Starting /dee2/code/volunteer_pipeline.sh SRR9668915 current disk space = 3051976044544 free memory = 1581736568 SRR9668915 SRAfilesize 380797b436d7337f963623b6ec389430 SRR9668915.sra SRR9668915.sra file validated SRR9668915 is paired end SRR9668915 is conventional basespace SRR9668915 read1 length is 47-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668915_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 47-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.76375 32.0 32.0 32.0 32.0 32.0 2 31.72375 32.0 32.0 32.0 32.0 32.0 3 31.7325 32.0 32.0 32.0 32.0 32.0 4 31.76525 32.0 32.0 32.0 32.0 32.0 5 31.78825 32.0 32.0 32.0 32.0 32.0 6 35.43475 36.0 36.0 36.0 36.0 36.0 7 35.473 36.0 36.0 36.0 36.0 36.0 8 35.441 36.0 36.0 36.0 36.0 36.0 9 35.47575 36.0 36.0 36.0 36.0 36.0 10-11 35.393375000000006 36.0 36.0 36.0 36.0 36.0 12-13 35.457625 36.0 36.0 36.0 36.0 36.0 14-15 35.47425 36.0 36.0 36.0 36.0 36.0 16-17 35.347 36.0 36.0 36.0 36.0 36.0 18-19 35.469875 36.0 36.0 36.0 36.0 36.0 20-21 35.456125 36.0 36.0 36.0 36.0 36.0 22-23 35.359624999999994 36.0 36.0 36.0 36.0 36.0 24-25 35.353875 36.0 36.0 36.0 36.0 36.0 26-27 35.392250000000004 36.0 36.0 36.0 36.0 36.0 28-29 35.313625 36.0 36.0 36.0 36.0 36.0 30-31 35.317125 36.0 36.0 36.0 36.0 36.0 32-33 35.292125 36.0 36.0 36.0 36.0 36.0 34-35 35.227625 36.0 36.0 36.0 36.0 36.0 36-37 35.270125 36.0 36.0 36.0 36.0 36.0 38-39 35.32275 36.0 36.0 36.0 36.0 36.0 40-41 35.3125 36.0 36.0 36.0 36.0 36.0 42-43 35.305375 36.0 36.0 36.0 36.0 36.0 44-45 35.23075 36.0 36.0 36.0 36.0 36.0 46-47 35.200625 36.0 36.0 36.0 36.0 36.0 48-49 35.15691422855714 36.0 36.0 36.0 36.0 36.0 50-51 35.1626656664166 36.0 36.0 36.0 36.0 36.0 52-53 35.0762739459252 36.0 36.0 36.0 36.0 36.0 54-55 34.98661830915458 36.0 36.0 36.0 34.0 36.0 56-57 35.06690845422712 36.0 36.0 36.0 36.0 36.0 58-59 34.96273136568284 36.0 36.0 36.0 32.0 36.0 60-61 34.991995997999 36.0 36.0 36.0 32.0 36.0 62-63 34.931715857928964 36.0 36.0 36.0 34.0 36.0 64-65 34.929572179134354 36.0 36.0 36.0 34.0 36.0 66-67 34.86257822277847 36.0 36.0 36.0 32.0 36.0 68-69 34.75202907615491 36.0 36.0 36.0 32.0 36.0 70-71 34.71682523785678 36.0 36.0 36.0 32.0 36.0 72-73 34.6647684024877 36.0 36.0 36.0 32.0 36.0 74-75 34.68498986075052 36.0 36.0 36.0 32.0 36.0 76 33.93276055285768 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 2.0 24 0.0 25 8.0 26 11.0 27 29.0 28 19.0 29 45.0 30 62.0 31 79.0 32 93.0 33 151.0 34 418.0 35 3082.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.175 13.8 10.4 42.625 2 21.925 17.5 38.35 22.225 3 19.35 22.175 24.65 33.825 4 22.95 30.2 21.75 25.1 5 22.2 34.675 23.150000000000002 19.975 6 19.400000000000002 34.699999999999996 26.150000000000002 19.75 7 15.2 23.674999999999997 42.85 18.275 8 17.95 22.375 32.675 27.0 9 18.825 21.85 32.95 26.375 10-11 21.712500000000002 31.674999999999997 23.225 23.3875 12-13 21.125 24.4125 28.749999999999996 25.7125 14-15 20.8 26.224999999999998 28.212500000000002 24.762500000000003 16-17 21.978984238178633 27.207905929447087 26.65749311983988 24.1556167125344 18-19 20.4125 27.700000000000003 26.8 25.087500000000002 20-21 20.8875 27.35 27.525 24.2375 22-23 21.4375 26.9125 27.224999999999998 24.425 24-25 21.25 