Starting /dee2/code/volunteer_pipeline.sh SRR9668909 current disk space = 3051722133504 free memory = 1439959772 SRR9668909 SRAfilesize 56ca0d3c27620da5bc568bb714345b23 SRR9668909.sra SRR9668909.sra file validated SRR9668909 is paired end SRR9668909 is conventional basespace SRR9668909 read1 length is 44-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668909_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 44-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.655 32.0 32.0 32.0 32.0 32.0 2 31.677 32.0 32.0 32.0 32.0 32.0 3 31.7525 32.0 32.0 32.0 32.0 32.0 4 31.75 32.0 32.0 32.0 32.0 32.0 5 31.78825 32.0 32.0 32.0 32.0 32.0 6 35.3585 36.0 36.0 36.0 36.0 36.0 7 35.35125 36.0 36.0 36.0 36.0 36.0 8 35.373 36.0 36.0 36.0 36.0 36.0 9 35.407 36.0 36.0 36.0 36.0 36.0 10-11 35.330375000000004 36.0 36.0 36.0 36.0 36.0 12-13 35.399125 36.0 36.0 36.0 36.0 36.0 14-15 35.449625 36.0 36.0 36.0 36.0 36.0 16-17 35.2955 36.0 36.0 36.0 36.0 36.0 18-19 35.277 36.0 36.0 36.0 36.0 36.0 20-21 35.27625 36.0 36.0 36.0 36.0 36.0 22-23 35.2805 36.0 36.0 36.0 36.0 36.0 24-25 35.323499999999996 36.0 36.0 36.0 36.0 36.0 26-27 35.21925 36.0 36.0 36.0 36.0 36.0 28-29 35.252125 36.0 36.0 36.0 36.0 36.0 30-31 35.2485 36.0 36.0 36.0 36.0 36.0 32-33 35.232749999999996 36.0 36.0 36.0 36.0 36.0 34-35 35.188 36.0 36.0 36.0 36.0 36.0 36-37 35.201499999999996 36.0 36.0 36.0 36.0 36.0 38-39 35.150625 36.0 36.0 36.0 36.0 36.0 40-41 35.19475 36.0 36.0 36.0 36.0 36.0 42-43 35.104124999999996 36.0 36.0 36.0 36.0 36.0 44-45 35.098270848962244 36.0 36.0 36.0 36.0 36.0 46-47 35.12253063265817 36.0 36.0 36.0 36.0 36.0 48-49 35.06301575393849 36.0 36.0 36.0 36.0 36.0 50-51 34.96699174793699 36.0 36.0 36.0 36.0 36.0 52-53 34.94586146536634 36.0 36.0 36.0 34.0 36.0 54-55 34.90722680670167 36.0 36.0 36.0 34.0 36.0 56-57 34.92048012003001 36.0 36.0 36.0 36.0 36.0 58-59 34.794323580895224 36.0 36.0 36.0 32.0 36.0 60-61 34.8643992521918 36.0 36.0 36.0 32.0 36.0 62-63 34.80012515644556 36.0 36.0 36.0 34.0 36.0 64-65 34.815114442627646 36.0 36.0 36.0 34.0 36.0 66-67 34.7827991987982 36.0 36.0 36.0 32.0 36.0 68-69 34.597170047583276 36.0 36.0 36.0 32.0 36.0 70-71 34.63625896362053 36.0 36.0 36.0 32.0 36.0 72-73 34.61088269398269 36.0 36.0 36.0 32.0 36.0 74-75 34.5679905070506 36.0 36.0 36.0 32.0 36.0 76 33.80693641618497 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 3.0 18 1.0 19 0.0 20 1.0 21 0.0 22 2.0 23 3.0 24 13.0 25 8.0 26 17.0 27 20.0 28 32.0 29 46.0 30 54.0 31 71.0 32 118.0 33 181.0 34 419.0 35 3011.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.675000000000004 13.15 7.925 29.25 2 22.975 15.950000000000001 36.025 25.05 3 18.575 24.075 27.250000000000004 30.099999999999998 4 22.325 31.1 23.575 23.0 5 23.225 34.699999999999996 23.400000000000002 18.675 6 20.775 34.825 23.65 20.75 7 15.25 23.075000000000003 41.65 20.025000000000002 8 17.925 24.474999999999998 30.475 27.125 9 18.575 24.099999999999998 31.775 25.55 10-11 22.5625 32.5375 22.175 22.725 12-13 21.6 24.85 28.025 25.525 14-15 21.4875 26.2875 27.5875 24.637500000000003 16-17 21.29548580717769 26.93510066274853 27.11016631236714 24.65924721770664 18-19 21.4375 27.375 27.287499999999998 23.9 20-21 22.400000000000002 