Starting /dee2/code/volunteer_pipeline.sh SRR9668910 current disk space = 3051949821952 free memory = 1581868424 SRR9668910 SRAfilesize a36718ee71176c052c11dbfa86241284 SRR9668910.sra SRR9668910.sra file validated SRR9668910 is paired end SRR9668910 is conventional basespace SRR9668910 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668910_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6885 32.0 32.0 32.0 32.0 32.0 2 31.6825 32.0 32.0 32.0 32.0 32.0 3 31.69625 32.0 32.0 32.0 32.0 32.0 4 31.703 32.0 32.0 32.0 32.0 32.0 5 31.72225 32.0 32.0 32.0 32.0 32.0 6 35.4245 36.0 36.0 36.0 36.0 36.0 7 35.38875 36.0 36.0 36.0 36.0 36.0 8 35.45675 36.0 36.0 36.0 36.0 36.0 9 35.47575 36.0 36.0 36.0 36.0 36.0 10-11 35.37075 36.0 36.0 36.0 36.0 36.0 12-13 35.36075 36.0 36.0 36.0 36.0 36.0 14-15 35.413624999999996 36.0 36.0 36.0 36.0 36.0 16-17 35.34375 36.0 36.0 36.0 36.0 36.0 18-19 35.322375 36.0 36.0 36.0 36.0 36.0 20-21 35.42225 36.0 36.0 36.0 36.0 36.0 22-23 35.376374999999996 36.0 36.0 36.0 36.0 36.0 24-25 35.307500000000005 36.0 36.0 36.0 36.0 36.0 26-27 35.272125 36.0 36.0 36.0 36.0 36.0 28-29 35.268125 36.0 36.0 36.0 36.0 36.0 30-31 35.245125 36.0 36.0 36.0 36.0 36.0 32-33 35.2295 36.0 36.0 36.0 36.0 36.0 34-35 35.194 36.0 36.0 36.0 36.0 36.0 36-37 35.28196147110333 36.0 36.0 36.0 36.0 36.0 38-39 35.16737553164874 36.0 36.0 36.0 36.0 36.0 40-41 35.178759069301975 36.0 36.0 36.0 36.0 36.0 42-43 35.2247935951964 36.0 36.0 36.0 36.0 36.0 44-45 35.102952214160624 36.0 36.0 36.0 36.0 36.0 46-47 35.107955966975226 36.0 36.0 36.0 36.0 36.0 48-49 35.06404803602702 36.0 36.0 36.0 36.0 36.0 50-51 35.0597992914105 36.0 36.0 36.0 36.0 36.0 52-53 34.98110610610611 36.0 36.0 36.0 34.0 36.0 54-55 34.866991991991995 36.0 36.0 36.0 34.0 36.0 56-57 34.89014014014014 36.0 36.0 36.0 36.0 36.0 58-59 34.91141141141141 36.0 36.0 36.0 32.0 36.0 60-61 34.83946446446446 36.0 36.0 36.0 32.0 36.0 62-63 34.867367367367365 36.0 36.0 36.0 34.0 36.0 64-65 34.84271771771772 36.0 36.0 36.0 32.0 36.0 66-67 34.84471971971972 36.0 36.0 36.0 32.0 36.0 68-69 34.66641641641641 36.0 36.0 36.0 32.0 36.0 70-71 34.7145350463129 36.0 36.0 36.0 32.0 36.0 72-73 34.672000585193786 36.0 36.0 36.0 32.0 36.0 74-75 34.61308352181266 36.0 36.0 36.0 32.0 36.0 76 33.77297721916732 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 1.0 20 1.0 21 0.0 22 1.0 23 0.0 24 1.0 25 7.0 26 16.0 27 21.0 28 41.0 29 57.0 30 49.0 31 67.0 32 96.0 33 182.0 34 433.0 35 3023.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.307480610457844 13.159869902426822 9.106830122591944 34.42581936452339 2 21.66624968726545 17.713284963722792 35.67675756817613 24.943707780835627 3 20.01501125844383 21.79134350763072 26.1195896922692 32.07405554165624 4 24.06805103827871 29.997498123592692 21.816362271703778 24.11808856642482 5 23.617713284963724 33.62521891418564 22.66700025018764 20.090067550662997 6 19.11433575181386 34.9762321741306 25.519139354515886 20.390292719539655 7 15.086314736052039 22.566925193895422 42.982236677508126 19.36452339254441 8 18.33875406554916 22.742056542406804 31.848886664998748 27.070302727045288 9 19.489617212909682 21.691268451338505 32.49937453089817 