27.462500000000002 26.7125 24.575 26-27 21.7875 27.375 25.887500000000003 24.95 28-29 21.1875 27.474999999999998 26.05 25.2875 30-31 19.714786089567177 28.008506379784837 27.057793345008758 25.21891418563923 32-33 21.425 27.987499999999997 26.875 23.7125 34-35 20.8625 28.262500000000003 26.900000000000002 23.974999999999998 36-37 20.5 27.437499999999996 25.912499999999998 26.150000000000002 38-39 20.3125 27.474999999999998 26.8375 25.374999999999996 40-41 20.1375 28.037499999999998 26.375 25.45 42-43 21.2875 26.625 27.650000000000002 24.4375 44-45 20.875 26.8125 27.8875 24.425 46-47 21.875 27.425 27.400000000000002 23.3 48-49 21.530382595648913 26.244061015253813 26.569142285571395 25.656414103525883 50-51 20.930232558139537 27.206801700425103 27.306826706676667 24.55613903475869 52-53 20.932849818682005 28.03551331749406 26.634988120545206 24.39664874327873 54-55 21.435717858929465 27.41370685342671 26.43821910955478 24.712356178089045 56-57 20.54777388694347 27.37618809404702 26.25062531265633 25.82541270635318 58-59 21.860930465232617 27.62631315657829 25.86293146573287 24.64982491245623 60-61 21.735867933966986 27.288644322161083 25.7503751875938 25.22511255627814 62-63 21.48574287143572 27.026013006503252 27.201100550275136 24.287143571785894 64-65 21.61621215911934 27.1703777833375 26.882661996497376 24.330748061045785 66-67 20.037546933667084 27.50938673341677 26.595744680851062 25.857321652065078 68-69 20.991363124295905 27.450244085617726 27.149831017649266 24.4085617724371 70-71 21.219328993490237 27.45368052078117 26.777666499749625 24.54932398597897 72-73 21.346902877245885 27.377811282824478 26.548561377057418 24.72672446287222 74-75 20.711241342567927 24.080980287693126 28.516249334043685 26.69152903569526 76 22.786701531565186 0.0 41.38961524094135 35.82368322749346 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 1.0 21 1.0 22 3.0 23 4.5 24 2.5 25 2.0 26 6.0 27 16.0 28 20.0 29 18.5 30 26.5 31 36.5 32 42.0 33 45.0 34 60.5 35 79.5 36 95.5 37 119.5 38 135.5 39 169.0 40 207.5 41 228.0 42 235.0 43 282.5 44 326.5 45 303.5 46 288.5 47 284.0 48 269.5 49 248.5 50 235.0 51 225.0 52 204.5 53 177.5 54 157.0 55 132.0 56 115.5 57 109.5 58 97.5 59 76.0 60 49.0 61 31.5 62 22.0 63 20.0 64 15.5 65 9.5 66 7.5 67 8.0 68 6.0 69 3.0 70 2.0 71 1.5 72 1.5 73 3.0 74 3.5 75 1.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.075 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.075 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 47 1.0 48 0.0 49 0.0 50 0.0 51 0.0 52 1.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 1.0 64 0.0 65 2.0 66 0.0 67 0.0 68 1.0 69 0.0 70 0.0 71 4.0 72 21.0 73 79.0 74 272.0 75 941.0 76 2677.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.55 #Duplication Level Percentage of deduplicated Percentage of total 1 97.17762817193164 93.825 2 2.330398757120663 4.5 3 0.33661315380631796 0.975 4 0.07767995857068877 0.3 5 0.05178663904712584 0.25 6 0.02589331952356292 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTA 6 0.15 No Hit GTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGG 5 0.125 No Hit GTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCAGAACCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668915 