Starting /dee2/code/volunteer_pipeline.sh SRR9668917 current disk space = 3051972792320 free memory = 1576958224 SRR9668917 SRAfilesize 8d63d99c2494f785af8db46dc9b2fc50 SRR9668917.sra SRR9668917.sra file validated SRR9668917 is paired end SRR9668917 is conventional basespace SRR9668917 read1 length is 57-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668917_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 57-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5085 32.0 32.0 32.0 32.0 32.0 2 31.45 32.0 32.0 32.0 32.0 32.0 3 31.63275 32.0 32.0 32.0 32.0 32.0 4 31.65725 32.0 32.0 32.0 32.0 32.0 5 31.65775 32.0 32.0 32.0 32.0 32.0 6 34.6785 36.0 36.0 36.0 36.0 36.0 7 35.1695 36.0 36.0 36.0 36.0 36.0 8 35.32675 36.0 36.0 36.0 36.0 36.0 9 35.218 36.0 36.0 36.0 36.0 36.0 10-11 35.1705 36.0 36.0 36.0 36.0 36.0 12-13 35.149 36.0 36.0 36.0 36.0 36.0 14-15 35.139875 36.0 36.0 36.0 36.0 36.0 16-17 35.192 36.0 36.0 36.0 36.0 36.0 18-19 35.189125000000004 36.0 36.0 36.0 36.0 36.0 20-21 35.094875 36.0 36.0 36.0 36.0 36.0 22-23 34.995625000000004 36.0 36.0 36.0 36.0 36.0 24-25 34.9975 36.0 36.0 36.0 36.0 36.0 26-27 34.95 36.0 36.0 36.0 36.0 36.0 28-29 35.039375 36.0 36.0 36.0 36.0 36.0 30-31 35.081999999999994 36.0 36.0 36.0 36.0 36.0 32-33 35.024625 36.0 36.0 36.0 36.0 36.0 34-35 34.88975 36.0 36.0 36.0 34.0 36.0 36-37 34.8335 36.0 36.0 36.0 36.0 36.0 38-39 34.93575 36.0 36.0 36.0 36.0 36.0 40-41 34.907375 36.0 36.0 36.0 36.0 36.0 42-43 34.87625 36.0 36.0 36.0 36.0 36.0 44-45 34.806124999999994 36.0 36.0 36.0 36.0 36.0 46-47 34.821875 36.0 36.0 36.0 36.0 36.0 48-49 34.88249999999999 36.0 36.0 36.0 36.0 36.0 50-51 34.731625 36.0 36.0 36.0 34.0 36.0 52-53 34.664625 36.0 36.0 36.0 32.0 36.0 54-55 34.72175 36.0 36.0 36.0 32.0 36.0 56-57 34.58025 36.0 36.0 36.0 32.0 36.0 58-59 34.721680420105024 36.0 36.0 36.0 32.0 36.0 60-61 34.61315328832208 36.0 36.0 36.0 32.0 36.0 62-63 34.48424606151538 36.0 36.0 36.0 32.0 36.0 64-65 34.48612153038259 36.0 36.0 36.0 32.0 36.0 66-67 34.40514558979915 36.0 36.0 36.0 32.0 36.0 68-69 34.39312541559747 36.0 36.0 36.0 32.0 36.0 70-71 34.428131346257445 36.0 36.0 36.0 32.0 36.0 72-73 34.34168491225715 36.0 36.0 36.0 32.0 36.0 74-75 34.406535699947 36.0 36.0 36.0 32.0 36.0 76 33.510546875 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 4.0 24 8.0 25 7.0 26 16.0 27 31.0 28 59.0 29 52.0 30 95.0 31 117.0 32 133.0 33 244.0 34 552.0 35 2679.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.05 14.374999999999998 9.15 39.425 2 21.85 17.65 39.324999999999996 21.175 3 18.425 20.974999999999998 26.724999999999998 33.875 4 22.75 28.999999999999996 23.75 24.5 5 22.5 34.975 22.825 19.7 6 18.442415017757483 36.3013698630137 24.708269913749366 20.54794520547945 7 14.649999999999999 24.325 42.575 18.45 8 17.65 23.5 32.85 26.0 9 18.575 23.974999999999998 32.574999999999996 24.875 10-11 20.9 33.7 22.675 22.725 12-13 21.05 25.387500000000003 28.237499999999997 25.324999999999996 14-15 20.025000000000002 27.1125 28.225 24.637500000000003 16-17 20.4875 27.6625 26.9125 24.9375 18-19 20.7125 28.462500000000002 27.187499999999996 23.6375 20-21 20.8 28.599999999999998 26.5125 24.087500000000002 22-23 21.2 28.499999999999996 26.75 23.549999999999997 24-25 20.8875 27.437499999999996 27.3125 24.3625 26-27 20.65 28.175 26.974999999999998 24.2 28-29 20.1125 28.287499999999998 27.787499999999998 23.8125 30-31 20.6875 28.512500000000003 26.5875 24.212500000000002 32-33 20.6625 27.6375 27.737499999999997 