Starting /dee2/code/volunteer_pipeline.sh SRR9668916 current disk space = 3051964444672 free memory = 1446196144 SRR9668916 SRAfilesize 9c0363dda1192e0716494c330e643fb0 SRR9668916.sra SRR9668916.sra file validated SRR9668916 is paired end SRR9668916 is conventional basespace SRR9668916 read1 length is 62-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668916_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 62-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.49125 32.0 32.0 32.0 32.0 32.0 2 31.3855 32.0 32.0 32.0 32.0 32.0 3 31.56125 32.0 32.0 32.0 32.0 32.0 4 31.6135 32.0 32.0 32.0 32.0 32.0 5 31.623 32.0 32.0 32.0 32.0 32.0 6 34.69275 36.0 36.0 36.0 36.0 36.0 7 35.25675 36.0 36.0 36.0 36.0 36.0 8 35.17375 36.0 36.0 36.0 36.0 36.0 9 35.1155 36.0 36.0 36.0 36.0 36.0 10-11 35.134375000000006 36.0 36.0 36.0 36.0 36.0 12-13 35.156125 36.0 36.0 36.0 36.0 36.0 14-15 35.103 36.0 36.0 36.0 36.0 36.0 16-17 35.1145 36.0 36.0 36.0 36.0 36.0 18-19 35.176375 36.0 36.0 36.0 36.0 36.0 20-21 35.088750000000005 36.0 36.0 36.0 36.0 36.0 22-23 35.085125 36.0 36.0 36.0 36.0 36.0 24-25 35.088750000000005 36.0 36.0 36.0 36.0 36.0 26-27 34.923375 36.0 36.0 36.0 36.0 36.0 28-29 35.124875 36.0 36.0 36.0 36.0 36.0 30-31 34.98925 36.0 36.0 36.0 36.0 36.0 32-33 34.842625 36.0 36.0 36.0 34.0 36.0 34-35 34.934875000000005 36.0 36.0 36.0 36.0 36.0 36-37 34.846625 36.0 36.0 36.0 36.0 36.0 38-39 34.919125 36.0 36.0 36.0 36.0 36.0 40-41 34.8765 36.0 36.0 36.0 36.0 36.0 42-43 34.795874999999995 36.0 36.0 36.0 36.0 36.0 44-45 34.754125 36.0 36.0 36.0 34.0 36.0 46-47 34.878875 36.0 36.0 36.0 36.0 36.0 48-49 34.734125000000006 36.0 36.0 36.0 34.0 36.0 50-51 34.783249999999995 36.0 36.0 36.0 36.0 36.0 52-53 34.643125 36.0 36.0 36.0 32.0 36.0 54-55 34.682375 36.0 36.0 36.0 32.0 36.0 56-57 34.69125 36.0 36.0 36.0 32.0 36.0 58-59 34.650625000000005 36.0 36.0 36.0 32.0 36.0 60-61 34.524249999999995 36.0 36.0 36.0 32.0 36.0 62-63 34.45569217304326 36.0 36.0 36.0 32.0 36.0 64-65 34.41410352588147 36.0 36.0 36.0 32.0 36.0 66-67 34.3988497124281 36.0 36.0 36.0 32.0 36.0 68-69 34.31307826956739 36.0 36.0 36.0 32.0 36.0 70-71 34.37434358589647 36.0 36.0 36.0 32.0 36.0 72-73 34.406982487812684 36.0 36.0 36.0 32.0 36.0 74-75 34.26010430695533 36.0 36.0 36.0 32.0 36.0 76 33.32103461392164 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 4.0 24 4.0 25 14.0 26 14.0 27 35.0 28 48.0 29 83.0 30 80.0 31 112.0 32 151.0 33 254.0 34 519.0 35 2680.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.2 13.575000000000001 11.575000000000001 43.65 2 20.674999999999997 16.5 38.824999999999996 24.0 3 19.6 21.525 24.0 34.875 4 22.275 31.0 21.9 24.825 5 21.075 35.325 24.15 19.45 6 18.40506329113924 35.34177215189873 24.9873417721519 21.265822784810126 7 14.299999999999999 24.425 43.875 17.4 8 17.150000000000002 23.225 32.6 27.025 9 17.45 23.400000000000002 34.55 24.6 10-11 21.087500000000002 31.937500000000004 23.7125 23.2625 12-13 20.962500000000002 25.275 28.3625 25.4 14-15 20.275000000000002 26.474999999999998 28.1625 25.087500000000002 16-17 20.0125 27.5625 27.500000000000004 24.925 18-19 20.599999999999998 27.875 27.650000000000002 23.875 20-21 20.7625 28.449999999999996 27.3875 23.400000000000002 22-23 21.712500000000002 27.1125 26.7625 24.4125 24-25 20.4625 26.6625 28.6125 24.2625 26-27 20.0375 28.1375 27.250000000000004 24.575 28-29 20.65 27.200000000000003 27.800000000000004 24.349999999999998 30-31 20.8125 28.262500000000003 26.8 24.125 