26.9125 27.325 23.3625 22-23 22.275 27.675 27.2625 22.787499999999998 24-25 21.6625 27.325 26.5375 24.474999999999998 26-27 21.212500000000002 27.6 26.787499999999998 24.4 28-29 20.9875 28.3875 26.0 24.625 30-31 21.142785696424106 27.881970492623154 26.65666416604151 24.318579644911228 32-33 21.025 27.4125 27.0875 24.474999999999998 34-35 21.375 27.375 27.3625 23.8875 36-37 20.837500000000002 27.6625 26.787499999999998 24.712500000000002 38-39 21.337500000000002 27.6375 26.8375 24.1875 40-41 21.525 28.249999999999996 26.687499999999996 23.5375 42-43 21.075 28.225 26.4625 24.2375 44-45 21.61520190023753 27.61595199399925 26.60332541567696 24.16552069008626 46-47 21.50537634408602 28.169542385596397 26.531632908227053 23.793448362090523 48-49 21.867966991747938 27.74443610902726 25.481370342585645 24.90622655663916 50-51 20.980245061265315 26.619154788697173 26.756689172293076 25.64391097774444 52-53 21.655413853463365 27.431857964491122 27.44436109027257 23.468367091772944 54-55 21.255313828457115 27.86946736684171 26.6816704176044 24.193548387096776 56-57 21.167791947987 26.78169542385596 26.819204801200303 25.23130782695674 58-59 20.86771692923231 27.91947986996749 27.28182045511378 23.93098274568642 60-61 21.193544351307395 27.749280620542976 26.66082822469661 24.39634680345302 62-63 21.214017521902377 27.546933667083856 27.53441802252816 23.704630788485606 64-65 22.0177744398548 28.063587432719988 26.5114532482163 23.407184879208913 66-67 21.41962944416625 28.004506760140206 26.176765147721582 24.399098647971957 68-69 20.761332331580267 27.44803405960431 26.95967943901828 24.830954169797145 70-71 21.38829720586393 26.989099110387173 27.678235810048868 23.94436787370004 72-73 21.556058320764205 28.14228255404726 26.69683257918552 23.604826546003014 74-75 22.09922646038944 24.219791944518537 28.1141637770072 25.566817818084825 76 22.54335260115607 0.0 41.040462427745666 36.41618497109826 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.5 20 2.0 21 2.0 22 2.0 23 1.0 24 1.5 25 5.0 26 12.5 27 15.5 28 15.5 29 19.0 30 27.0 31 37.5 32 51.5 33 63.0 34 68.0 35 81.0 36 106.5 37 131.5 38 149.0 39 161.0 40 174.0 41 223.0 42 262.0 43 259.0 44 272.5 45 297.0 46 306.5 47 306.5 48 304.0 49 273.5 50 241.0 51 232.0 52 212.0 53 182.0 54 157.0 55 129.0 56 107.5 57 89.0 58 70.0 59 64.0 60 52.0 61 37.5 62 28.5 63 18.5 64 8.5 65 4.5 66 3.5 67 3.0 68 3.0 69 2.0 70 0.5 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0375 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.025 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 44 1.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 1.0 60 3.0 61 0.0 62 0.0 63 0.0 64 1.0 65 0.0 66 0.0 67 1.0 68 0.0 69 2.0 70 1.0 71 1.0 72 22.0 73 79.0 74 278.0 75 1015.0 76 2595.