23.962500000000002 34-35 20.05 28.575 26.575 24.8 36-37 19.45 27.987499999999997 27.6 24.962500000000002 38-39 20.549999999999997 27.6375 27.3375 24.474999999999998 40-41 20.775 28.8625 26.6125 23.75 42-43 21.099999999999998 27.8375 27.0125 24.05 44-45 21.712500000000002 28.849999999999998 25.9625 23.474999999999998 46-47 22.075 27.8625 26.937499999999996 23.125 48-49 20.75 27.725 27.025 24.5 50-51 21.25 27.750000000000004 26.424999999999997 24.575 52-53 20.3875 27.9375 28.050000000000004 23.625 54-55 20.424999999999997 27.775 27.175 24.625 56-57 20.5625 28.1625 26.974999999999998 24.3 58-59 20.94273568392098 28.232058014503625 26.531632908227053 24.293573393348336 60-61 20.64266066516629 27.51937984496124 26.819204801200303 25.018754688672168 62-63 20.880220055013755 28.044511127781945 27.544386096524132 23.53088272068017 64-65 20.517629407351837 27.59439859964991 28.219554888722183 23.668417104276067 66-67 19.98249343503814 27.522821057896714 27.53532574715518 24.959359759909965 68-69 20.950594121325828 27.779862414008754 27.604752970606626 23.66479049405879 70-71 21.030902039284374 27.186288002001753 27.786813461779058 23.99599649693482 72-73 20.821298505588345 28.60730880321487 26.861735526811504 23.70965716438528 74-75 20.749202975557917 24.97343251859724 28.61317747077577 25.664187035069077 76 22.6171875 0.0 40.859375 36.5234375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 1.5 20 3.0 21 4.5 22 4.5 23 4.5 24 6.0 25 9.0 26 12.5 27 15.5 28 18.0 29 20.5 30 30.5 31 44.0 32 51.0 33 57.5 34 73.5 35 99.5 36 122.0 37 135.0 38 157.0 39 191.0 40 212.5 41 224.0 42 242.5 43 276.0 44 299.5 45 303.5 46 304.0 47 309.0 48 302.0 49 273.0 50 249.5 51 231.0 52 199.0 53 150.0 54 118.5 55 101.5 56 83.5 57 78.0 58 76.0 59 54.0 60 31.0 61 22.0 62 16.5 63 13.0 64 7.0 65 4.5 66 5.0 67 6.0 68 3.5 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 1.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.4500000000000002 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 57 1.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 0.0 68 1.0 69 0.0 70 1.0 71 4.0 72 21.0 73 74.0 74 266.0 75 1071.0 76 2560.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8860759493671 97.65 2 0.9620253164556962 1.9 3 0.1518987341772152 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668917 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668917_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.211 32.0 32.0 32.0 32.0 32.0 2 30.9545 32.0 32.0 32.0 32.0 32.0 3 30.96325 32.0 32.0 32.0 32.0 32.0 4 30.9625 32.0 32.0 32.0 32.0 32.0 5 30.9505 32.0 32.0 32.0 32.0 32.0 6 34.3225 36.0 36.0 36.0 32.0 36.0 7 34.45075 36.0 36.0 36.0 32.0 36.0 8 34.34875 36.0 36.0 36.0 32.0 36.0 9 34.58675 36.0 36.0 36.0 32.0 36.0 10-11 34.386875 36.0 36.0 36.0 32.0 36.0 12-13 34.4645 36.0 36.0 36.0 32.0 36.0 14-15 34.382625 36.0 36.0 36.0 32.0 36.0 16-17 34.230000000000004 36.0 36.0 36.0 32.0 36.0 18-19 34.265 36.0 36.0 36.0 32.0 36.0 20-21 34.25275 36.0 36.0 36.0 32.0 36.0 22-23 34.26575 36.0 36.0 36.0 32.0 36.0 24-25 34.300875 36.0 36.0 36.0 32.0 36.0 26-27 34.25425 36.0 36.0 36.0 32.0 36.0 28-29 34.141625000000005 36.0 36.0 36.0 32.0 36.0 30-31 34.110625 36.0 36.0 36.0 32.0 36.0 32-33 34.128375 36.0 36.0 36.0 32.0 36.0 34-35 34.172625 36.0 36.0 36.0 32.0 36.0 36-37 34.2496866382552 36.0 36.0 36.0 32.0 36.0 38-39 34.073451992980694 36.0 36.0 36.0 32.0 36.0 40-41 33.88305339684132 36.0 36.0 36.0 29.5 36.0 42-43 33.95687664648496 36.0 36.0 36.0 32.0 36.0 