32-33 20.625 26.987499999999997 27.500000000000004 24.887500000000003 34-35 20.5875 27.625 27.625 24.1625 36-37 20.4125 28.287499999999998 27.400000000000002 23.9 38-39 21.1625 27.650000000000002 27.075 24.1125 40-41 20.5875 28.3375 27.0875 23.9875 42-43 21.85 27.237499999999997 26.75 24.1625 44-45 20.849999999999998 27.224999999999998 28.125 23.799999999999997 46-47 20.125 26.674999999999997 28.175 25.025 48-49 21.125 27.962500000000002 26.875 24.0375 50-51 21.099999999999998 27.625 27.3 23.974999999999998 52-53 21.712500000000002 27.650000000000002 25.874999999999996 24.762500000000003 54-55 20.65 27.775 27.437499999999996 24.1375 56-57 20.05 27.750000000000004 27.737499999999997 24.462500000000002 58-59 21.3125 27.5125 27.437499999999996 23.7375 60-61 20.849999999999998 27.6 28.0625 23.4875 62-63 20.902612826603324 27.740967620952617 26.96587073384173 24.390548818602326 64-65 20.78019504876219 27.84446111527882 27.094273568392097 24.281070267566893 66-67 20.905226306576644 27.831957989497376 27.35683920980245 23.905976494123532 68-69 21.21780445111278 27.406851712928233 27.53188297074269 23.843460865216304 70-71 20.792698174543638 28.532133033258315 26.906726681670417 23.768442110527634 72-73 21.151674821226948 27.6753230460419 27.336595157445743 23.83640697528541 74-75 21.15691489361702 25.385638297872344 28.24468085106383 25.21276595744681 76 21.414986686953213 0.0 40.928109547356414 37.65690376569037 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 1.5 22 3.5 23 5.0 24 5.0 25 5.0 26 11.0 27 17.5 28 18.0 29 18.0 30 23.0 31 32.0 32 42.5 33 52.0 34 67.0 35 94.0 36 121.5 37 135.5 38 162.0 39 206.0 40 235.5 41 254.0 42 272.5 43 291.5 44 309.0 45 314.0 46 310.0 47 299.0 48 287.0 49 266.5 50 243.0 51 216.0 52 192.5 53 162.5 54 135.5 55 122.0 56 96.5 57 74.5 58 59.0 59 46.0 60 34.0 61 23.0 62 15.0 63 12.0 64 8.5 65 7.0 66 6.0 67 5.5 68 3.0 69 0.5 70 0.0 71 0.0 72 0.5 73 1.0 74 1.5 75 2.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.25 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 62 1.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 5.0 72 17.0 73 86.0 74 262.0 75 1000.0 76 2629.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06612821807168 98.125 2 0.9086320040383644 1.7999999999999998 3 0.025239777889954566 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668916 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668916_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.137 32.0 32.0 32.0 32.0 32.0 2 30.98975 32.0 32.0 32.0 32.0 32.0 3 31.01025 32.0 32.0 32.0 32.0 32.0 4 31.03125 32.0 32.0 32.0 32.0 32.0 5 30.89675 32.0 32.0 32.0 32.0 32.0 6 34.4005 36.0 36.0 36.0 32.0 36.0 7 34.58625 36.0 36.0 36.0 32.0 36.0 8 34.513 36.0 36.0 36.0 32.0 36.0 9 34.489 36.0 36.0 36.0 32.0 36.0 10-11 34.403999999999996 36.0 36.0 36.0 32.0 36.0 12-13 34.464 36.0 36.0 36.0 32.0 36.0 14-15 34.4125 36.0 36.0 36.0 32.0 36.0 16-17 34.412375 36.0 36.0 36.0 32.0 36.0 18-19 34.380250000000004 36.0 36.0 36.0 32.0 36.0 20-21 34.2625 36.0 36.0 36.0 32.0 36.0 22-23 34.338625 36.0 36.0 36.0 32.0 36.0 24-25 34.316 36.0 36.0 36.0 32.0 36.0 26-27 34.291624999999996 36.0 36.0 36.0 32.0 36.0 28-29 34.22175 36.0 36.0 36.0 32.0 36.0 30-31 34.220625 36.0 36.0 36.0 32.0 36.0 32-33 34.181375 36.0 36.0 36.0 32.0 36.0 34-35 34.19625 36.0 36.0 36.0 32.0 36.0 36-37 34.234151841643694 36.0 36.0 36.0 32.0 36.0 38-39 34.08907541969431 36.0 36.0 36.0 32.0 36.0 40-41 34.036832873966425 36.0 36.0 36.0 32.0 36.0 