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.02917839774763 95.75 2 1.6124904018428463 3.15 3 0.3071410289224469 0.8999999999999999 4 0.05119017148707448 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668909 read2 length is 44-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668909_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 44-76 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.19625 32.0 32.0 32.0 32.0 32.0 2 31.07075 32.0 32.0 32.0 32.0 32.0 3 31.065 32.0 32.0 32.0 32.0 32.0 4 31.0015 32.0 32.0 32.0 32.0 32.0 5 31.01825 32.0 32.0 32.0 32.0 32.0 6 34.61825 36.0 36.0 36.0 32.0 36.0 7 34.58425 36.0 36.0 36.0 32.0 36.0 8 34.46 36.0 36.0 36.0 32.0 36.0 9 34.4205 36.0 36.0 36.0 32.0 36.0 10-11 34.3875 36.0 36.0 36.0 32.0 36.0 12-13 34.3675 36.0 36.0 36.0 32.0 36.0 14-15 34.357124999999996 36.0 36.0 36.0 32.0 36.0 16-17 34.28075 36.0 36.0 36.0 32.0 36.0 18-19 34.229375000000005 36.0 36.0 36.0 32.0 36.0 20-21 34.106624999999994 36.0 36.0 36.0 32.0 36.0 22-23 33.995125 36.0 36.0 36.0 32.0 36.0 24-25 34.032 36.0 36.0 36.0 32.0 36.0 26-27 33.996875 36.0 36.0 36.0 32.0 36.0 28-29 33.846875 36.0 36.0 36.0 29.5 36.0 30-31 33.835 36.0 36.0 36.0 32.0 36.0 32-33 33.9245 36.0 36.0 36.0 32.0 36.0 34-35 33.784375 36.0 36.0 36.0 29.5 36.0 36-37 33.759625 36.0 36.0 36.0 26.5 36.0 38-39 33.778499999999994 36.0 36.0 36.0 29.5 36.0 40-41 33.734125 36.0 36.0 36.0 26.5 36.0 42-43 33.7345 36.0 36.0 36.0 26.5 36.0 44-45 33.63332208052013 36.0 36.0 36.0 21.0 36.0 46-47 33.61277819454864 36.0 36.0 36.0 21.0 36.0 48-49 33.62128032008002 36.0 36.0 36.0 21.0 36.0 50-51 33.600400100025006 36.0 36.0 36.0 21.0 36.0 52-53 33.51500375093774 36.0 36.0 36.0 21.0 36.0 54-55 33.49424856214054 36.0 36.0 36.0 21.0 36.0 56-57 33.55326331582896 36.0 36.0 36.0 21.0 36.0 58-59 33.41472868217055 36.0 36.0 36.0 21.0 36.0 60-61 33.381401599198 36.0 36.0 36.0 21.0 36.0 62-63 33.2754004004004 36.0 36.0 36.0 17.5 36.0 64-65 33.4174764564314 36.0 36.0 36.0 21.0 36.0 66-67 33.25181476846058 36.0 36.0 36.0 21.0 36.0 68-69 33.27966950425638 36.0 36.0 36.0 21.0 36.0 70-71 33.19779363914499 36.0 36.0 36.0 14.0 36.0 72-73 33.19750548607615 36.0 36.0 36.0 17.5 36.0 74-75 33.152113353440285 36.0 36.0 36.0 17.5 36.0 76 32.669514563106794 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 8.0 15 30.0 16 47.0 17 39.0 18 21.0 19 29.0 20 24.0 21 21.0 22 18.0 23 11.0 24 19.0 25 31.0 26 28.0 27 29.0 28 43.0 29 57.0 30 83.0 31 82.0 32 129.0 33 196.0 34 473.0 35 2582.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.147869674185465 20.726817042606516 9.473684210526317 20.651629072681704 2 32.666333166583286 23.1615807903952 28.4392196098049 15.732866433216607 3 24.23105776444111 26.93173293323331 27.93198299574894 20.905226306576644 4 29.25 32.324999999999996 18.95 19.475 5 29.425 34.875 18.075 17.625 6 25.7 34.65 20.549999999999997 19.1 7 23.724999999999998 19.400000000000002 36.9 19.975 8 25.85 22.400000000000002 25.324999999999996 26.424999999999997 9 26.075 24.7 25.7 23.525 10-11 28.375 29.1875 20.599999999999998 21.837500000000002 12-13 27.05 24.0625 26.9125 21.975 14-15 27.725 26.3625 25.4625 20.45 16-17 28.012500000000003 26.487500000000004 24.5 21.0 18-19 27.0875 27.55 25.337500000000002 20.025000000000002 20-21 26.8 26.637499999999996 26.0125 20.549999999999997 22-23 27.450000000000003 26.437500000000004 24.55 21.5625 24-25 27.85 26.625 25.337500000000002 20.1875 26-27 26.487500000000004 27.5875 25.2375 20.6875 28-29 26.724999999999998 27.125 25.3125 20.837500000000002 30-31 26.6125 25.874999999999996 25.575 21.9375 32-33 26.1 27.025 25.2125 21.6625 34-35 26.337500000000002 27.1625 25.687500000000004 20.8125 36-37 