read2 length is 47-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668915_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 47-76 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5395 32.0 32.0 32.0 32.0 32.0 2 31.414 32.0 32.0 32.0 32.0 32.0 3 31.42825 32.0 32.0 32.0 32.0 32.0 4 31.3635 32.0 32.0 32.0 32.0 32.0 5 31.41425 32.0 32.0 32.0 32.0 32.0 6 35.095 36.0 36.0 36.0 36.0 36.0 7 35.119 36.0 36.0 36.0 36.0 36.0 8 35.06775 36.0 36.0 36.0 36.0 36.0 9 35.13625 36.0 36.0 36.0 36.0 36.0 10-11 35.101124999999996 36.0 36.0 36.0 36.0 36.0 12-13 35.00975 36.0 36.0 36.0 36.0 36.0 14-15 35.107875 36.0 36.0 36.0 36.0 36.0 16-17 34.980000000000004 36.0 36.0 36.0 36.0 36.0 18-19 35.05325 36.0 36.0 36.0 36.0 36.0 20-21 34.892875000000004 36.0 36.0 36.0 36.0 36.0 22-23 34.930499999999995 36.0 36.0 36.0 36.0 36.0 24-25 34.952125 36.0 36.0 36.0 36.0 36.0 26-27 34.96825 36.0 36.0 36.0 36.0 36.0 28-29 34.8855 36.0 36.0 36.0 36.0 36.0 30-31 34.84575 36.0 36.0 36.0 36.0 36.0 32-33 34.84625 36.0 36.0 36.0 36.0 36.0 34-35 34.770875000000004 36.0 36.0 36.0 36.0 36.0 36-37 34.716875 36.0 36.0 36.0 36.0 36.0 38-39 34.808625 36.0 36.0 36.0 36.0 36.0 40-41 34.805 36.0 36.0 36.0 36.0 36.0 42-43 34.708 36.0 36.0 36.0 36.0 36.0 44-45 34.708 36.0 36.0 36.0 36.0 36.0 46-47 34.719375 36.0 36.0 36.0 36.0 36.0 48-49 34.592523130782695 36.0 36.0 36.0 34.0 36.0 50-51 34.53225806451613 36.0 36.0 36.0 32.0 36.0 52-53 34.61522449772023 36.0 36.0 36.0 36.0 36.0 54-55 34.53401700850425 36.0 36.0 36.0 32.0 36.0 56-57 34.60167583791896 36.0 36.0 36.0 34.0 36.0 58-59 34.48174087043522 36.0 36.0 36.0 32.0 36.0 60-61 34.50637818909455 36.0 36.0 36.0 32.0 36.0 62-63 34.40832916458229 36.0 36.0 36.0 32.0 36.0 64-65 34.43820365273955 36.0 36.0 36.0 32.0 36.0 66-67 34.35682102628286 36.0 36.0 36.0 32.0 36.0 68-69 34.3796054086138 36.0 36.0 36.0 32.0 36.0 70-71 34.303781617831206 36.0 36.0 36.0 32.0 36.0 72-73 34.34106221852202 36.0 36.0 36.0 32.0 36.0 74-75 34.32432871037358 36.0 36.0 36.0 32.0 36.0 76 33.52861035422343 36.0 36.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 8.0 16 2.0 17 5.0 18 2.0 19 12.0 20 3.0 21 4.0 22 7.0 23 14.0 24 13.0 25 28.0 26 18.0 27 28.0 28 42.0 29 47.0 30 69.0 31 83.0 32 111.0 33 189.0 34 487.0 35 2825.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.08408408408408 20.37037037037037 13.838838838838837 31.706706706706704 2 30.107526881720432 25.63140785196299 31.43285821455364 12.828207051762941 3 23.799999999999997 25.324999999999996 27.575 23.3 4 24.55 34.675 21.025 19.75 5 27.224999999999998 35.949999999999996 20.549999999999997 16.275000000000002 6 23.625 36.55 19.85 19.975 7 20.200000000000003 18.625 39.050000000000004 22.125 8 24.6 23.0 26.3 26.1 9 25.174999999999997 23.075000000000003 27.6 24.15 10-11 26.437500000000004 30.3 22.4375 20.825 12-13 25.2 24.762500000000003 26.474999999999998 23.5625 14-15 25.0375 26.187500000000004 26.900000000000002 21.875 16-17 25.2125 26.650000000000002 26.375 21.762500000000003 18-19 25.0375 27.437499999999996 25.6125 21.912499999999998 20-21 25.0375 27.525 25.575 21.8625 22-23 24.5375 27.175 26.8 21.4875 24-25 25.25 27.187499999999996 25.825 21.7375 26-27 25.174999999999997 27.1 26.137500000000003 