42-43 33.96780255575044 36.0 36.0 36.0 32.0 36.0 44-45 33.82147331495866 36.0 36.0 36.0 29.5 36.0 46-47 33.97531946880481 36.0 36.0 36.0 32.0 36.0 48-49 34.11390977443609 36.0 36.0 36.0 32.0 36.0 50-51 33.98809523809524 36.0 36.0 36.0 32.0 36.0 52-53 33.805513784461155 36.0 36.0 36.0 32.0 36.0 54-55 33.79273182957394 36.0 36.0 36.0 29.5 36.0 56-57 33.848245614035086 36.0 36.0 36.0 32.0 36.0 58-59 33.82368421052632 36.0 36.0 36.0 32.0 36.0 60-61 33.65025062656642 36.0 36.0 36.0 27.0 36.0 62-63 33.7007255227565 36.0 36.0 36.0 27.0 36.0 64-65 33.6768613687641 36.0 36.0 36.0 27.0 36.0 66-67 33.55502632238657 36.0 36.0 36.0 27.0 36.0 68-69 33.638595593750416 36.0 36.0 36.0 27.0 36.0 70-71 33.69928368899976 36.0 36.0 36.0 27.0 36.0 72-73 33.68547903736157 36.0 36.0 36.0 27.0 36.0 74-75 33.674470581974106 36.0 36.0 36.0 27.0 36.0 76 32.63768115942029 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 3.0 15 6.0 16 10.0 17 5.0 18 4.0 19 8.0 20 11.0 21 9.0 22 19.0 23 15.0 24 26.0 25 28.0 26 41.0 27 56.0 28 60.0 29 78.0 30 121.0 31 141.0 32 202.0 33 288.0 34 567.0 35 2293.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.951770911831197 19.366993217784476 15.322783220296406 33.35845265008792 2 27.90872617853561 25.175526579739216 33.776328986960884 13.139418254764292 3 22.876472062139815 27.56201453269857 28.514156852919072 21.047356552242547 4 25.60120240480962 33.366733466933866 21.19238476953908 19.839679358717436 5 25.701402805611224 35.64629258517034 21.51803607214429 17.13426853707415 6 21.54308617234469 36.09719438877755 23.79759519038076 18.562124248496996 7 20.59118236472946 18.7625250501002 40.756513026052104 19.88977955911824 8 23.471943887775552 22.970941883767534 27.930861723446892 25.626252505010022 9 23.49699398797595 25.0751503006012 28.2064128256513 23.22144288577154 10-11 25.112725450901802 32.15180360721443 21.51803607214429 21.217434869739478 12-13 24.912324649298597 24.599198396793586 27.367234468937873 23.12124248496994 14-15 24.636773547094187 27.204408817635272 27.004008016032067 21.154809619238478 16-17 23.941368078175895 28.263593084439993 26.27161112503132 21.523427712352795 18-19 24.73697394789579 27.805611222444888 26.77855711422846 20.678857715430862 20-21 23.788049605411498 28.57321808843793 27.007390705248653 20.631341600901916 22-23 24.99373590578802 26.94813329992483 27.08594337258832 20.972187421698823 24-25 23.725416510083928 26.869597895527995 27.082550419641738 22.322435174746335 26-27 23.672344689378757 27.329659318637272 27.55511022044088 21.442885771543086 28-29 24.492608368829867 27.3365071410674 27.3365071410674 20.83437734903533 30-31 24.066649962415436 27.461789025306942 27.424204460035078 21.047356552242547 32-33 24.17940365823102 27.800050112753695 26.33425206715109 21.686294161864193 34-35 24.818341267852666 27.825106489601602 26.384364820846905 20.972187421698823 36-37 24.630047654878354 26.824680210684726 27.175821419613744 21.369450714823177 38-39 24.667169053001757 27.0032655111781 26.601356443104745 21.7282089927154 40-41 25.84213172448467 26.370035193564608 26.558572146807442 21.229260935143287 42-43 24.163522012578618 27.622641509433965 26.754716981132077 21.459119496855347 44-45 24.68840488480423 27.395190733979604 27.067858491753743 20.848545889462418 46-47 24.17914203044408 27.361932318530634 26.85872436784501 21.600201283180272 48-49 24.17775546070801 26.801405975395433 28.031634446397184 20.989204117499373 50-51 25.332496863237143 