25.5375 27.5625 25.7 21.2 38-39 26.787499999999998 26.825 25.525 20.8625 40-41 27.425 27.200000000000003 24.8125 20.5625 42-43 26.087500000000002 26.937499999999996 25.424999999999997 21.55 44-45 26.428303537942245 27.753469183647955 25.278159769971246 20.540067508438558 46-47 27.28182045511378 27.206801700425103 25.018754688672168 20.492623155788948 48-49 26.806701675418854 26.65666416604151 26.19404851212803 20.342585646411603 50-51 25.456364091022753 26.93173293323331 26.6816704176044 20.930232558139537 52-53 25.868967241810452 27.481870467616904 26.456614153538382 20.192548137034258 54-55 25.993998499624904 26.694173543385848 27.069267316829208 20.24256064016004 56-57 25.806451612903224 26.456614153538382 26.30657664416104 21.43035758939735 58-59 25.968992248062015 27.231807951987996 26.38159539884971 20.417604401100277 60-61 26.019514635976982 26.21966474856142 25.99449587190393 21.766324743557668 62-63 24.7997997997998 28.52852852852853 25.850850850850847 20.82082082082082 64-65 25.4411212614191 27.556000500563133 25.916656238268054 21.086221999749718 66-67 26.095118898623284 28.247809762202753 25.294117647058822 20.362953692115145 68-69 24.9749624436655 28.392588883324986 25.450676014021035 21.181772658988482 70-71 25.291243893273208 28.673431040962043 25.491669798321432 20.543655267443317 72-73 24.8807431584233 27.906100928948028 25.797137835802157 21.41601807682651 74-75 24.519487453283503 24.75974372664175 27.80298985584624 22.91777896422851 76 28.504854368932037 0.0 38.679611650485434 32.81553398058252 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.5 19 1.5 20 1.5 21 2.0 22 2.0 23 4.0 24 6.0 25 4.5 26 4.5 27 7.5 28 7.5 29 7.5 30 15.5 31 24.0 32 38.0 33 56.5 34 55.5 35 62.0 36 87.5 37 111.5 38 132.5 39 159.5 40 189.0 41 234.5 42 268.5 43 291.0 44 297.5 45 297.0 46 314.5 47 325.5 48 312.0 49 263.5 50 232.5 51 205.0 52 177.0 53 158.5 54 151.5 55 136.0 56 101.0 57 82.0 58 75.5 59 65.0 60 49.5 61 39.0 62 31.0 63 21.0 64 16.0 65 15.0 66 9.5 67 6.0 68 7.0 69 6.0 70 6.5 71 7.0 72 4.0 73 5.5 74 7.5 75 6.0 76 4.0 77 3.0 78 3.5 79 3.0 80 1.5 81 3.0 82 3.5 83 1.5 84 2.0 85 4.0 86 3.5 87 2.0 88 2.5 89 2.0 90 2.5 91 4.5 92 5.0 93 4.0 94 4.5 95 5.0 96 4.0 97 3.5 98 6.0 99 25.5 100 42.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.05 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 44 1.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 1.0 60 2.0 61 0.0 62 0.0 63 0.0 64 1.0 65 0.0 66 0.0 67 1.0 68 0.0 69 2.0 70 1.0 71 2.0 72 12.0 73 88.0 74 286.0 75 1028.0 76 2575.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.52751227073108 95.35 2 1.2658227848101267 2.45 3 0.15499870834409715 0.44999999999999996 4 0.025833118057349523 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025833118057349523 1.6500000000000001 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 66 1.6500000000000001 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1481855 spots for SRR9668909.sra Written 1481855 spots for SRR9668909.sra Read 1481855 spots for SRR9668909.sra Written 1481855 spots for SRR9668909.sra Read 1481855 spots for SRR9668909.sra Written 1481855 spots for SRR9668909.sra Read 1481855 spots for SRR9668909.sra Written 1481855 spots