: GC/AG | 155720 Number of splices: AT/AC | 6281 Number of splices: Non-canonical | 19120 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.02% Deletion average length | 2.16 Insertion rate per base | 0.01% Insertion average length | 2.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1075018 % of reads mapped to multiple loci | 3.77% Number of reads mapped to too many loci | 1600709 % of reads mapped to too many loci | 5.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.08% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5401075 5401075 5401075 N_multimapping 1075018 1075018 1075018 N_noFeature 724994 21772139 809126 N_ambiguous 343359 1115 133234 UnstrandedReadsAssigned:20997197 PositiveStrandReadsAssigned:292296 NegativeStrandReadsAssigned:21123190 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668907 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668907-trimmed-pair1.fastq SRR9668907-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,541,643 reads, 23,654,328 reads pseudoaligned [quant] estimated average fragment length: 197.894 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,214 rounds 52401 SRR9668907.ke.tsv 34699 SRR9668907.se.tsv 87100 total ==> SRR9668907.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1821.11 365 6.97796 Potri.005G024800.1.v4.1 1035 838.106 166 6.89573 Potri.004G059700.1.v4.1 961 764.106 55 2.50599 Potri.007G009000.2.v4.1 1416 1219.11 0 0 Potri.003G141000.2.v4.1 2943 2746.11 341.453 4.32898 Potri.016G087400.1.v4.1 270 89.7457 1422.6 551.873 Potri.015G069301.1.v4.1 564 367.29 0 0 Potri.010G195200.1.v4.1 1773 1576.11 4 0.0883579 Potri.012G127500.1.v4.1 977 780.106 4725 210.872 ==> SRR9668907.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 24 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 318 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 48 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 9 SRR9668907 completed mapping pipeline successfully