26.750313676286076 26.900878293601004 21.016311166875784 52-53 24.026626475759862 28.246671690530018 26.475759859331827 21.250941974378296 54-55 24.132730015082956 26.73453996983409 27.124183006535947 22.00854700854701 56-57 24.04124229850371 28.027159562429272 26.153652709669306 21.77794542939771 58-59 24.421529175050303 27.74144869215292 26.219818913480886 21.617203219315893 60-61 24.181612943684936 26.928383293615955 27.02872193653581 21.8612818261633 62-63 24.14312617702448 27.972379158819837 26.478342749529187 21.40615191462649 64-65 25.04400301734976 26.954991199396527 26.389238119185315 21.611767664068392 66-67 23.5730450088006 27.596178023635908 27.256726175509176 21.57405079205431 68-69 24.384731290808638 27.209944751381215 27.23505775991964 21.17026619789051 70-71 25.454773554133737 26.696775812319657 27.28641324802409 20.56203738552252 72-73 23.789712556732223 26.487644982349973 27.54664649520928 22.175995965708523 74-75 24.576043068640647 24.3606998654105 28.465679676985197 22.59757738896366 76 25.73443008225617 0.0 43.00822561692127 31.25734430082256 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 8.0 1 4.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.5 23 2.5 24 4.5 25 6.0 26 7.5 27 7.0 28 10.5 29 17.5 30 17.0 31 27.5 32 45.0 33 57.0 34 69.0 35 89.0 36 114.0 37 124.5 38 154.0 39 207.0 40 243.5 41 260.0 42 264.0 43 283.5 44 307.0 45 316.5 46 323.0 47 318.5 48 291.0 49 252.0 50 229.0 51 203.5 52 163.5 53 136.5 54 132.5 55 115.5 56 86.5 57 67.5 58 58.5 59 52.0 60 37.5 61 28.5 62 25.0 63 16.0 64 10.0 65 7.0 66 3.0 67 2.5 68 2.5 69 3.5 70 3.0 71 1.0 72 2.0 73 2.5 74 2.5 75 2.5 76 1.5 77 1.0 78 0.5 79 0.0 80 0.5 81 0.5 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.5 88 1.0 89 1.0 90 1.5 91 1.0 92 0.0 93 0.0 94 0.5 95 1.0 96 1.0 97 0.5 98 0.5 99 14.0 100 27.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.3 3 0.22499999999999998 4 0.2 5 0.2 6 0.2 7 0.2 8 0.2 9 0.2 10-11 0.2 12-13 0.2 14-15 0.2 16-17 0.22499999999999998 18-19 0.2 20-21 0.21250000000000002 22-23 0.22499999999999998 24-25 0.21250000000000002 26-27 0.2 28-29 0.22499999999999998 30-31 0.22499999999999998 32-33 0.22499999999999998 34-35 0.22499999999999998 36-37 0.10022550739163118 38-39 0.25056376847907796 40-41 0.32573289902280134 42-43 0.4009020295665247 44-45 0.4885993485342019 46-47 0.4134302179904786 48-49 0.17543859649122806 50-51 0.12531328320802004 52-53 0.2255639097744361 54-55 0.30075187969924816 56-57 0.3383458646616541 58-59 0.3508771929824561 60-61 0.08771929824561403 62-63 0.17546058403308684 64-65 0.3008272750062672 66-67 0.3008272750062672 68-69 0.1629685345367933 70-71 0.037622272385252065 72-73 0.1510574018126888 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 9.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 1.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 0.0 70 2.0 71 2.0 72 24.0 73 77.0 74 336.0 75 994.0 76 2553.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.13551995931859 97.475 2 0.7882023900330536 1.55 3 0.0 0.0 4 0.02542588354945334 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02542588354945334 0.2 9 0.0 0.0 >10 0.02542588354945334 0.675 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 27 0.675 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1845514 spots for SRR9668916.sra Written 1845514 spots for SRR9668916.sra Read 1845514 spots for SRR9668916.sra Written 1845514 spots for SRR9668916.sra Read 1845514 spots for SRR9668916.sra Written 1845514 