21.587500000000002 28-29 24.474999999999998 27.6 25.912499999999998 22.0125 30-31 24.3 26.55 26.2625 22.8875 32-33 24.637500000000003 27.6 25.8 21.9625 34-35 25.387500000000003 27.037499999999998 25.8625 21.712500000000002 36-37 24.5375 27.700000000000003 25.687500000000004 22.075 38-39 24.7375 27.3125 26.3 21.65 40-41 25.362499999999997 27.3125 25.924999999999997 21.4 42-43 25.387500000000003 26.5 26.487500000000004 21.625 44-45 24.15 27.6125 25.9875 22.25 46-47 25.4625 26.6125 25.624999999999996 22.3 48-49 24.60615153788447 26.994248562140534 26.556639159789945 21.842960740185045 50-51 25.71892973243311 27.106776694173547 25.406351587896975 21.767941985496375 52-53 25.347005126922596 27.397774165311993 26.47242716018507 20.78279354758034 54-55 25.200100050025014 27.738869434717362 24.7623811905953 22.298649324662332 56-57 25.062531265632813 26.538269134567283 27.051025512756375 21.34817408704352 58-59 24.73736868434217 26.91345672836418 26.100550275137568 22.24862431215608 60-61 24.312156078039017 26.575787893946973 27.113556778389196 21.99849924962481 62-63 25.63781890945473 26.18809404702351 26.025512756378188 22.14857428714357 64-65 25.69427070302727 26.45734300725544 26.08206154615962 21.766324743557668 66-67 25.481852315394242 26.33291614518148 26.307884856070086 21.877346683354194 68-69 24.652560410667334 27.51971954425942 26.017278076874923 21.810441968198322 70-71 24.267468069120962 27.811169546706736 26.10818933132983 21.813173052842476 72-73 25.06290890790136 27.17664821338702 25.70457976849522 22.055863110216407 74-75 25.544713273626517 23.793610479882368 27.202245689079003 23.459430557412112 76 25.262748151031527 0.0 40.36590112884391 34.37135072012456 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 2.0 20 2.5 21 1.5 22 0.5 23 0.5 24 0.5 25 1.0 26 3.5 27 6.5 28 9.5 29 12.0 30 15.5 31 22.5 32 37.0 33 48.0 34 49.0 35 70.5 36 92.5 37 101.5 38 134.5 39 174.0 40 198.5 41 219.5 42 234.0 43 271.0 44 303.0 45 295.5 46 299.5 47 319.0 48 305.5 49 262.0 50 233.0 51 218.0 52 189.0 53 146.0 54 136.5 55 137.5 56 122.5 57 103.5 58 89.0 59 82.5 60 63.5 61 50.0 62 44.5 63 28.0 64 14.5 65 10.0 66 7.5 67 8.0 68 9.0 69 7.5 70 5.0 71 4.0 72 3.5 73 4.0 74 3.5 75 2.0 76 1.0 77 1.0 78 1.5 79 2.0 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 1.5 89 1.5 90 1.5 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 1.5 99 12.5 100 23.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 47 1.0 48 0.0 49 0.0 50 0.0 51 0.0 52 1.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 1.0 64 0.0 65 2.0 66 0.0 67 1.0 68 1.0 69 0.0 70 0.0 71 7.0 72 24.0 73 84.0 74 275.0 75 1034.0 76 2569.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.65 #Duplication Level Percentage of deduplicated Percentage of total 1 97.77547853078117 94.5 2 1.8106570098292811 3.5000000000000004 3 0.28453181583031556 0.8250000000000001 4 0.05173305742369374 0.2 5 0.02586652871184687 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02586652871184687 0.22499999999999998 >10 0.02586652871184687 0.