Starting /dee2/code/volunteer_pipeline.sh SRR9668912 current disk space = 3051855429632 free memory = 1480454752 SRR9668912 SRAfilesize 37d3be5078fe5788d9c461d0df98f74e SRR9668912.sra SRR9668912.sra file validated SRR9668912 is paired end SRR9668912 is conventional basespace SRR9668912 read1 length is 62-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668912_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 62-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.73425 32.0 32.0 32.0 32.0 32.0 2 31.7245 32.0 32.0 32.0 32.0 32.0 3 31.7275 32.0 32.0 32.0 32.0 32.0 4 31.74125 32.0 32.0 32.0 32.0 32.0 5 31.7595 32.0 32.0 32.0 32.0 32.0 6 35.45525 36.0 36.0 36.0 36.0 36.0 7 35.49775 36.0 36.0 36.0 36.0 36.0 8 35.483 36.0 36.0 36.0 36.0 36.0 9 35.5165 36.0 36.0 36.0 36.0 36.0 10-11 35.318749999999994 36.0 36.0 36.0 36.0 36.0 12-13 35.4045 36.0 36.0 36.0 36.0 36.0 14-15 35.40775 36.0 36.0 36.0 36.0 36.0 16-17 35.37425 36.0 36.0 36.0 36.0 36.0 18-19 35.414249999999996 36.0 36.0 36.0 36.0 36.0 20-21 35.4285 36.0 36.0 36.0 36.0 36.0 22-23 35.436625 36.0 36.0 36.0 36.0 36.0 24-25 35.345875 36.0 36.0 36.0 36.0 36.0 26-27 35.328375 36.0 36.0 36.0 36.0 36.0 28-29 35.36025 36.0 36.0 36.0 36.0 36.0 30-31 35.248000000000005 36.0 36.0 36.0 36.0 36.0 32-33 35.28574999999999 36.0 36.0 36.0 36.0 36.0 34-35 35.288624999999996 36.0 36.0 36.0 36.0 36.0 36-37 35.22625 36.0 36.0 36.0 36.0 36.0 38-39 35.28075 36.0 36.0 36.0 36.0 36.0 40-41 35.2725 36.0 36.0 36.0 36.0 36.0 42-43 35.22425 36.0 36.0 36.0 36.0 36.0 44-45 35.19675 36.0 36.0 36.0 36.0 36.0 46-47 35.092124999999996 36.0 36.0 36.0 36.0 36.0 48-49 35.142624999999995 36.0 36.0 36.0 36.0 36.0 50-51 35.144125 36.0 36.0 36.0 36.0 36.0 52-53 34.974625 36.0 36.0 36.0 34.0 36.0 54-55 35.06375 36.0 36.0 36.0 34.0 36.0 56-57 35.002375 36.0 36.0 36.0 36.0 36.0 58-59 34.895125 36.0 36.0 36.0 32.0 36.0 60-61 34.832125000000005 36.0 36.0 36.0 32.0 36.0 62-63 34.86984229614808 36.0 36.0 36.0 34.0 36.0 64-65 34.86293146573286 36.0 36.0 36.0 32.0 36.0 66-67 34.901700850425215 36.0 36.0 36.0 32.0 36.0 68-69 34.68021510755378 36.0 36.0 36.0 32.0 36.0 70-71 34.637404923377375 36.0 36.0 36.0 32.0 36.0 72-73 34.63451994456942 36.0 36.0 36.0 32.0 36.0 74-75 34.661164629808695 36.0 36.0 36.0 32.0 36.0 76 33.76744186046512 36.0 32.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 3.0 25 7.0 26 12.0 27 30.0 28 36.0 29 37.0 30 68.0 31 74.0 32 98.0 33 157.0 34 416.0 35 3061.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.65 12.174999999999999 10.05 43.125 2 22.625 15.625 39.375 22.375 3 19.85 18.5 24.85 36.8 4 23.65 29.525000000000002 22.275 24.55 5 21.475 33.275 25.074999999999996 20.175 6 18.95 34.925 25.8 20.325 7 15.975 24.3 42.1 17.625 8 17.4 22.85 32.35 27.400000000000002 9 17.525 22.2 34.4 25.874999999999996 10-11 21.65 32.675 22.7 22.975 12-13 21.3 25.7 26.724999999999998 26.275 14-15 20.5125 27.35 27.975 24.1625 16-17 21.558084281605602 26.710016256096036 27.085156933850197 24.64674252844817 18-19 19.925 27.3 28.0625 24.712500000000002 20-21 22.1 26.9125 27.500000000000004 23.4875 22-23 21.2625 28.025 26.575 24.1375 24-25 20.575 27.325 27.075 25.025 26-27 21.375 25.424999999999997 27.650000000000002 