spots for SRR9668916.sra Read 1845514 spots for SRR9668916.sra Written 1845514 spots for SRR9668916.sra Read 1845514 spots for SRR9668916.sra Written 1845514 spots for SRR9668916.sra Read 1845514 spots for SRR9668916.sra Written 1845514 spots for SRR9668916.sra Read 1845514 spots for SRR9668916.sra Written 1845514 spots for SRR9668916.sra Read 1845514 spots for SRR9668916.sra Written 1845514 spots for SRR9668916.sra Read 1845514 spots for SRR9668916.sra Written 1845514 spots for SRR9668916.sra Read 1845514 spots for SRR9668916.sra Written 1845514 spots for SRR9668916.sra Read 1845514 spots for SRR9668916.sra Written 1845514 spots for SRR9668916.sra Read 1845514 spots for SRR9668916.sra Written 1845514 spots for SRR9668916.sra Read 1845514 spots for SRR9668916.sra Written 1845514 spots for SRR9668916.sra Read 1845514 spots for SRR9668916.sra Written 1845514 spots for SRR9668916.sra Read 1845514 spots for SRR9668916.sra Written 1845514 spots for SRR9668916.sra Read 1845514 spots for SRR9668916.sra Written 1845514 spots for SRR9668916.sra Read 1845514 spots for SRR9668916.sra Written 1845514 spots for SRR9668916.sra Read 1845514 spots for SRR9668916.sra Written 1845514 spots for SRR9668916.sra Read 1845514 spots for SRR9668916.sra Written 1845514 spots for SRR9668916.sra Read 1845514 spots for SRR9668916.sra Written 1845514 spots for SRR9668916.sra SRR ids: ['SRR9668916.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hvwpmua9 SRR9668916.sra spots: 36910280 blocks: [[1, 1845514], [1845515, 3691028], [3691029, 5536542], [5536543, 7382056], [7382057, 9227570], [9227571, 11073084], [11073085, 12918598], [12918599, 14764112], [14764113, 16609626], [16609627, 18455140], [18455141, 20300654], [20300655, 22146168], [22146169, 23991682], [23991683, 25837196], [25837197, 27682710], [27682711, 29528224], [29528225, 31373738], [31373739, 33219252], [33219253, 35064766], [35064767, 36910280]] SRR9668916 file size 7007810 SRR9668916 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668916 SRR9668916_1.fastq SRR9668916_2.fastq Input file: SRR9668916_1.fastq Paired file: SRR9668916_2.fastq trimmed: SRR9668916-trimmed-pair1.fastq, SRR9668916-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:22:55 2025 >> started Wed Feb 12 16:23:22 2025 >> done (27.051s) 36910280 read pairs processed; of these: 37 ( 0.00%) short read pairs filtered out after trimming by size control 4278 ( 0.01%) empty read pairs filtered out after trimming by size control 36905965 (99.99%) read pairs available; of these: 7221 ( 0.02%) trimmed read pairs available after processing 36898744 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 7 0.00% 21 7 0.00% 22 14 0.00% 23 15 0.00% 24 22 0.00% 25 19 0.00% 26 43 0.00% 27 34 0.00% 28 38 0.00% 29 56 0.00% 30 43 0.00% 31 36 0.00% 32 44 0.00% 33 56 0.00% 34 60 0.00% 35 196 0.00% 36 189 0.00% 37 246 0.00% 38 252 0.00% 39 285 0.00% 40 249 0.00% 41 273 0.00% 42 283 0.00% 43 316 0.00% 44 375 0.00% 45 343 0.00% 46 268 0.00% 47 410 0.00% 48 392 0.00% 49 419 0.00% 50 510 0.00% 51 651 0.00% 52 586 0.00% 53 592 0.00% 54 626 0.00% 55 994 0.00% 56 1086 0.00% 57 1020 0.00% 58 1100 0.00% 59 1120 0.00% 60 1293 0.00% 61 1125 0.00% 62 1384 0.00% 63 1513 0.00% 64 1714 0.00% 65 1886 0.01% 66 1981 0.01% 67 2224 0.01% 68 2208 0.01% 69 2704 0.01% 70 3976 0.01% 71 6426 0.02% 72 25914 0.07% 73 325738 0.88% 74 3066036 8.31% 75 17938222 48.61% 76 15508346 42.02% 36905965 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=19 