44-45 33.89240030097818 36.0 36.0 36.0 32.0 36.0 46-47 33.92952094306496 36.0 36.0 36.0 32.0 36.0 48-49 34.029876977152895 36.0 36.0 36.0 29.5 36.0 50-51 33.98104443886518 36.0 36.0 36.0 32.0 36.0 52-53 33.72043685664072 36.0 36.0 36.0 27.0 36.0 54-55 33.7316093396937 36.0 36.0 36.0 29.5 36.0 56-57 33.63582726587999 36.0 36.0 36.0 27.0 36.0 58-59 33.5922903063787 36.0 36.0 36.0 27.0 36.0 60-61 33.67174168965065 36.0 36.0 36.0 27.0 36.0 62-63 33.551494599346896 36.0 36.0 36.0 27.0 36.0 64-65 33.53566942979151 36.0 36.0 36.0 27.0 36.0 66-67 33.384074353177596 36.0 36.0 36.0 27.0 36.0 68-69 33.679702266671214 36.0 36.0 36.0 27.0 36.0 70-71 33.636261067842355 36.0 36.0 36.0 27.0 36.0 72-73 33.505386577231356 36.0 36.0 36.0 27.0 36.0 74-75 33.60715509121738 36.0 36.0 36.0 27.0 36.0 76 32.42532855436081 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 2.0 16 10.0 17 6.0 18 5.0 19 8.0 20 15.0 21 8.0 22 12.0 23 18.0 24 34.0 25 38.0 26 48.0 27 49.0 28 70.0 29 79.0 30 115.0 31 140.0 32 199.0 33 307.0 34 618.0 35 2206.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.97942799799298 22.32814851981937 11.991971901655795 28.700451580531862 2 27.858575727181545 26.755265797392173 31.41925777331996 13.966900702106319 3 22.417251755265795 26.730190571715145 29.03711133400201 21.81544633901705 4 25.394835798445726 35.02130859864628 21.007771371270994 18.576084231637 5 25.595387315116568 35.948859363248935 21.709701679618952 16.74605164201554 6 21.133116069190272 37.80396089245425 22.486838806718477 18.576084231637 7 20.40611682125846 18.952118325394835 39.70920030082728 20.932564552519427 8 22.536976685886188 23.614941087991976 27.475557783905742 26.372524442216093 9 23.865630483830532 23.13863123589872 28.302832790172978 24.69290549009777 10-11 24.830784657808973 30.985209325645524 23.063424417147154 21.120581599398346 12-13 24.51742291301078 25.219353221358737 27.049385810980198 23.21383805465029 14-15 24.52995738280271 26.548007019303082 27.513161193281526 21.408874404612686 16-17 24.441936292952093 26.812139453222976 27.326310509154755 21.419613744670176 18-19 23.978440711957884 28.190022562045623 26.63574830784658 21.195788418149913 20-21 24.084754262788366 27.90872617853561 26.19107321965898 21.81544633901705 22-23 24.90272373540856 27.664114472197816 26.34617798418476 21.086983808208863 24-25 23.83997993478806 27.13819914722849 26.950087785302234 22.071733132681214 26-27 23.802958134870895 28.26522938079719 26.44773126096766 21.484081223364253 28-29 25.2508780732564 27.069744104365277 26.103863522328147 21.575514300050173 30-31 24.419334588826114 27.357187696170747 26.666666666666668 21.55681104833647 32-33 24.2534504391468 27.51568381430364 26.97616060225847 21.25470514429109 34-35 25.338855421686745 26.945281124497996 25.941265060240966 21.774598393574294 36-37 23.885470300138138 27.67801079994977 27.024990581439155 21.411528318472936 38-39 23.899924566255972 27.156147850138296 27.483027407593664 21.460900176012068 40-41 24.511903262375615 28.026199773271195 26.124197002141326 21.337699962211865 42-43 24.332157258064516 26.90272177419355 27.331149193548388 21.433971774193548 44-45 24.135755740600555 27.605349482715113 26.659096643956598 21.59979813272773 46-47 25.236354468675152 26.723811924870795 26.35825034665322 21.68158325980083 48-49 24.450031426775613 26.67504714016342 27.42928975487115 21.445631678189816 50-51 24.258793969849247 27.85175879396985 26.407035175879397 21.482412060301506 52-53 25.213782696177063 