26.319739804853644 10-11 22.604453340005005 31.64873655241431 22.679509632224168 23.067300475356518 12-13 22.116587440580435 24.86865148861646 27.50813109832374 25.50662997247936 14-15 21.053289967475607 26.857643232424316 27.47060295221416 24.618463847885916 16-17 21.581383710746906 26.710872013011382 26.86100337795571 24.846740898286 18-19 21.56617463097323 27.1703777833375 26.65749311983988 24.605954465849386 20-21 21.66624968726545 27.50813109832374 26.632474355766828 24.193144858643983 22-23 21.678759069301975 27.207905929447087 26.90768076057043 24.20565424068051 24-25 21.278458844133098 27.670753064798596 27.33299974981236 23.71778834125594 26-27 21.71628721541156 27.62071553665249 26.45734300725544 24.20565424068051 28-29 22.204153114836128 27.52064048036027 26.607455591693768 23.667750813109834 30-31 20.83072688602527 28.024521456274236 26.635806330539225 24.508945327161268 32-33 21.09081811358519 26.007005253940456 27.395546659994995 25.50662997247936 34-35 21.303477608206155 27.32049036777583 26.845133850387793 24.530898173630224 36-37 20.765574180635475 27.87090317738304 26.582436827620715 24.78108581436077 38-39 21.70377783337503 26.970227670753065 26.56992744558419 24.756067050287715 40-41 21.85389041781336 27.18288716537403 26.182136602451838 24.78108581436077 42-43 21.240930698023515 27.645734300725543 26.55741806354766 24.55591693770328 44-45 21.115836877658246 27.307980985739306 26.46985238929197 25.106329747310486 46-47 21.90392794595947 26.99524643482612 27.257943457593193 23.842882161621215 48-49 22.029021766324743 27.020265198899175 26.407305479109333 24.54340755566675 50-51 21.231077192543477 27.336419366946078 26.473164018516204 24.959339421994244 52-53 22.27227227227227 27.08958958958959 26.714214214214216 23.923923923923923 54-55 21.57157157157157 27.55255255255255 26.964464464464466 23.91141141141141 56-57 20.75825825825826 27.52752752752753 26.726726726726728 24.987487487487485 58-59 21.696696696696698 27.802802802802802 26.514014014014016 23.986486486486484 60-61 21.834334334334336 26.5015015015015 26.964464464464466 24.6996996996997 62-63 21.97197197197197 27.289789789789793 26.08858858858859 24.64964964964965 64-65 21.396396396396398 27.489989989989986 26.263763763763766 24.84984984984985 66-67 22.12212212212212 27.740240240240237 26.238738738738736 23.8988988988989 68-69 22.4974974974975 26.75175175175175 26.363863863863862 24.386886886886888 70-71 21.409790910229123 27.66996369099787 26.380368098159508 24.539877300613497 72-73 22.00728551689486 27.30812711970858 27.119708579324204 23.564878784072352 74-75 21.907560780122896 23.45711995725354 27.892065188351587 26.743254074271977 76 21.013354281225453 0.0 43.244304791830324 35.74234092694423 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 2.5 21 3.0 22 2.0 23 3.5 24 6.5 25 6.0 26 6.5 27 12.0 28 17.0 29 22.5 30 30.0 31 34.5 32 41.0 33 48.0 34 64.5 35 89.5 36 116.0 37 139.5 38 148.5 39 161.0 40 186.5 41 214.0 42 237.5 43 256.5 44 274.5 45 288.5 46 285.5 47 295.0 48 286.0 49 253.0 50 238.0 51 217.0 52 190.5 53 160.5 54 140.0 55 136.5 56 134.0 57 112.5 58 94.0 59 78.5 60 60.0 61 41.0 62 22.5 63 19.5 64 16.5 65 13.0 66 14.0 67 15.0 68 8.0 69 3.0 70 4.5 71 3.5 72 2.5 73 4.5 74 4.5 75 2.0 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.5 95 1.0 96 1.0 97 0.5 98 1.0 99 1.