25.55 28-29 21.2875 27.05 26.937499999999996 24.725 30-31 20.70776541202951 27.485306990121295 26.722520945354507 25.084406652494685 32-33 21.4125 26.8625 26.974999999999998 24.75 34-35 21.5 26.8 27.1375 24.5625 36-37 21.087500000000002 26.85 27.737499999999997 24.325 38-39 21.0125 27.025 27.775 24.1875 40-41 22.537499999999998 27.224999999999998 25.9625 24.275 42-43 21.5 26.3 27.762500000000003 24.4375 44-45 21.775 26.987499999999997 27.05 24.1875 46-47 21.1375 27.750000000000004 26.950000000000003 24.1625 48-49 21.0 27.55 25.5625 25.887500000000003 50-51 20.9 27.85 27.3 23.95 52-53 21.45 27.150000000000002 27.725 23.674999999999997 54-55 21.125 27.787499999999998 26.474999999999998 24.6125 56-57 21.349999999999998 26.174999999999997 26.85 25.624999999999996 58-59 20.674999999999997 27.8625 27.1375 24.325 60-61 21.5 27.35 25.7 25.45 62-63 21.73043260815204 27.38184546136534 25.943985996499126 24.943735933983497 64-65 21.298149074537267 27.47623811905953 26.850925462731368 24.374687343671837 66-67 20.96048024012006 27.70135067533767 26.525762881440716 24.81240620310155 68-69 20.947973986993496 27.688844422211105 26.375687843921963 24.987493746873437 70-71 21.263289555972484 27.604752970606626 26.216385240775487 24.915572232645403 72-73 22.407732864674866 27.403966859151392 25.847351242781823 24.340949033391915 74-75 20.569830914658503 24.231127679403542 29.157236053787777 26.04180535215018 76 23.33206252382768 0.0 39.38238658025162 37.2855508959207 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 3.5 18 2.5 19 0.5 20 2.0 21 4.5 22 3.0 23 1.0 24 3.0 25 7.0 26 10.5 27 14.5 28 15.0 29 16.0 30 24.5 31 41.0 32 57.0 33 56.5 34 59.5 35 86.5 36 106.5 37 117.0 38 137.0 39 162.5 40 194.0 41 219.5 42 230.5 43 262.5 44 289.0 45 298.5 46 306.0 47 301.0 48 279.5 49 275.0 50 280.0 51 233.0 52 191.5 53 166.0 54 153.5 55 143.5 56 120.0 57 101.5 58 90.5 59 80.0 60 60.5 61 37.5 62 22.5 63 15.5 64 8.5 65 9.0 66 9.0 67 9.0 68 7.5 69 4.0 70 3.5 71 4.0 72 3.0 73 1.5 74 1.0 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0375 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0375 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 62 2.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 1.0 71 3.0 72 22.0 73 81.0 74 271.0 75 997.0 76 2623.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.575 #Duplication Level Percentage of deduplicated Percentage of total 1 97.20424540512556 93.875 2 2.3039088791095006 4.45 3 0.36241263266891016 1.05 4 0.025886616619207874 0.1 5 0.0776598498576236 0.375 6 0.025886616619207874 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGTTGAAGACCAACAATTGCAATGATCTATCCCCATCACGATGAAATT 6 0.15 No Hit GTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACGTCAGTATCGCTGCGGGCCTCCACC 5 0.125 No Hit CCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCA 5 0.125 No Hit GTTGAGACTAGGACGGTATCTGATCGTCTTCGAGCCCCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668912 read2 length is 62-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668912_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 62-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4175 32.0 32.0 32.0 32.0 32.0 2 31.2625 32.0 32.0 32.0 