26.836016096579478 25.691649899396378 22.258551307847082 54-55 24.175270712666837 27.788970032737346 26.114328884411986 21.921430370183835 56-57 23.979334677419356 26.953125 27.268145161290324 21.79939516129032 58-59 23.881537492123503 27.246376811594203 27.22117202268431 21.650913673597984 60-61 23.979399572917977 27.05690239919608 26.868483858811707 22.095214169074236 62-63 24.217669976121652 27.83712454442629 26.71861254241548 21.22659293703657 64-65 25.447215923406404 26.933736457545983 26.3416477702192 21.27739984882842 66-67 24.39516129032258 27.280745967741936 27.305947580645164 21.01814516129032 68-69 24.786109713135378 26.182687468545545 27.403120281831907 21.628082536487167 70-71 25.20733852726816 27.381251570746418 25.785373209349082 21.62603669263634 72-73 23.487814117944183 27.57923980300543 27.705518373532012 21.227427705518373 74-75 24.49144550720733 24.275899232116398 28.371278458844134 22.861376801832144 76 27.001194743130224 0.0 40.26284348864994 32.73596176821984 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 11.0 1 5.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 1.0 19 1.0 20 0.5 21 0.5 22 1.5 23 4.5 24 7.0 25 6.5 26 6.5 27 9.0 28 13.0 29 14.0 30 20.5 31 26.0 32 32.5 33 43.0 34 53.5 35 78.0 36 102.5 37 114.5 38 146.0 39 197.5 40 225.0 41 249.0 42 288.5 43 312.0 44 329.5 45 316.5 46 294.5 47 305.5 48 293.5 49 251.0 50 220.5 51 217.0 52 204.5 53 159.0 54 120.5 55 101.0 56 83.5 57 73.5 58 70.0 59 62.5 60 43.5 61 26.0 62 18.5 63 16.5 64 15.5 65 11.0 66 4.5 67 2.0 68 3.0 69 3.0 70 1.5 71 1.0 72 1.5 73 1.5 74 1.5 75 1.5 76 0.5 77 1.0 78 1.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 1.0 87 2.0 88 1.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.5 94 1.5 95 1.5 96 1.0 97 1.5 98 2.0 99 8.5 100 15.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.3 3 0.3 4 0.27499999999999997 5 0.27499999999999997 6 0.27499999999999997 7 0.27499999999999997 8 0.27499999999999997 9 0.27499999999999997 10-11 0.27499999999999997 12-13 0.27499999999999997 14-15 0.27499999999999997 16-17 0.325 18-19 0.27499999999999997 20-21 0.3 22-23 0.41250000000000003 24-25 0.325 26-27 0.27499999999999997 28-29 0.35000000000000003 30-31 0.43750000000000006 32-33 0.375 34-35 0.4 36-37 0.18801704687891702 38-39 0.3008272750062672 40-41 0.48884432188518423 42-43 0.5139776858468096 44-45 0.601956358164033 46-47 0.5141710559317783 48-49 0.1380868691940748 50-51 0.07532011046949535 52-53 0.17574692442882248 54-55 0.3012804418779814 56-57 0.37660055234747675 58-59 0.3641386238071321 60-61 0.02511616225040814 62-63 0.06279829188646069 64-65 0.30143180105501133 66-67 0.3265511178095956 68-69 0.163296068333124 70-71 0.012564392511622063 72-73 0.02524933720489837 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 11.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 1.0 43 1.0 44 0.0 45 0.0 46 0.0 47 4.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 1.0 58 0.0 59 0.0 60 1.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 0.0 70 1.0 71 5.0 72 27.0 73 95.0 74 281.0 75 1060.0 76 2511.