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.075 4 0.075 5 0.075 6 0.075 7 0.075 8 0.075 9 0.075 10-11 0.075 12-13 0.075 14-15 0.075 16-17 0.08750000000000001 18-19 0.075 20-21 0.075 22-23 0.075 24-25 0.075 26-27 0.075 28-29 0.075 30-31 0.08750000000000001 32-33 0.075 34-35 0.075 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 3.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 1.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 1.0 70 3.0 71 4.0 72 15.0 73 78.0 74 304.0 75 1045.0 76 2546.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.05 #Duplication Level Percentage of deduplicated Percentage of total 1 97.50128799587841 94.625 2 2.0865533230293662 4.05 3 0.28335909325090164 0.8250000000000001 4 0.1287995878413189 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668910 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668910_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.26525 32.0 32.0 32.0 32.0 32.0 2 31.08725 32.0 32.0 32.0 32.0 32.0 3 31.15025 32.0 32.0 32.0 32.0 32.0 4 31.185 32.0 32.0 32.0 32.0 32.0 5 31.2615 32.0 32.0 32.0 32.0 32.0 6 34.71525 36.0 36.0 36.0 32.0 36.0 7 34.6155 36.0 36.0 36.0 32.0 36.0 8 34.546 36.0 36.0 36.0 32.0 36.0 9 34.55825 36.0 36.0 36.0 32.0 36.0 10-11 34.483374999999995 36.0 36.0 36.0 32.0 36.0 12-13 34.504375 36.0 36.0 36.0 32.0 36.0 14-15 34.429375 36.0 36.0 36.0 32.0 36.0 16-17 34.348124999999996 36.0 36.0 36.0 32.0 36.0 18-19 34.330625 36.0 36.0 36.0 32.0 36.0 20-21 34.200374999999994 36.0 36.0 36.0 32.0 36.0 22-23 34.24525 36.0 36.0 36.0 32.0 36.0 24-25 34.215 36.0 36.0 36.0 32.0 36.0 26-27 34.162375 36.0 36.0 36.0 32.0 36.0 28-29 34.023875000000004 36.0 36.0 36.0 32.0 36.0 30-31 33.955124999999995 36.0 36.0 36.0 32.0 36.0 32-33 34.021625 36.0 36.0 36.0 32.0 36.0 34-35 34.0115 36.0 36.0 36.0 32.0 36.0 36-37 34.0298974230673 36.0 36.0 36.0 32.0 36.0 38-39 33.994370778083564 36.0 36.0 36.0 32.0 36.0 40-41 33.94045534150613 36.0 36.0 36.0 32.0 36.0 42-43 33.909807355516634 36.0 36.0 36.0 29.5 36.0 44-45 33.76519889917438 36.0 36.0 36.0 24.0 36.0 46-47 33.725919439579684 36.0 36.0 36.0 21.0 36.0 48-49 33.84863647735801 36.0 36.0 36.0 27.0 36.0 50-51 33.71090818113585 36.0 36.0 36.0 27.0 36.0 52-53 33.712284213159876 36.0 36.0 36.0 27.0 36.0 54-55 33.642356767575684 36.0 36.0 36.0 27.0 36.0 56-57 33.63847885914436 36.0 36.0 36.0 24.0 36.0 58-59 33.57405554165624 36.0 36.0 36.0 24.0 36.0 60-61 33.46084563422567 36.0 36.0 36.0 24.0 36.0 62-63 33.50087565674255 36.0 36.0 36.0 24.0 36.0 64-65 33.673755316487366 36.0 36.0 36.0 27.0 36.0 66-67 33.468476357267946 36.0 36.0 36.0 24.0 36.0 68-69 33.44708531398548 36.0 36.0 36.0 24.0 36.0 70-71 33.38931133887329 36.0 36.0 36.0 21.0 36.0 72-73 33.40406791754247 36.0 36.0 36.0 21.0 36.0 74-75 33.48501980690284 36.0 36.0 36.0 27.0 36.0 76 32.78790199081164 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 5.0 15 35.0 16 32.0 17 33.0 18 21.0 19 20.0 20 18.0 21 24.0 22 11.0 23 23.0 24 17.0 25 23.0 26 27.0 27 26.0 28 46.0 29 51.0 30 63.0 31 89.0 32 121.0 33 217.0 34 489.0 35 2606.