Starting /dee2/code/volunteer_pipeline.sh SRR9668914 current disk space = 3051966861312 free memory = 1424842764 SRR9668914 SRAfilesize b21eb033639c87a0104891aee97f57de SRR9668914.sra SRR9668914.sra file validated SRR9668914 is paired end SRR9668914 is conventional basespace SRR9668914 read1 length is 38-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668914_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 38-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.72725 32.0 32.0 32.0 32.0 32.0 2 31.69275 32.0 32.0 32.0 32.0 32.0 3 31.794 32.0 32.0 32.0 32.0 32.0 4 31.7505 32.0 32.0 32.0 32.0 32.0 5 31.77225 32.0 32.0 32.0 32.0 32.0 6 35.3975 36.0 36.0 36.0 36.0 36.0 7 35.4175 36.0 36.0 36.0 36.0 36.0 8 35.553 36.0 36.0 36.0 36.0 36.0 9 35.46325 36.0 36.0 36.0 36.0 36.0 10-11 35.417 36.0 36.0 36.0 36.0 36.0 12-13 35.327 36.0 36.0 36.0 36.0 36.0 14-15 35.388999999999996 36.0 36.0 36.0 36.0 36.0 16-17 35.372 36.0 36.0 36.0 36.0 36.0 18-19 35.393125 36.0 36.0 36.0 36.0 36.0 20-21 35.35875 36.0 36.0 36.0 36.0 36.0 22-23 35.318 36.0 36.0 36.0 36.0 36.0 24-25 35.3505 36.0 36.0 36.0 36.0 36.0 26-27 35.365125 36.0 36.0 36.0 36.0 36.0 28-29 35.354375 36.0 36.0 36.0 36.0 36.0 30-31 35.290625 36.0 36.0 36.0 36.0 36.0 32-33 35.3155 36.0 36.0 36.0 36.0 36.0 34-35 35.206375 36.0 36.0 36.0 36.0 36.0 36-37 35.27775 36.0 36.0 36.0 36.0 36.0 38-39 35.287910040010004 36.0 36.0 36.0 36.0 36.0 40-41 35.25618904726181 36.0 36.0 36.0 36.0 36.0 42-43 35.2326831707927 36.0 36.0 36.0 36.0 36.0 44-45 35.12878219554889 36.0 36.0 36.0 36.0 36.0 46-47 35.110652663165794 36.0 36.0 36.0 36.0 36.0 48-49 35.14391097774444 36.0 36.0 36.0 36.0 36.0 50-51 35.11979254818707 36.0 36.0 36.0 36.0 36.0 52-53 34.998749061796346 36.0 36.0 36.0 34.0 36.0 54-55 34.979484613460095 36.0 36.0 36.0 34.0 36.0 56-57 34.95296472354266 36.0 36.0 36.0 36.0 36.0 58-59 34.898423817863396 36.0 36.0 36.0 32.0 36.0 60-61 34.89367025268952 36.0 36.0 36.0 32.0 36.0 62-63 34.84776082061546 36.0 36.0 36.0 34.0 36.0 64-65 34.9019019019019 36.0 36.0 36.0 34.0 36.0 66-67 34.84021521521521 36.0 36.0 36.0 32.0 36.0 68-69 34.67463392679288 36.0 36.0 36.0 32.0 36.0 70-71 34.592554476270095 36.0 36.0 36.0 32.0 36.0 72-73 34.682858008381814 36.0 36.0 36.0 32.0 36.0 74-75 34.56969482091846 36.0 36.0 36.0 32.0 36.0 76 33.94892473118279 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 4.0 24 1.0 25 11.0 26 15.0 27 27.0 28 24.0 29 46.0 30 56.0 31 83.0 32 101.0 33 185.0 34 407.0 35 3040.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.849999999999994 12.325 10.575 42.25 2 21.425 17.45 38.35 22.775000000000002 3 19.75 20.1 25.624999999999996 34.525 4 23.35 29.625 21.65 25.374999999999996 5 22.1 35.625 23.525 18.75 6 19.55 34.825 25.2 20.424999999999997 7 14.475 23.425 42.9 19.2 8 18.525 22.425 31.5 27.55 9 18.2 23.45 33.6 24.75 10-11 21.5625 32.3625 23.3625 22.7125 12-13 21.0375 24.9375 28.762500000000003 25.2625 14-15 20.674999999999997 26.375 27.625 25.324999999999996 16-17 21.41517689711214 27.19089886235779 27.378422302787847 24.01550193774222 18-19 21.5 26.8625 27.0875 24.55 20-21 20.837500000000002 27.4125 27.462500000000002 24.2875 22-23 20.974999999999998 27.625 27.875 23.525 24-25 21.4 26.375 26.6125 25.6125 26-27 20.549999999999997 27.650000000000002 27.55 24.25 