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08490086426029 97.45 2 0.7371631926792069 1.4500000000000002 3 0.10167768174885612 0.3 4 0.02541942043721403 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05083884087442806 0.7000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 17 0.42500000000000004 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 11 0.27499999999999997 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2004061 spots for SRR9668917.sra Written 2004061 spots for SRR9668917.sra Read 2004061 spots for SRR9668917.sra Written 2004061 spots for SRR9668917.sra Read 2004061 spots for SRR9668917.sra Written 2004061 spots for SRR9668917.sra Read 2004061 spots for SRR9668917.sra Written 2004061 spots for SRR9668917.sra Read 2004061 spots for SRR9668917.sra Written 2004061 spots for SRR9668917.sra Read 2004061 spots for SRR9668917.sra Written 2004061 spots for SRR9668917.sra Read 2004061 spots for SRR9668917.sra Written 2004061 spots for SRR9668917.sra Read 2004061 spots for SRR9668917.sra Written 2004061 spots for SRR9668917.sra Read 2004069 spots for SRR9668917.sra Written 2004069 spots for SRR9668917.sra Read 2004061 spots for SRR9668917.sra Written 2004061 spots for SRR9668917.sra Read 2004061 spots for SRR9668917.sra Written 2004061 spots for SRR9668917.sra Read 2004061 spots for SRR9668917.sra Written 2004061 spots for SRR9668917.sra Read 2004061 spots for SRR9668917.sra Written 2004061 spots for SRR9668917.sra Read 2004061 spots for SRR9668917.sra Written 2004061 spots for SRR9668917.sra Read 2004061 spots for SRR9668917.sra Written 2004061 spots for SRR9668917.sra Read 2004061 spots for SRR9668917.sra Written 2004061 spots for SRR9668917.sra Read 2004061 spots for SRR9668917.sra Written 2004061 spots for SRR9668917.sra Read 2004061 spots for SRR9668917.sra Written 2004061 spots for SRR9668917.sra Read 2004061 spots for SRR9668917.sra Written 2004061 spots for SRR9668917.sra Read 2004061 spots for SRR9668917.sra Written 2004061 spots for SRR9668917.sra SRR ids: ['SRR9668917.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tcqgdegy SRR9668917.sra spots: 40081228 blocks: [[1, 2004061], [2004062, 4008122], [4008123, 6012183], [6012184, 8016244], [8016245, 10020305], [10020306, 12024366], [12024367, 14028427], [14028428, 16032488], [16032489, 18036549], [18036550, 20040610], [20040611, 22044671], [22044672, 24048732], [24048733, 26052793], [26052794, 28056854], [28056855, 30060915], [30060916, 32064976], [32064977, 34069037], [34069038, 36073098], [36073099, 38077159], [38077160, 40081228]] SRR9668917 file size 7610992 SRR9668917 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668917 SRR9668917_1.fastq SRR9668917_2.fastq Input file: SRR9668917_1.fastq Paired file: SRR9668917_2.fastq trimmed: SRR9668917-trimmed-pair1.fastq, SRR9668917-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:59:11 2025 >> started Wed Feb 12 16:59:44 2025 >> done (33.058s) 40081228 read pairs processed; of these: 25 ( 0.00%) short read pairs filtered out after trimming by size control 5176 ( 0.01%) empty read pairs filtered out after trimming by size control 40076027 (99.99%) read pairs available; of these: 7117 ( 0.02%) trimmed read pairs available after processing 40068910 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 4 0.00% 21 2 0.00% 22 6 0.00% 23 6 0.00% 24 13 0.00% 25 14 0.00% 26 13 0.00% 27 17 0.00% 28 20 0.00% 29 20 0.00% 30 17 0.00% 31 32 0.00% 32 28 0.00% 33 21 0.00% 34 43 0.00% 35 157 0.00% 36 197 0.00% 37 207 0.00% 38 225 0.00% 39 221 0.00% 40 248 0.00% 41 283 0.00% 42 290 0.00% 43 344 0.00% 44 394 0.00% 45 401 0.00% 46 349 0.00% 47 452 0.00% 48 512 0.00% 49 526 0.00% 50 653 0.00% 51 796 0.00% 52 757 0.00% 53 741 0.00% 54 861 0.00% 55 1303 0.00% 56 1287 0.00% 57 1335 0.00% 58 1473 0.00% 59 1571 0.00% 60 1774 0.00% 61 1712 0.00% 62 1942 0.00% 63 2158 0.01% 64 2366 0.01% 65 2615 