for SRR9668909.sra Read 1481855 spots for SRR9668909.sra Written 1481855 spots for SRR9668909.sra Read 1481855 spots for SRR9668909.sra Written 1481855 spots for SRR9668909.sra Read 1481855 spots for SRR9668909.sra Written 1481855 spots for SRR9668909.sra Read 1481855 spots for SRR9668909.sra Written 1481855 spots for SRR9668909.sra Read 1481855 spots for SRR9668909.sra Written 1481855 spots for SRR9668909.sra Read 1481855 spots for SRR9668909.sra Written 1481855 spots for SRR9668909.sra Read 1481855 spots for SRR9668909.sra Written 1481855 spots for SRR9668909.sra Read 1481855 spots for SRR9668909.sra Written 1481855 spots for SRR9668909.sra Read 1481855 spots for SRR9668909.sra Written 1481855 spots for SRR9668909.sra Read 1481855 spots for SRR9668909.sra Written 1481855 spots for SRR9668909.sra Read 1481855 spots for SRR9668909.sra Written 1481855 spots for SRR9668909.sra Read 1481866 spots for SRR9668909.sra Written 1481866 spots for SRR9668909.sra Read 1481855 spots for SRR9668909.sra Written 1481855 spots for SRR9668909.sra Read 1481855 spots for SRR9668909.sra Written 1481855 spots for SRR9668909.sra Read 1481855 spots for SRR9668909.sra Written 1481855 spots for SRR9668909.sra Read 1481855 spots for SRR9668909.sra Written 1481855 spots for SRR9668909.sra SRR ids: ['SRR9668909.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aombs4wg SRR9668909.sra spots: 29637111 blocks: [[1, 1481855], [1481856, 2963710], [2963711, 4445565], [4445566, 5927420], [5927421, 7409275], [7409276, 8891130], [8891131, 10372985], [10372986, 11854840], [11854841, 13336695], [13336696, 14818550], [14818551, 16300405], [16300406, 17782260], [17782261, 19264115], [19264116, 20745970], [20745971, 22227825], [22227826, 23709680], [23709681, 25191535], [25191536, 26673390], [26673391, 28155245], [28155246, 29637111]] SRR9668909 file size 5619592 SRR9668909 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668909 SRR9668909_1.fastq SRR9668909_2.fastq Input file: SRR9668909_1.fastq Paired file: SRR9668909_2.fastq trimmed: SRR9668909-trimmed-pair1.fastq, SRR9668909-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:56:05 2025 >> started Wed Feb 12 15:56:29 2025 >> done (23.646s) 29637111 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 22126 ( 0.07%) empty read pairs filtered out after trimming by size control 29614984 (99.93%) read pairs available; of these: 4072 ( 0.01%) trimmed read pairs available after processing 29610912 (99.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 21 1 0.00% 22 4 0.00% 23 2 0.00% 24 9 0.00% 25 4 0.00% 26 10 0.00% 27 17 0.00% 28 8 0.00% 29 26 0.00% 30 20 0.00% 31 22 0.00% 32 25 0.00% 33 32 0.00% 34 23 0.00% 35 120 0.00% 36 176 0.00% 37 191 0.00% 38 252 0.00% 39 292 0.00% 40 377 0.00% 41 437 0.00% 42 516 0.00% 43 565 0.00% 44 649 0.00% 45 723 0.00% 46 802 0.00% 47 968 0.00% 48 1229 0.00% 49 1454 0.00% 50 1735 0.01% 51 1925 0.01% 52 2114 0.01% 53 2294 0.01% 54 2362 0.01% 55 2601 0.01% 56 2980 0.01% 57 3455 0.01% 58 3652 0.01% 59 3986 0.01% 60 4698 0.02% 61 4996 0.02% 62 5338 0.02% 63 5916 0.02% 64 6154 0.02% 65 6316 0.02% 66 6627 0.02% 67 7176 0.02% 68 7673 0.03% 69 8437 0.03% 70 9641 0.03% 71 11467 0.04% 72 26897 0.09% 73 263994 