32.0 32.0 3 31.205 32.0 32.0 32.0 32.0 32.0 4 31.226 32.0 32.0 32.0 32.0 32.0 5 31.25675 32.0 32.0 32.0 32.0 32.0 6 34.91 36.0 36.0 36.0 36.0 36.0 7 34.93125 36.0 36.0 36.0 36.0 36.0 8 34.93875 36.0 36.0 36.0 36.0 36.0 9 34.831 36.0 36.0 36.0 36.0 36.0 10-11 34.836875 36.0 36.0 36.0 34.0 36.0 12-13 34.80525 36.0 36.0 36.0 36.0 36.0 14-15 34.86825 36.0 36.0 36.0 36.0 36.0 16-17 34.866875 36.0 36.0 36.0 36.0 36.0 18-19 34.809 36.0 36.0 36.0 36.0 36.0 20-21 34.616249999999994 36.0 36.0 36.0 32.0 36.0 22-23 34.7615 36.0 36.0 36.0 34.0 36.0 24-25 34.7035 36.0 36.0 36.0 34.0 36.0 26-27 34.737375 36.0 36.0 36.0 36.0 36.0 28-29 34.593875 36.0 36.0 36.0 34.0 36.0 30-31 34.681 36.0 36.0 36.0 36.0 36.0 32-33 34.5685 36.0 36.0 36.0 32.0 36.0 34-35 34.5715 36.0 36.0 36.0 32.0 36.0 36-37 34.628249999999994 36.0 36.0 36.0 34.0 36.0 38-39 34.581875 36.0 36.0 36.0 34.0 36.0 40-41 34.503 36.0 36.0 36.0 32.0 36.0 42-43 34.525999999999996 36.0 36.0 36.0 32.0 36.0 44-45 34.430625000000006 36.0 36.0 36.0 32.0 36.0 46-47 34.477625 36.0 36.0 36.0 32.0 36.0 48-49 34.4345 36.0 36.0 36.0 32.0 36.0 50-51 34.359125 36.0 36.0 36.0 32.0 36.0 52-53 34.427375 36.0 36.0 36.0 32.0 36.0 54-55 34.27675 36.0 36.0 36.0 32.0 36.0 56-57 34.407125 36.0 36.0 36.0 32.0 36.0 58-59 34.3365 36.0 36.0 36.0 32.0 36.0 60-61 34.141000000000005 36.0 36.0 36.0 32.0 36.0 62-63 34.20640382691346 36.0 36.0 36.0 32.0 36.0 64-65 34.31990995497749 36.0 36.0 36.0 32.0 36.0 66-67 34.07803901950975 36.0 36.0 36.0 32.0 36.0 68-69 34.07891445722861 36.0 36.0 36.0 32.0 36.0 70-71 34.06253621054772 36.0 36.0 36.0 32.0 36.0 72-73 34.14379627835732 36.0 36.0 36.0 32.0 36.0 74-75 34.02730619749952 36.0 36.0 36.0 32.0 36.0 76 33.334348819497336 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 6.0 16 4.0 17 6.0 18 5.0 19 5.0 20 6.0 21 8.0 22 9.0 23 12.0 24 27.0 25 20.0 26 29.0 27 34.0 28 53.0 29 70.0 30 80.0 31 100.0 32 145.0 33 215.0 34 594.0 35 2572.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.047094188376754 21.59318637274549 12.17434869739479 30.185370741482963 2 27.188594297148573 26.313156578289142 32.44122061030515 14.057028514257128 3 22.386193096548272 26.538269134567283 29.014507253626814 22.061030515257627 4 25.825 31.8 22.675 19.7 5 26.924999999999997 34.8 20.549999999999997 17.724999999999998 6 20.3 36.125 22.875 20.7 7 19.950000000000003 19.425 38.375 22.25 8 23.625 23.5 25.825 27.05 9 23.35 24.875 28.349999999999998 23.425 10-11 25.874999999999996 31.4375 21.55 21.1375 12-13 25.8625 24.587500000000002 26.3 23.25 14-15 24.7875 27.025 26.75 21.4375 16-17 25.174999999999997 26.6 25.575 22.650000000000002 18-19 24.975 27.212500000000002 25.1 22.7125 20-21 24.175 27.187499999999996 26.737499999999997 21.9 22-23 25.137500000000003 27.287499999999998 25.775 21.8 24-25 24.3875 27.35 27.187499999999996 21.075 26-27 25.025 27.025 25.8625 22.0875 28-29 25.25 27.474999999999998 25.7875 21.4875 30-31 24.95 27.8625 25.837500000000002 21.349999999999998 32-33 24.887500000000003 27.6 26.7125 20.8 34-35 25.6125 26.674999999999997 25.6 22.112499999999997 36-37 24.462500000000002 27.025 26.637499999999996 21.875 38-39 25.224999999999998 27.3125 26.1 21.3625 40-41 25.174999999999997 