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.08414725770098 19.033308289506635 10.318056599048335 22.564487853744055 2 32.932932932932935 23.573573573573572 26.851851851851855 16.64164164164164 3 27.627627627627625 25.225225225225223 27.127127127127125 20.02002002002002 4 30.172629472104077 31.973980485364024 19.46459844883663 18.388791593695274 5 31.473605203902927 32.77458093570178 19.21441080810608 16.537403052289218 6 26.1195896922692 34.40080060045034 20.94070552914686 18.5389041781336 7 25.31898924193145 18.864148111083313 34.82611958969227 20.99074305729297 8 26.845133850387793 21.31598699024268 24.293219914936202 27.545659244433324 9 25.469101826369776 24.69352014010508 27.24543407555667 22.59194395796848 10-11 29.184388291218415 29.02176632474356 21.31598699024268 20.477858393795348 12-13 28.821616212159118 23.455091318488865 24.31823867900926 23.405053790342755 14-15 26.932699524643482 25.74430823117338 25.65674255691769 21.66624968726545 16-17 28.68401300975732 25.50662997247936 25.106329747310486 20.70302727045284 18-19 28.246184638478862 25.531648736552416 25.619214410808105 20.60295221416062 20-21 28.121090818113586 25.856892669502123 24.73104828621466 21.290968226169625 22-23 28.083562672004003 26.207155366524894 24.1556167125344 21.553665248936703 24-25 28.13360020015011 26.432324243182386 24.55591693770328 20.878158618964225 26-27 27.057793345008758 27.545659244433324 24.86865148861646 20.527895921941454 28-29 27.920940705529144 27.057793345008758 24.0180135101326 21.003252439329497 30-31 28.458844133099824 25.906930197648236 24.943707780835627 20.690517888416313 32-33 27.045283962972228 25.99449587190393 24.956217162872154 22.004003002251686 34-35 27.733299974981236 26.932699524643482 24.20565424068051 21.128346259694773 36-37 28.13360020015011 26.232174130597947 24.706029522141606 20.928196147110334 38-39 27.257943457593193 25.906930197648236 26.019514635976982 20.815611708781585 40-41 27.18288716537403 26.745058794095574 25.143857893420062 20.928196147110334 42-43 27.670753064798596 25.606705028771582 24.91868901676257 21.80385288966725 44-45 26.932699524643482 26.432324243182386 25.181386039529645 21.453590192644484 46-47 27.34550913184889 27.020265198899175 24.455841881411057 21.178383787840882 48-49 26.932699524643482 26.745058794095574 25.606705028771582 20.715536652489366 50-51 26.53239929947461 26.82011508631474 25.13134851138354 21.51613710282712 52-53 27.383037277958465 26.632474355766828 25.168876657493122 20.815611708781585 54-55 27.257943457593193 26.407305479109333 25.444083062296723 20.89066800100075 56-57 26.90768076057043 27.220415311483613 24.7935951963973 21.078308731548663 58-59 26.7575681761321 26.607455591693768 25.25644233174881 21.37853390042532 60-61 27.18288716537403 26.98273705278959 24.83112334250688 21.003252439329497 62-63 26.607455591693768 26.307230422817113 24.856142106579934 22.22917187890918 64-65 26.920190142606952 27.670753064798596 24.73104828621466 20.678008506379786 66-67 27.395546659994995 26.53239929947461 24.856142106579934 21.215911933950462 68-69 26.670002501876404 27.633224918689013 