prefix-density=0.44 prefix-fanout=2.1 sequence=CTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=27 fanout-score=19.17 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=4.6 sequence=CCATCTTTCGGCTAACCTAGCCTCCTCCGTCCCTCGGGACCAACAAGGGGTAGTACAGGAATATTCGCCTGTTGTCCATCGACTACGCCTTTCGGCCTGATCTTAGGCCCTGACTCACCCTCCGTGGACGAACCTTGCGGAGGAACCCTTAGGTTTTCGGGGCATTGGATTCTCACCAATGTTTGCGTTACTCAAGCCGACATTCTCGCTTCCGCTTCGTCCACCCCCGCTCGCGCGGGTGCTTCCCTCTAAGCGGAACGCTCCCCTACCGATGCATTTTTACATCCCACAGCTTCGGCAGATCGCTTAGCCCCGTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTATTACGCACTCTTTCAAGGGTGGCTGCTTCTAGGCAAACCTCCTGGCTGTCTCTGCACCCCTACCTCCTTTATCACTGAGCGGTCATTTAGGGGCCTTAGCTGGTGATCCGGGCTGTTTCCCTCTCGACGATGAAGCTTATCCCCCACCGTCTCACTGGC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=25 prefix-density=0.30 prefix-fanout=2.1 sequence=CCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=28.90 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.3 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR9668916 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:23:51 Started mapping on | Feb 12 16:23:51 Finished on | Feb 12 16:25:45 Mapping speed, Million of reads per hour | 1165.45 Number of input reads | 36905965 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 32650120 Uniquely mapped reads % | 88.47% Average mapped length | 150.43 Number of splices: Total | 15136520 Number of splices: Annotated (sjdb) | 14971411 Number of splices: GT/AG | 14871029 Number of splices: GC/AG | 227245 Number of splices: AT/AC | 10220 Number of splices: Non-canonical | 28026 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.02% Deletion average length | 2.18 Insertion rate per base | 0.01% Insertion average length | 1.95 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1542370 % of reads mapped to multiple loci | 4.18% Number of reads mapped to too many loci | 1584435 % of reads mapped to too many loci | 4.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.86% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2713523 2713523 2713523 N_multimapping 1542370 1542370 1542370 N_noFeature 891793 32289959 999943 N_ambiguous 410474 1613 157202 UnstrandedReadsAssigned:31347853 PositiveStrandReadsAssigned:358548 NegativeStrandReadsAssigned:31492975 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668916 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668916-trimmed-pair1.fastq SRR9668916-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,905,965 reads, 33,501,366 reads pseudoaligned [quant] estimated average fragment length: 207.803 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,256 rounds 52401 SRR9668916.ke.tsv 34699 SRR9668916.se.tsv 87100 total ==> SRR9668916.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1811.2 654.511 9.64199 Potri.005G024800.1.v4.1 1035 828.197 148 4.76808 Potri.004G059700.1.v4.1 961 754.197 101 3.57315 Potri.007G009000.2.v4.1 1416 1209.2 0 0 Potri.003G141000.2.v4.1 2943 2736.2 588 5.73383 Potri.016G087400.1.v4.1 270 84.9476 2347.37 737.302 Potri.015G069301.1.v4.1 564 357.518 0 0 Potri.010G195200.1.v4.1 1773 1566.2 17 0.289613 Potri.012G127500.1.v4.1 977 770.197 8262 286.219 ==> SRR9668916.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 50 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 433 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 171 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 13 SRR9668916 completed mapping pipeline successfully