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 25 0.625 No Hit GTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTCG 9 0.22499999999999998 No Hit GCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1447009 spots for SRR9668915.sra Written 1447009 spots for SRR9668915.sra Read 1447009 spots for SRR9668915.sra Written 1447009 spots for SRR9668915.sra Read 1447009 spots for SRR9668915.sra Written 1447009 spots for SRR9668915.sra Read 1447009 spots for SRR9668915.sra Written 1447009 spots for SRR9668915.sra Read 1447009 spots for SRR9668915.sra Written 1447009 spots for SRR9668915.sra Read 1447009 spots for SRR9668915.sra Written 1447009 spots for SRR9668915.sra Read 1447009 spots for SRR9668915.sra Written 1447009 spots for SRR9668915.sra Read 1447009 spots for SRR9668915.sra Written 1447009 spots for SRR9668915.sra Read 1447009 spots for SRR9668915.sra Written 1447009 spots for SRR9668915.sra Read 1447024 spots for SRR9668915.sra Written 1447024 spots for SRR9668915.sra Read 1447009 spots for SRR9668915.sra Written 1447009 spots for SRR9668915.sra Read 1447009 spots for SRR9668915.sra Written 1447009 spots for SRR9668915.sra Read 1447009 spots for SRR9668915.sra Written 1447009 spots for SRR9668915.sra Read 1447009 spots for SRR9668915.sra Written 1447009 spots for SRR9668915.sra Read 1447009 spots for SRR9668915.sra Written 1447009 spots for SRR9668915.sra Read 1447009 spots for SRR9668915.sra Written 1447009 spots for SRR9668915.sra Read 1447009 spots for SRR9668915.sra Written 1447009 spots for SRR9668915.sra Read 1447009 spots for SRR9668915.sra Written 1447009 spots for SRR9668915.sra Read 1447009 spots for SRR9668915.sra Written 1447009 spots for SRR9668915.sra Read 1447009 spots for SRR9668915.sra Written 1447009 spots for SRR9668915.sra SRR ids: ['SRR9668915.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i3x46aaq SRR9668915.sra spots: 28940195 blocks: [[1, 1447009], [1447010, 2894018], [2894019, 4341027], [4341028, 5788036], [5788037, 7235045], [7235046, 8682054], [8682055, 10129063], [10129064, 11576072], [11576073, 13023081], [13023082, 14470090], [14470091, 15917099], [15917100, 17364108], [17364109, 18811117], [18811118, 20258126], [20258127, 21705135], [21705136, 23152144], [23152145, 24599153], [24599154, 26046162], [26046163, 27493171], [27493172, 28940195]] SRR9668915 file size 5489949 SRR9668915 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668915 SRR9668915_1.fastq SRR9668915_2.fastq Input file: SRR9668915_1.fastq Paired file: SRR9668915_2.fastq trimmed: SRR9668915-trimmed-pair1.fastq, SRR9668915-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:55:52 2025 >> started Wed Feb 12 16:56:17 2025 >> done (24.936s) 28940195 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 11858 ( 0.04%) empty read pairs filtered out after trimming by size control 28928336 (99.96%) read pairs available; of these: 3482 ( 0.01%) trimmed read pairs available after processing 28924854 (99.