25.106329747310486 20.590442832124094 70-71 26.329620823426353 27.681141283944438 25.215867851332753 20.773370041296456 72-73 26.120246014811094 27.099284548763652 25.442450106690096 21.338019329735157 74-75 25.589496248660236 24.19614147909968 27.30439442658092 22.909967845659164 76 31.08728943338438 0.0 37.21286370597244 31.699846860643184 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.5 16 1.5 17 1.5 18 1.0 19 1.0 20 1.5 21 2.5 22 2.0 23 2.0 24 2.5 25 2.0 26 4.0 27 6.0 28 6.0 29 9.5 30 16.5 31 25.5 32 33.5 33 34.5 34 44.5 35 64.0 36 77.0 37 89.0 38 117.5 39 162.0 40 188.0 41 203.5 42 222.0 43 242.0 44 269.0 45 269.5 46 266.0 47 305.0 48 317.5 49 270.0 50 228.0 51 206.0 52 186.5 53 161.5 54 142.5 55 121.0 56 109.0 57 107.5 58 98.0 59 87.0 60 67.0 61 52.0 62 43.0 63 32.5 64 21.5 65 14.0 66 12.5 67 11.5 68 10.5 69 9.0 70 9.5 71 11.5 72 11.0 73 11.0 74 8.5 75 5.5 76 4.0 77 3.5 78 4.5 79 5.0 80 4.5 81 4.5 82 4.0 83 3.0 84 3.5 85 4.5 86 5.0 87 5.0 88 5.0 89 4.0 90 4.0 91 3.5 92 2.0 93 3.0 94 2.5 95 2.5 96 4.0 97 5.5 98 7.0 99 39.5 100 72.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.1 3 0.1 4 0.075 5 0.075 6 0.075 7 0.075 8 0.075 9 0.075 10-11 0.075 12-13 0.075 14-15 0.075 16-17 0.075 18-19 0.075 20-21 0.075 22-23 0.075 24-25 0.075 26-27 0.075 28-29 0.075 30-31 0.075 32-33 0.075 34-35 0.075 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 3.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 1.0 70 1.0 71 6.0 72 11.0 73 86.0 74 320.0 75 960.0 76 2612.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.65 #Duplication Level Percentage of deduplicated Percentage of total 1 97.96131730266598 93.7 2 1.6989022477783586 3.25 3 0.26136957658128596 0.75 4 0.052273915316257184 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.026136957658128592 2.1 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 84 2.1 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1308421 spots for SRR9668910.sra Written 1308421 spots for SRR9668910.sra Read 1308421 spots for SRR9668910.sra Written 1308421 spots for SRR9668910.sra Read 1308421 spots for SRR9668910.sra Written 1308421 spots for SRR9668910.sra Read 1308421 spots for SRR9668910.sra Written 1308421 spots for SRR9668910.sra Read 1308421 spots for SRR9668910.sra Written 1308421 spots for SRR9668910.sra Read 1308421 spots for SRR9668910.sra Written 1308421 spots for SRR9668910.sra Read 1308421 spots for SRR9668910.sra Written 1308421 spots for SRR9668910.sra Read 1308421 spots for SRR9668910.sra Written 1308421 spots for SRR9668910.sra Read 1308421 spots for SRR9668910.sra Written 1308421 spots for SRR9668910.sra Read 1308421 spots for SRR9668910.sra Written 1308421 spots for SRR9668910.sra Read 1308421 spots for SRR9668910.sra Written 1308421 spots for SRR9668910.sra Read 1308421 spots for SRR9668910.sra Written 1308421 spots for SRR9668910.sra Read 1308421 spots for SRR9668910.sra Written 1308421 spots for SRR9668910.sra Read 1308421 spots for SRR9668910.sra Written 1308421 spots for SRR9668910.sra Read 1308421 spots for SRR9668910.sra Written 1308421 spots for SRR9668910.sra Read 1308421 spots for SRR9668910.sra Written 1308421 spots for SRR9668910.sra Read 1308421 spots for SRR9668910.sra Written 1308421 spots for SRR9668910.sra Read 1308421 spots for SRR9668910.sra Written 1308421 spots for SRR9668910.sra Read 1308421 spots for SRR9668910.sra Written 1308421 spots for SRR9668910.sra Read 1308421 spots for SRR9668910.sra Written 1308421 spots for SRR9668910.sra SRR ids: ['SRR9668910.