26.687499999999996 25.825 22.3125 42-43 24.8625 27.537499999999998 26.125 21.475 44-45 23.65 27.075 26.025 23.25 46-47 24.55 27.474999999999998 26.5125 21.462500000000002 48-49 24.8125 26.474999999999998 26.924999999999997 21.7875 50-51 24.8 26.9625 26.400000000000002 21.837500000000002 52-53 25.087500000000002 26.900000000000002 26.887499999999996 21.125 54-55 24.462500000000002 26.625 26.5625 22.35 56-57 25.2875 26.875 26.150000000000002 21.6875 58-59 24.725 26.8625 26.575 21.837500000000002 60-61 25.025 26.224999999999998 26.55 22.2 62-63 24.93123280820205 25.95648912228057 27.04426106526632 22.06801700425106 64-65 25.400200100050025 26.225612806403202 26.3631815907954 22.011005502751377 66-67 24.88744372186093 26.87593796898449 26.025512756378188 22.211105552776388 68-69 24.537268634317158 26.93846923461731 26.813406703351678 21.710855427713856 70-71 24.59344508381286 26.957718288716535 26.857643232424316 21.591193395046286 72-73 25.477147162230036 25.96685082872928 26.833249623304873 21.72275238573581 74-75 24.717457784869033 23.893099321898685 28.30740593006249 23.08203696316979 76 28.865194211728866 0.0 38.1949733434882 32.939832444782944 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.5 18 1.0 19 1.5 20 2.0 21 0.5 22 0.5 23 1.5 24 2.5 25 2.5 26 2.5 27 6.0 28 7.0 29 6.0 30 10.0 31 19.0 32 28.0 33 34.0 34 49.0 35 65.0 36 81.5 37 99.5 38 129.0 39 166.0 40 204.5 41 239.5 42 259.5 43 294.5 44 305.5 45 316.5 46 341.5 47 338.5 48 312.0 49 262.0 50 228.0 51 203.0 52 179.0 53 158.5 54 136.0 55 129.0 56 118.0 57 94.5 58 82.0 59 71.5 60 54.0 61 43.0 62 36.5 63 25.5 64 18.0 65 15.0 66 11.0 67 10.5 68 7.5 69 6.5 70 6.0 71 3.0 72 2.0 73 3.0 74 2.5 75 0.0 76 0.0 77 1.5 78 2.0 79 1.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 1.0 87 2.5 88 2.5 89 1.0 90 0.0 91 0.0 92 0.0 93 1.5 94 1.5 95 0.0 96 0.0 97 0.5 98 0.5 99 6.0 100 12.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.05 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 62 2.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 2.0 71 4.0 72 20.0 73 75.0 74 273.0 75 998.0 76 2626.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.875 #Duplication Level Percentage of deduplicated Percentage of total 1 97.78064516129032 94.72500000000001 2 1.703225806451613 3.3000000000000003 3 0.2838709677419355 0.8250000000000001 4 0.15483870967741936 0.6 5 0.05161290322580645 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025806451612903226 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit CTTACCAGGTCCAGACATAGTAAGGATTGACAGACTGAGAGCTCTTTCTT 5 0.125 No Hit GGGGAATCCGACTGTTTAATTAAAACAAAGCATTGCGATGGTCCCTGCGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1599022 spots for SRR9668912.sra Written 1599022 spots for SRR9668912.sra Read 1599022 spots for SRR9668912.sra Written 1599022 spots for SRR9668912.sra Read 1599022 spots for SRR9668912.sra Written 1599022 spots for SRR9668912.sra Read 1599022 spots for SRR9668912.sra Written 1599022 spots for SRR9668912.sra Read 1599022 spots for SRR9668912.sra Written 1599022 spots for SRR9668912.sra Read 1599022 spots for SRR9668912.sra Written 1599022 spots for SRR9668912.sra Read 1599022 spots for SRR9668912.sra Written 