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 0 0.00% 22 3 0.00% 23 6 0.00% 24 4 0.00% 25 5 0.00% 26 5 0.00% 27 8 0.00% 28 3 0.00% 29 10 0.00% 30 8 0.00% 31 17 0.00% 32 8 0.00% 33 11 0.00% 34 23 0.00% 35 37 0.00% 36 67 0.00% 37 89 0.00% 38 94 0.00% 39 107 0.00% 40 116 0.00% 41 129 0.00% 42 133 0.00% 43 162 0.00% 44 211 0.00% 45 214 0.00% 46 212 0.00% 47 308 0.00% 48 292 0.00% 49 413 0.00% 50 560 0.00% 51 612 0.00% 52 619 0.00% 53 651 0.00% 54 675 0.00% 55 858 0.00% 56 1051 0.00% 57 1201 0.00% 58 1326 0.00% 59 1583 0.01% 60 1778 0.01% 61 1913 0.01% 62 2167 0.01% 63 2360 0.01% 64 2810 0.01% 65 2990 0.01% 66 3287 0.01% 67 3731 0.01% 68 3908 0.01% 69 4552 0.02% 70 5681 0.02% 71 8238 0.03% 72 22678 0.08% 73 242193 0.84% 74 2326958 8.04% 75 13866820 47.94% 76 12414438 42.91% 28928336 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=33 prefix-density=0.60 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=17.61 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=1.4 sequence=ATGCACCACCTGTGTCCGCGTTCCCGAAGGCACCCCTCTCTTTCAAGAGGATTCGCGGCATGTCAAGCCCTGGTAAGGTTCTTCGCTTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=22 prefix-density=0.49 prefix-fanout=1.9 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=18.08 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=2.9 sequence=CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR9668915 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:56:43 Started mapping on | Feb 12 16:56:43 Finished on | Feb 12 16:58:34 Mapping speed, Million of reads per hour | 938.22 Number of input reads | 28928336 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 23529343 Uniquely mapped reads % | 81.34% Average mapped length | 150.43 Number of splices: Total | 10085534 Number of splices: Annotated (sjdb) | 9978432 Number of splices: GT/AG | 9893254 Number of splices: GC/AG | 165487 Number of splices: AT/AC | 6560 Number of splices: Non-canonical | 20233 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1232503 % of reads mapped to multiple loci | 4.26% Number of reads mapped to too many loci | 3032894 % of reads mapped to too many loci | 10.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.59% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4166490 4166490 4166490 N_multimapping 1232503 1232503 1232503 N_noFeature 1109884 23199491 1199093 N_ambiguous 380796 1530 138902 UnstrandedReadsAssigned:22038663 PositiveStrandReadsAssigned:328322 NegativeStrandReadsAssigned:22191348 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668915 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668915-trimmed-pair1.fastq SRR9668915-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,928,336 reads, 24,903,000 reads pseudoaligned [quant] estimated average fragment length: 190.622 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 980 rounds 52401 SRR9668915.ke.tsv 34699 SRR9668915.se.tsv 87100 total ==> SRR9668915.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1828.38 318 5.75169 Potri.005G024800.1.v4.1 1035 845.378 143 5.59397 Potri.004G059700.1.v4.1 961 771.393 38 1.62908 Potri.007G009000.2.v4.1 1416 1226.38 0 0 Potri.003G141000.2.v4.1 2943 2753.38 313 3.75935 Potri.016G087400.1.v4.1 270 95.4294 1397.28 484.213 Potri.015G069301.1.v4.1 564 374.567 0 0 Potri.010G195200.1.v4.1 1773 1583.38 7 0.1462 Potri.012G127500.1.v4.1 977 787.388 4609 193.577 ==> SRR9668915.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 22 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 320 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 63 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 9 SRR9668915 completed mapping pipeline successfully