0.01% 66 2864 0.01% 67 3276 0.01% 68 3324 0.01% 69 3967 0.01% 70 5452 0.01% 71 7988 0.02% 72 29034 0.07% 73 356735 0.89% 74 3347361 8.35% 75 19581531 48.86% 76 16706088 41.69% 40076027 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=24 prefix-density=0.54 prefix-fanout=2.2 sequence=CTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=23.90 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.6 sequence=TCTTTCAATTGTTCTTACAGTCACAATATTTTATTCTCTAAGAACTTATCGTCTTCTCCATCAGAGCTGAGCATGATTGATATCGTAAGCATCAGAATCATCAAGCTTCAGCTTAACTAGTTCGCTGATATCATATGGATAGGCGTCCTTTGGTGACTGACGTTTATATGCTCTTTTTCCAAAGGCCCAAGCTTTAGCTTCAGTAAAATGGGCTCCATCCCAGTACACATAGTCACTCCTGTTGCTACATGGGAAGGAGAGAGATTTACATGGGACTGAACCAGGTTCTACCTCGCAACAGCTCTTACGGGTTTGTGTAAAACCTGTATT criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=25 prefix-density=0.36 prefix-fanout=2.1 sequence=CCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=31.41 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=3.5 sequence=CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR9668917 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:00:13 Started mapping on | Feb 12 17:00:13 Finished on | Feb 12 17:01:58 Mapping speed, Million of reads per hour | 1374.04 Number of input reads | 40076027 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 35543747 Uniquely mapped reads % | 88.69% Average mapped length | 150.40 Number of splices: Total | 15652705 Number of splices: Annotated (sjdb) | 15475993 Number of splices: GT/AG | 15373460 Number of splices: GC/AG | 237411 Number of splices: AT/AC | 10068 Number of splices: Non-canonical | 31766 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.02% Deletion average length | 2.16 Insertion rate per base | 0.01% Insertion average length | 1.93 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1687362 % of reads mapped to multiple loci | 4.21% Number of reads mapped to too many loci | 1232820 % of reads mapped to too many loci | 3.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.87% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2844981 2844981 2844981 N_multimapping 1687362 1687362 1687362 N_noFeature 849335 35109101 997264 N_ambiguous 482253 1592 194376 UnstrandedReadsAssigned:34212159 PositiveStrandReadsAssigned:433054 NegativeStrandReadsAssigned:34352107 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668917 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668917-trimmed-pair1.fastq SRR9668917-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,076,027 reads, 36,254,697 reads pseudoaligned [quant] estimated average fragment length: 198.523 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52401 SRR9668917.ke.tsv 34699 SRR9668917.se.tsv 87100 total ==> SRR9668917.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1820.48 572 7.48254 Potri.005G024800.1.v4.1 1035 837.477 173 4.91939 Potri.004G059700.1.v4.1 961 763.481 85 2.6513 Potri.007G009000.2.v4.1 1416 1218.48 0 0 Potri.003G141000.2.v4.1 2943 2745.48 566.552 4.91428 Potri.016G087400.1.v4.1 270 89.654 2694.44 715.71 Potri.015G069301.1.v4.1 564 366.652 0 0 Potri.010G195200.1.v4.1 1773 1575.48 8 0.120925 Potri.012G127500.1.v4.1 977 779.481 9208 281.318 ==> SRR9668917.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 60 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 564 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 158 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 15 SRR9668917 completed mapping pipeline successfully