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n5y6ic_h SRR9668910.sra spots: 26168420 blocks: [[1, 1308421], [1308422, 2616842], [2616843, 3925263], [3925264, 5233684], [5233685, 6542105], [6542106, 7850526], [7850527, 9158947], [9158948, 10467368], [10467369, 11775789], [11775790, 13084210], [13084211, 14392631], [14392632, 15701052], [15701053, 17009473], [17009474, 18317894], [18317895, 19626315], [19626316, 20934736], [20934737, 22243157], [22243158, 23551578], [23551579, 24859999], [24860000, 26168420]] SRR9668910 file size 4959298 SRR9668910 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668910 SRR9668910_1.fastq SRR9668910_2.fastq Input file: SRR9668910_1.fastq Paired file: SRR9668910_2.fastq trimmed: SRR9668910-trimmed-pair1.fastq, SRR9668910-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:44:37 2025 >> started Wed Feb 12 16:44:59 2025 >> done (22.534s) 26168420 read pairs processed; of these: 16 ( 0.00%) short read pairs filtered out after trimming by size control 59709 ( 0.23%) empty read pairs filtered out after trimming by size control 26108695 (99.77%) read pairs available; of these: 2843 ( 0.01%) trimmed read pairs available after processing 26105852 (99.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 3 0.00% 24 0 0.00% 25 1 0.00% 26 11 0.00% 27 9 0.00% 28 10 0.00% 29 9 0.00% 30 6 0.00% 31 7 0.00% 32 10 0.00% 33 10 0.00% 34 15 0.00% 35 76 0.00% 36 81 0.00% 37 106 0.00% 38 122 0.00% 39 171 0.00% 40 193 0.00% 41 249 0.00% 42 278 0.00% 43 302 0.00% 44 333 0.00% 45 411 0.00% 46 431 0.00% 47 535 0.00% 48 666 0.00% 49 765 0.00% 50 949 0.00% 51 1024 0.00% 52 1125 0.00% 53 1274 0.00% 54 1255 0.00% 55 1427 0.01% 56 1615 0.01% 57 1875 0.01% 58 2166 0.01% 59 2387 0.01% 60 2563 0.01% 61 2880 0.01% 62 3013 0.01% 63 3383 0.01% 64 3578 0.01% 65 3877 0.01% 66 3998 0.02% 67 4409 0.02% 68 4691 0.02% 69 5404 0.02% 70 6206 0.02% 71 8018 0.03% 72 21049 0.08% 73 219470 0.84% 74 2106190 8.07% 75 12471135 47.77% 76 11218921 42.97% 26108695 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=14 prefix-density=0.60 prefix-fanout=2.2 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.07 sequence-density-rank=24 fanout-score=15.13 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=3.2 sequence=CCATCTTTCGGCTAACCTAGCCTCCTCCGTCCCTCGGGACCAACAAGGGGTAGTACAGGAATATTCGCCTGTTGTCCATCGACTACGCCTTTCGGCCTGATCTTAGGCCCTGACTCACCCTCCGTGGACGAACCTTGCGGAGGAACCCTTAGGTTTTCGGGGCATTGGATTCTCACCAATGTTTGCGTTACTCAAGCCGACATTCTCGCTTCCGCTTCGTCCACCCCCGCTCGCGCGGGTGCTTCCCTCTAAGCGGAACGCTCCCCTACCGATGCATTTTTACATCCCACAGCTTCGGCAGATCGCTTAGCCCCGTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTATTACGCACTCTTTCAAGGGTGGCTGCTTCTAGGCAAACCTCCTGGCTGTCTCTGCACCCCTACCTCCTTTATCACTGAGCGGTCATTTAGGGGCCTTAGCTGGTGATCCGGGCTGTTTCCCTCTCGACGATGAAGCTTATCCCCCACCGTCTCACTGGC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=25 