1599022 spots for SRR9668912.sra Read 1599022 spots for SRR9668912.sra Written 1599022 spots for SRR9668912.sra Read 1599022 spots for SRR9668912.sra Written 1599022 spots for SRR9668912.sra Read 1599022 spots for SRR9668912.sra Written 1599022 spots for SRR9668912.sra Read 1599022 spots for SRR9668912.sra Written 1599022 spots for SRR9668912.sra Read 1599022 spots for SRR9668912.sra Written 1599022 spots for SRR9668912.sra Read 1599022 spots for SRR9668912.sra Written 1599022 spots for SRR9668912.sra Read 1599022 spots for SRR9668912.sra Written 1599022 spots for SRR9668912.sra Read 1599022 spots for SRR9668912.sra Written 1599022 spots for SRR9668912.sra Read 1599022 spots for SRR9668912.sra Written 1599022 spots for SRR9668912.sra Read 1599022 spots for SRR9668912.sra Written 1599022 spots for SRR9668912.sra Read 1599022 spots for SRR9668912.sra Written 1599022 spots for SRR9668912.sra Read 1599022 spots for SRR9668912.sra Written 1599022 spots for SRR9668912.sra Read 1599028 spots for SRR9668912.sra Written 1599028 spots for SRR9668912.sra SRR ids: ['SRR9668912.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bt4sapkz SRR9668912.sra spots: 31980446 blocks: [[1, 1599022], [1599023, 3198044], [3198045, 4797066], [4797067, 6396088], [6396089, 7995110], [7995111, 9594132], [9594133, 11193154], [11193155, 12792176], [12792177, 14391198], [14391199, 15990220], [15990221, 17589242], [17589243, 19188264], [19188265, 20787286], [20787287, 22386308], [22386309, 23985330], [23985331, 25584352], [25584353, 27183374], [27183375, 28782396], [28782397, 30381418], [30381419, 31980446]] SRR9668912 file size 6069270 SRR9668912 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668912 SRR9668912_1.fastq SRR9668912_2.fastq Input file: SRR9668912_1.fastq Paired file: SRR9668912_2.fastq trimmed: SRR9668912-trimmed-pair1.fastq, SRR9668912-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:03:13 2025 >> started Wed Feb 12 16:03:40 2025 >> done (26.448s) 31980446 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 3569 ( 0.01%) empty read pairs filtered out after trimming by size control 31976877 (99.99%) read pairs available; of these: 3726 ( 0.01%) trimmed read pairs available after processing 31973151 (99.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 3 0.00% 22 2 0.00% 23 2 0.00% 24 8 0.00% 25 4 0.00% 26 4 0.00% 27 3 0.00% 28 12 0.00% 29 16 0.00% 30 17 0.00% 31 15 0.00% 32 13 0.00% 33 18 0.00% 34 13 0.00% 35 55 0.00% 36 65 0.00% 37 70 0.00% 38 67 0.00% 39 91 0.00% 40 97 0.00% 41 132 0.00% 42 151 0.00% 43 171 0.00% 44 189 0.00% 45 186 0.00% 46 191 0.00% 47 226 0.00% 48 265 0.00% 49 350 0.00% 50 423 0.00% 51 449 0.00% 52 544 0.00% 53 534 0.00% 54 597 0.00% 55 773 0.00% 56 843 0.00% 57 1014 0.00% 58 1218 0.00% 59 1315 0.00% 60 1460 0.00% 61 1510 0.00% 62 1783 0.01% 63 2009 0.01% 64 2277 0.01% 65 2475 0.01% 66 2775 0.01% 67 3078 0.01% 68 3354 0.01% 69 3834 0.01% 70 5007 0.02% 71 7567 0.02% 72 23289 0.07% 73 264804 0.83% 74 2574391 8.05% 75 15318015 47.90% 76 13749102 43.00% 31976877 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=30 prefix-density=0.58 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=21.76 