28-29 21.2875 27.5875 26.775 24.349999999999998 30-31 20.977622202775347 27.490936367045883 26.8533566695837 24.678084760595073 32-33 21.375 27.125 27.8625 23.6375 34-35 21.712500000000002 28.1375 26.3625 23.7875 36-37 21.9625 27.287499999999998 26.737499999999997 24.0125 38-39 21.315164395549445 27.453431678959873 26.690836354544317 24.54056757094637 40-41 21.817954488622153 27.70692673168292 26.069017254313575 24.406101525381345 42-43 21.467866966741685 27.144286071517882 27.131782945736433 24.256064016004 44-45 21.9679919979995 26.556639159789945 26.731682920730183 24.74368592148037 46-47 20.64266066516629 27.806951737934483 28.132033008252062 23.418354588647162 48-49 21.417854463615903 27.60690172543136 25.831457864466117 25.143785946486624 50-51 20.432662248343128 27.860447667875455 27.19769913717644 24.509190946604978 52-53 21.56617463097323 27.695771828871653 26.54490868151113 24.193144858643983 54-55 21.553665248936703 28.071053289967473 25.894420815611706 24.48086064548411 56-57 21.165874405804352 27.1703777833375 27.395546659994995 24.26820115086315 58-59 21.078308731548663 27.545659244433324 26.632474355766828 24.74355766825119 60-61 21.778834125594194 26.56992744558419 27.220415311483613 24.430823117338004 62-63 20.89066800100075 27.020265198899175 27.24543407555667 24.843632724543408 64-65 20.445445445445447 27.915415415415417 27.264764764764767 24.374374374374376 66-67 21.383883883883883 27.565065065065063 26.33883883883884 24.71221221221221 68-69 21.5742710549368 27.668627205606306 26.154423726692528 24.602678012764358 70-71 21.091500813618726 26.874452372011515 28.201276755538867 23.832770058830892 72-73 21.06188025605623 27.086732772687334 26.747834818626835 25.1035521526296 74-75 20.958083832335326 24.484364604125084 28.955422488356618 25.602129075182965 76 23.195084485407065 0.0 41.05222734254993 35.752688172043015 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 2.0 21 2.5 22 1.5 23 2.0 24 3.5 25 4.0 26 7.5 27 11.5 28 15.5 29 20.5 30 29.0 31 36.5 32 49.0 33 63.0 34 75.5 35 100.0 36 120.0 37 129.0 38 145.5 39 164.5 40 183.0 41 217.5 42 236.5 43 280.5 44 314.0 45 293.5 46 288.5 47 298.0 48 301.5 49 276.0 50 248.5 51 217.5 52 186.0 53 170.5 54 160.5 55 144.5 56 114.5 57 84.5 58 64.0 59 59.5 60 51.5 61 35.0 62 25.5 63 20.5 64 13.5 65 9.0 66 9.5 67 9.5 68 5.5 69 2.5 70 2.5 71 1.5 72 1.0 73 2.5 74 1.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0125 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0125 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 38 1.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 1.0 51 1.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 1.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 0.0 70 1.0 71 0.0 72 21.0 73 72.0 74 287.0 75 1010.0 76 2604.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.23799795709908 96.175 2 1.4555669050051072 2.85 3 0.22982635342185903 0.675 4 0.07660878447395301 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668914 read2 length is 38-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668914_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 38-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.48125 32.0 32.0 32.0 32.0 32.0 2 31.32075 32.0 32.0 32.0 32.0 32.0 3 31.379 32.0 32.0 32.0 32.0 