0.89% 74 2453998 8.29% 75 14259197 48.15% 76 12490401 42.18% 29614984 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=19 prefix-density=0.79 prefix-fanout=2.2 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=17.58 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=3.1 sequence=AAAAGCAACATCCGCCAATCCCTGGTCGGCATCGTTTATGGTTGAGACTAGGACGGTATCTGATCGTCTTCGAGCCCCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCAAATGCTTTCGCAGTTGTTCGTCTTTCATAAATCCAAGAATTTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAAGGCCAGGAGCGCATCGCCG criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=20 prefix-density=0.56 prefix-fanout=1.9 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=9.69 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=4.0 sequence=CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTT SRR9668909 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:56:59 Started mapping on | Feb 12 15:57:00 Finished on | Feb 12 15:58:38 Mapping speed, Million of reads per hour | 1087.90 Number of input reads | 29614984 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 23325508 Uniquely mapped reads % | 78.76% Average mapped length | 150.21 Number of splices: Total | 10239070 Number of splices: Annotated (sjdb) | 10134001 Number of splices: GT/AG | 10047349 Number of splices: GC/AG | 164791 Number of splices: AT/AC | 6598 Number of splices: Non-canonical | 20332 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.01% Insertion average length | 1.96 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1076903 % of reads mapped to multiple loci | 3.64% Number of reads mapped to too many loci | 964583 % of reads mapped to too many loci | 3.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.18% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5212573 5212573 5212573 N_multimapping 1076903 1076903 1076903 N_noFeature 563286 23038079 648739 N_ambiguous 340957 904 138330 UnstrandedReadsAssigned:22421265 PositiveStrandReadsAssigned:286525 NegativeStrandReadsAssigned:22538439 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668909 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668909-trimmed-pair1.fastq SRR9668909-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,614,984 reads, 24,748,360 reads pseudoaligned [quant] estimated average fragment length: 194.858 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,218 rounds 52401 SRR9668909.ke.tsv 34699 SRR9668909.se.tsv 87100 total ==> SRR9668909.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1824.14 389 7.41923 Potri.005G024800.1.v4.1 1035 841.142 161 6.65923 Potri.004G059700.1.v4.1 961 767.142 53 2.40363 Potri.007G009000.2.v4.1 1416 1222.14 0 0 Potri.003G141000.2.v4.1 2943 2749.14 382 4.8343 Potri.016G087400.1.v4.1 270 92.8759 1490.44 558.313 Potri.015G069301.1.v4.1 564 370.407 0 0 Potri.010G195200.1.v4.1 1773 1579.14 6 0.13219 Potri.012G127500.1.v4.1 977 783.142 5133 228.033 ==> SRR9668909.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 33 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 353 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 62 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 5 SRR9668909 completed mapping pipeline successfully