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=1.8 sequence=CGCATCGCCGGTAGAAGGGACGAGGCGACCGGTGCACACCTGAGGCGGACCGGCCGACCCAACCCAAAGTCCAACTACGAGCTTTTTAACTGCAACAACTTAAATATACGCTATTGGAGCTGGAATTACCGCGGCTGCTGGCACCAGACTTGCCCTCCAATGGATCCTCGTTAAGGGATTTAGATTGTACTCATTCCAATTACCAGACTCGAAGAGCCCGGTATTGTTATTTATTGTCACTACCTCCCCGTGTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTAATTCTCCGTCACCCGTCACCACCATGGTAGGCCTCTATCCTACCATCGAAAGTTGATAGGGCAGAAATTTGAATGATGCGTCGCCAGCACGAAGGCCGTGCGATCCGTCGAGTTATCATGAATCATCAGAGCAACGGGCAGAGCCCGCGTCGACCTTTTATCTAATAAATGCGTC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=26 prefix-density=0.48 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=20.79 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=3.1 sequence=CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR9668912 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:04:13 Started mapping on | Feb 12 16:04:13 Finished on | Feb 12 16:06:13 Mapping speed, Million of reads per hour | 959.31 Number of input reads | 31976877 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 25874657 Uniquely mapped reads % | 80.92% Average mapped length | 150.44 Number of splices: Total | 11013724 Number of splices: Annotated (sjdb) | 10895127 Number of splices: GT/AG | 10803412 Number of splices: GC/AG | 180366 Number of splices: AT/AC | 7734 Number of splices: Non-canonical | 22212 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.02% Deletion average length | 2.17 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1373074 % of reads mapped to multiple loci | 4.29% Number of reads mapped to too many loci | 3501032 % of reads mapped to too many loci | 10.95% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.49% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4729146 4729146 4729146 N_multimapping 1373074 1373074 1373074 N_noFeature 1214685 25518357 1303976 N_ambiguous 429898 1682 161524 UnstrandedReadsAssigned:24230074 PositiveStrandReadsAssigned:354618 NegativeStrandReadsAssigned:24409157 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668912 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668912-trimmed-pair1.fastq SRR9668912-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,976,877 reads, 27,536,034 reads pseudoaligned [quant] estimated average fragment length: 196.327 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,021 rounds 52401 SRR9668912.ke.tsv 34699 SRR9668912.se.tsv 87100 total ==> SRR9668912.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1822.67 365 5.88782 Potri.005G024800.1.v4.1 1035 839.673 133 4.65706 Potri.004G059700.1.v4.1 961 765.677 51 1.95837 Potri.007G009000.2.v4.1 1416 1220.67 0 0 Potri.003G141000.2.v4.1 2943 2747.67 343.105 3.67141 Potri.016G087400.1.v4.1 270 92.9939 1523.66 481.73 Potri.015G069301.1.v4.1 564 368.991 0 0 Potri.010G195200.1.v4.1 1773 1577.67 1 0.018636 Potri.012G127500.1.v4.1 977 781.673 5306 199.578 ==> SRR9668912.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 21 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 356 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 50 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 10 SRR9668912 completed mapping pipeline successfully