32.0 4 31.373 32.0 32.0 32.0 32.0 32.0 5 31.4135 32.0 32.0 32.0 32.0 32.0 6 35.06775 36.0 36.0 36.0 36.0 36.0 7 35.035 36.0 36.0 36.0 36.0 36.0 8 34.9775 36.0 36.0 36.0 36.0 36.0 9 35.08975 36.0 36.0 36.0 36.0 36.0 10-11 35.013374999999996 36.0 36.0 36.0 36.0 36.0 12-13 34.99825 36.0 36.0 36.0 36.0 36.0 14-15 35.126125 36.0 36.0 36.0 36.0 36.0 16-17 34.992875 36.0 36.0 36.0 36.0 36.0 18-19 34.940625 36.0 36.0 36.0 36.0 36.0 20-21 34.885374999999996 36.0 36.0 36.0 36.0 36.0 22-23 34.949875000000006 36.0 36.0 36.0 36.0 36.0 24-25 34.849375 36.0 36.0 36.0 36.0 36.0 26-27 34.879000000000005 36.0 36.0 36.0 36.0 36.0 28-29 34.773250000000004 36.0 36.0 36.0 36.0 36.0 30-31 34.76575 36.0 36.0 36.0 36.0 36.0 32-33 34.809875 36.0 36.0 36.0 36.0 36.0 34-35 34.8005 36.0 36.0 36.0 36.0 36.0 36-37 34.786375 36.0 36.0 36.0 36.0 36.0 38-39 34.75772693173293 36.0 36.0 36.0 36.0 36.0 40-41 34.71580395098775 36.0 36.0 36.0 36.0 36.0 42-43 34.72280570142536 36.0 36.0 36.0 36.0 36.0 44-45 34.65941485371343 36.0 36.0 36.0 36.0 36.0 46-47 34.71155288822206 36.0 36.0 36.0 36.0 36.0 48-49 34.651787946986744 36.0 36.0 36.0 34.0 36.0 50-51 34.60152538134534 36.0 36.0 36.0 34.0 36.0 52-53 34.57503751875938 36.0 36.0 36.0 34.0 36.0 54-55 34.49499749874937 36.0 36.0 36.0 32.0 36.0 56-57 34.55527763881941 36.0 36.0 36.0 32.0 36.0 58-59 34.31778389194597 36.0 36.0 36.0 32.0 36.0 60-61 34.32166083041521 36.0 36.0 36.0 32.0 36.0 62-63 34.3715607803902 36.0 36.0 36.0 32.0 36.0 64-65 34.35263947960971 36.0 36.0 36.0 32.0 36.0 66-67 34.185138854140604 36.0 36.0 36.0 32.0 36.0 68-69 34.176271749608006 36.0 36.0 36.0 32.0 36.0 70-71 34.297172172172175 36.0 36.0 36.0 32.0 36.0 72-73 34.268781011891534 36.0 36.0 36.0 32.0 36.0 74-75 34.265125567346054 36.0 36.0 36.0 32.0 36.0 76 33.366976024748645 36.0 36.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 4.0 16 7.0 17 11.0 18 8.0 19 8.0 20 7.0 21 2.0 22 6.0 23 11.0 24 7.0 25 8.0 26 23.0 27 48.0 28 50.0 29 60.0 30 64.0 31 84.0 32 128.0 33 190.0 34 488.0 35 2786.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.74342928660826 20.700876095118897 14.217772215269086 30.337922403003752 2 29.40735183795949 25.6064016004001 31.207801950487625 13.778444611152787 3 22.330582645661416 27.231807951987996 28.032008002000502 22.405601400350086 4 25.4 33.75 21.75 19.1 5 27.525 35.025 20.0 17.45 6 22.35 36.5 21.25 19.900000000000002 7 20.5 18.425 38.675 22.400000000000002 8 23.5 22.025 27.375 27.1 9 25.174999999999997 22.900000000000002 28.1 23.825 10-11 26.5 29.462500000000002 22.5625 21.475 12-13 25.0375 24.762500000000003 26.6125 23.5875 14-15 24.6625 26.637499999999996 27.462500000000002 21.2375 16-17 25.687500000000004 25.374999999999996 26.887499999999996 22.05 18-19 25.087500000000002 26.825 26.3125 21.775 20-21 24.55 27.037499999999998 26.150000000000002 22.2625 22-23 25.2375 27.375 25.5125 21.875 24-25 25.5 26.9125 25.0125 22.575 26-27 25.650000000000002 27.025 26.3 21.025 28-29 25.2875 27.075 25.5625 22.075 30-31 24.175 26.8375 26.9125 22.075 32-33 25.4 26.7125 25.424999999999997 22.4625 34-35 25.324999999999996 26.924999999999997 26.187500000000004 21.5625 36-37 25.0375 27.5125 25.412499999999998 22.037499999999998 38-39 24.290536317039628 27.84098012251531 26.490811351418923 21.377672209026127 40-41 