prefix-density=0.46 prefix-fanout=1.9 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=9.37 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=1.7 sequence=GGCCGTCGGTGCAGATCTTGGTGGTAGTAGCAAATATTCAAATGAGAACTTTGAAGGCCGAAGAGGGGAAAGGTTCCATGTGAACGGCACTTGCACATGGGTTAGTCGATCCTAAGAGACGGGGGAAGCCCGTCCGACAGCGCGTTCGCGCGCGAGCTTCGAAAGGGAATCGGGTTAAAATTCCTGAACCGGGACGTGGCGGCTGACGGCAACGTTAGGGAGTCCGGAGACGTCGGCGGGGGCCTCGGGAAGAGTTATCTTTTCTGTTTAACAGCCCGCCCACCCTGGAAACGACTTAGTCGGAGGTAGGGTCCAGCGGCTGGAAGAGCACCGCACGTCGCGTGGTGTCCGGTGCGCCCCCGGCGGCCCTTGAAAATCCGGAGGACCGAGTGCCTCCCACGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAACAGCCTCTGGTCGATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTCGGGAAAAGG SRR9668910 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:45:28 Started mapping on | Feb 12 16:45:29 Finished on | Feb 12 16:47:09 Mapping speed, Million of reads per hour | 939.91 Number of input reads | 26108695 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 19894032 Uniquely mapped reads % | 76.20% Average mapped length | 150.33 Number of splices: Total | 8321300 Number of splices: Annotated (sjdb) | 8227735 Number of splices: GT/AG | 8162222 Number of splices: GC/AG | 135858 Number of splices: AT/AC | 5658 Number of splices: Non-canonical | 17562 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.02% Deletion average length | 2.18 Insertion rate per base | 0.02% Insertion average length | 2.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1021759 % of reads mapped to multiple loci | 3.91% Number of reads mapped to too many loci | 2078654 % of reads mapped to too many loci | 7.96% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.62% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5192904 5192904 5192904 N_multimapping 1021759 1021759 1021759 N_noFeature 782221 19602992 869545 N_ambiguous 329196 1366 124371 UnstrandedReadsAssigned:18782615 PositiveStrandReadsAssigned:289674 NegativeStrandReadsAssigned:18900116 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668910 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668910-trimmed-pair1.fastq SRR9668910-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,108,695 reads, 21,535,633 reads pseudoaligned [quant] estimated average fragment length: 197.506 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52401 SRR9668910.ke.tsv 34699 SRR9668910.se.tsv 87100 total ==> SRR9668910.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1821.49 350 7.34366 Potri.005G024800.1.v4.1 1035 838.494 107 4.87703 Potri.004G059700.1.v4.1 961 764.498 36 1.79969 Potri.007G009000.2.v4.1 1416 1219.49 0 0 Potri.003G141000.2.v4.1 2943 2746.49 340.241 4.73457 Potri.016G087400.1.v4.1 270 91.7982 1200.22 499.689 Potri.015G069301.1.v4.1 564 367.768 0 0 Potri.010G195200.1.v4.1 1773 1576.49 3 0.0727279 Potri.012G127500.1.v4.1 977 780.498 4353 213.152 ==> SRR9668910.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 11 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 289 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 70 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR9668910 completed mapping pipeline successfully