25.343835958989747 26.84421105276319 26.18154538634659 21.630407601900476 42-43 24.968742185546386 26.319079769942487 27.056764191047762 21.655413853463365 44-45 24.406101525381345 26.70667666916729 26.756689172293076 22.13053263315829 46-47 25.55638909727432 27.319329832458116 25.893973493373345 21.230307576894223 48-49 25.29382345586397 26.79419854963741 26.59414853713428 21.31782945736434 50-51 24.781195298824706 26.85671417854464 26.906726681670417 21.45536384096024 52-53 25.162581290645324 27.388694347173587 26.17558779389695 21.273136568284144 54-55 24.262131065532767 27.52626313156578 26.675837918959477 21.53576788394197 56-57 24.72486243121561 27.03851925962982 26.23811905952976 21.99849924962481 58-59 24.68734367183592 26.92596298149075 27.238619309654826 21.14807403701851 60-61 24.987493746873437 27.56378189094547 25.975487743871934 21.473236618309155 62-63 25.062531265632813 27.651325662831418 26.350675337668832 20.935467733866933 64-65 25.268951713785338 27.107830873154864 25.569176882662 22.0540405303978 66-67 24.956217162872154 26.970227670753065 26.64498373780335 21.428571428571427 68-69 24.97185036907294 27.386463155260856 27.11122231952959 20.530464156136617 70-71 24.4994994994995 27.802802802802802 27.077077077077078 20.62062062062062 72-73 25.436064750909775 27.18032375454888 26.43995482494667 20.94365666959468 74-75 24.442068689028464 23.854069223573433 28.94561004944541 22.75825203795269 76 26.875483372003096 0.0 40.564578499613305 32.55993812838361 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 1.5 24 1.0 25 1.0 26 2.0 27 4.5 28 7.0 29 10.5 30 15.5 31 24.0 32 36.5 33 46.5 34 57.5 35 78.0 36 103.0 37 124.0 38 131.5 39 158.0 40 213.0 41 237.5 42 247.0 43 285.5 44 317.0 45 327.0 46 319.0 47 316.5 48 296.0 49 257.0 50 247.5 51 229.0 52 195.5 53 158.5 54 127.5 55 114.5 56 104.0 57 96.5 58 94.5 59 73.5 60 51.0 61 40.0 62 30.5 63 23.0 64 15.5 65 11.0 66 6.5 67 4.5 68 6.0 69 7.5 70 6.0 71 4.0 72 3.0 73 2.5 74 3.0 75 3.5 76 2.0 77 1.5 78 2.0 79 1.5 80 1.5 81 1.0 82 1.0 83 1.5 84 1.5 85 0.5 86 1.0 87 1.0 88 0.0 89 0.0 90 1.0 91 1.0 92 0.0 93 1.0 94 1.0 95 0.5 96 1.0 97 0.5 98 0.0 99 13.0 100 26.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.025 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 38 1.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 1.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 1.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 0.0 70 0.0 71 3.0 72 17.0 73 88.0 74 293.0 75 1009.0 76 2586.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.44029659933521 96.25 2 1.431858859626694 2.8000000000000003 3 0.10227563283047815 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025568908207619537 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 26 0.65 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1688742 spots for SRR9668914.sra Written 1688742 spots for SRR9668914.sra Read 1688742 spots for SRR9668914.sra Written 1688742 spots for SRR9668914.sra Read 1688744 spots for SRR9668914.sra Written 1688744 spots for SRR9668914.sra Read 1688742 spots for SRR9668914.sra Written 1688742 spots for SRR9668914.sra Read 1688742 spots for SRR9668914.sra Written 1688742 spots for SRR9668914.sra Read 1688742 spots for SRR9668914.sra Written 1688742 spots for SRR9668914.sra Read 1688742 spots for SRR9668914.sra Written 1688742 spots for SRR9668914.sra Read 1688742 spots for SRR9668914.sra Written 1688742 spots for SRR9668914.sra Read 1688742 spots for SRR9668914.sra Written 1688742 spots for SRR9668914.sra Read 1688742 spots for SRR9668914.sra Written 1688742 spots for SRR9668914.sra Read 1688742 spots for SRR9668914.sra Written 1688742 spots for SRR9668914.sra Read 1688742 spots for SRR9668914.sra Written 1688742 spots for SRR9668914.sra Read 1688742 spots for SRR9668914.sra Written 1688742 spots for SRR9668914.sra Read 1688742 spots for SRR9668914.sra Written 1688742 spots for SRR9668914.sra Read 1688742 spots for SRR9668914.sra Written 1688742 spots for SRR9668914.sra Read 1688742 spots for SRR9668914.sra Written 1688742 spots for SRR9668914.sra Read 1688742 spots for SRR9668914.sra Written 1688742 spots for SRR9668914.sra Read 1688742 spots for SRR9668914.sra Written 1688742 spots for SRR9668914.sra Read 1688742 spots for SRR9668914.sra Written 1688742 spots for SRR9668914.sra Read 1688742 spots for SRR9668914.sra Written 1688742 spots for SRR9668914.sra SRR ids: ['SRR9668914.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cl3xtao3 SRR9668914.sra spots: 33774842 blocks: [[1, 1688742], [1688743, 3377484], [3377485, 5066226], [5066227, 6754968], [6754969, 8443710], [8443711, 10132452], [10132453, 11821194], [11821195, 13509936], [13509937, 15198678], [15198679, 16887420], [16887421, 18576162], [18576163, 20264904], [20264905, 21953646], [21953647, 23642388], [23642389, 25331130], [25331131, 27019872], [27019873, 28708614], [28708615, 30397356], [30397357, 32086098], [32086099, 33774842]] SRR9668914 file size 6410385 SRR9668914 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668914 SRR9668914_1.fastq SRR9668914_2.fastq Input file: SRR9668914_1.fastq Paired file: SRR9668914_2.fastq trimmed: SRR9668914-trimmed-pair1.fastq, SRR9668914-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:11:00 2025 >> started Wed Feb 12 16:11:46 2025 >> done (46.281s) 33774842 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 29010 ( 0.09%) empty read pairs filtered out after trimming by size control 33745832 (99.91%) read pairs available; of these: 3708 ( 0.01%) trimmed read pairs available after processing 33742124 (99.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 4 0.00% 23 2 0.00% 24 8 0.00% 25 7 0.00% 26 8 0.00% 27 8 0.00% 28 13 0.00% 29 17 0.00% 30 11 0.00% 31 19 0.00% 32 11 0.00% 33 18 0.00% 34 17 0.00% 35 61 0.00% 36 62 0.00% 37 79 0.00% 38 88 0.00% 39 88 0.00% 40 107 0.00% 41 127 0.00% 42 149 0.00% 43 163 0.00% 44 183 0.00% 45 189 0.00% 46 183 0.00% 47 249 0.00% 48 339 0.00% 49 406 0.00% 50 472 0.00% 51 493 0.00% 52 608 0.00% 53 620 0.00% 54 659 0.00% 55 845 0.00% 56 1109 0.00% 57 1198 0.00% 58 1472 0.00% 59 1610 0.00% 60 1870 0.01% 61 1903 0.01% 62 2325 0.01% 63 2677 0.01% 64 2891 0.01% 65 3226 0.01% 66 3739 0.01% 67 4267 0.01% 68 4481 0.01% 69 5344 0.02% 70 7116 0.02% 71 9946 0.03% 72 27872 0.08% 73 290074 0.86% 74 2758118 8.17% 75 16286297 48.26% 76 14321982 42.44% 33745832 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=20 prefix-density=0.64 prefix-fanout=2.1 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.08 sequence-density-rank=26 fanout-score=16.01 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=4.3 sequence=CCATCTTTCGGCTAACCTAGCCTCCTCCGTCCCTCGGGACCAACAAGGGGTAGTACAGGAATATTCGCCTGTTGTCCATCGACTACGCCTTTCGGCCTGATCTTAGGCCCTGACTCACCCTCCGTGGACGAACCTTGCGGAGGAACCCTTAGGTTTTCGGGGCATTGGATTCTCACCAATGTTTGCGTTACTCAAGCCGACATTCTCGCTTCCGCTTCGTCCACCCCCGCTCGCGCGGGTGCTTCCCTCTAAGCGGAACGCTCCCCTACCGATGCATTTTTACATCCCACAGCTTCGGCAGATCGCTTAGCCCCGTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTATTACGCACTCTTTCAAGGGTGGCTGCTTCTAGGCAAACCTCCTGGCTGTCTCTGCACCCCTACCTCCTTTATCACTGAGCGGTCATTTAGGGGCCTTAGCTGGTGATCCGGGCTGTTTCCCTCTCGACGATGAAGCTTATCCCCCACCGTCTCACTGGC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=28 prefix-density=0.53 prefix-fanout=1.9 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=21.34 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=3.3 sequence=CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR9668914 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:12:23 Started mapping on | Feb 12 16:12:23 Finished on | Feb 12 16:14:48 Mapping speed, Million of reads per hour | 837.83 Number of input reads | 33745832 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 29112011 Uniquely mapped reads % | 86.27% Average mapped length | 150.46 Number of splices: Total | 12562837 Number of splices: Annotated (sjdb) | 12427908 Number of splices: GT/AG | 12323450 Number of splices: GC/AG | 206901 Number of splices: AT/AC | 7489 Number of splices: Non-canonical | 24997 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.01% Insertion average length | 1.98 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1392998 % of reads mapped to multiple loci | 4.13% Number of reads mapped to too many loci | 2005336 % of reads mapped to too many loci | 5.94% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.46% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3240823 3240823 3240823 N_multimapping 1392998 1392998 1392998 N_noFeature 1107324 28730702 1214781 N_ambiguous 446392 1832 171040 UnstrandedReadsAssigned:27558295 PositiveStrandReadsAssigned:379477 NegativeStrandReadsAssigned:27726190 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668914 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668914-trimmed-pair1.fastq SRR9668914-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,745,832 reads, 29,810,481 reads pseudoaligned [quant] estimated average fragment length: 180.683 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52401 SRR9668914.ke.tsv 34699 SRR9668914.se.tsv 87100 total ==> SRR9668914.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1838.32 384 5.99136 Potri.005G024800.1.v4.1 1035 855.317 173 5.80141 Potri.004G059700.1.v4.1 961 781.317 46 1.68867 Potri.007G009000.2.v4.1 1416 1236.32 0 0 Potri.003G141000.2.v4.1 2943 2763.32 382.107 3.96615 Potri.016G087400.1.v4.1 270 102.497 1883.22 526.993 Potri.015G069301.1.v4.1 564 384.466 0 0 Potri.010G195200.1.v4.1 1773 1593.32 1 0.0180017 Potri.012G127500.1.v4.1 977 797.317 6415 230.771 ==> SRR9668914.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 26 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 389 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 79 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 10 SRR9668914 completed mapping pipeline successfully