Starting /dee2/code/volunteer_pipeline.sh SRR9668920 current disk space = 3051974209536 free memory = 1581156536 SRR9668920 SRAfilesize 4061cf8f2e3aed0f8bf2ee9873195b09 SRR9668920.sra SRR9668920.sra file validated SRR9668920 is paired end SRR9668920 is conventional basespace SRR9668920 read1 length is 61-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668920_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 61-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.525 32.0 32.0 32.0 32.0 32.0 2 31.47825 32.0 32.0 32.0 32.0 32.0 3 31.54875 32.0 32.0 32.0 32.0 32.0 4 31.481 32.0 32.0 32.0 32.0 32.0 5 31.5925 32.0 32.0 32.0 32.0 32.0 6 34.73725 36.0 36.0 36.0 36.0 36.0 7 35.103 36.0 36.0 36.0 36.0 36.0 8 35.119 36.0 36.0 36.0 36.0 36.0 9 35.184 36.0 36.0 36.0 36.0 36.0 10-11 35.162125 36.0 36.0 36.0 36.0 36.0 12-13 35.156125 36.0 36.0 36.0 36.0 36.0 14-15 35.121624999999995 36.0 36.0 36.0 36.0 36.0 16-17 35.203 36.0 36.0 36.0 36.0 36.0 18-19 35.149625 36.0 36.0 36.0 36.0 36.0 20-21 35.08975 36.0 36.0 36.0 36.0 36.0 22-23 35.094125000000005 36.0 36.0 36.0 36.0 36.0 24-25 35.03675 36.0 36.0 36.0 36.0 36.0 26-27 34.979625 36.0 36.0 36.0 36.0 36.0 28-29 34.986000000000004 36.0 36.0 36.0 36.0 36.0 30-31 34.914375 36.0 36.0 36.0 36.0 36.0 32-33 34.924375 36.0 36.0 36.0 36.0 36.0 34-35 34.866749999999996 36.0 36.0 36.0 36.0 36.0 36-37 34.947500000000005 36.0 36.0 36.0 36.0 36.0 38-39 34.952375 36.0 36.0 36.0 36.0 36.0 40-41 34.885625 36.0 36.0 36.0 36.0 36.0 42-43 34.892624999999995 36.0 36.0 36.0 36.0 36.0 44-45 34.83075 36.0 36.0 36.0 36.0 36.0 46-47 34.844875 36.0 36.0 36.0 34.0 36.0 48-49 34.75425 36.0 36.0 36.0 34.0 36.0 50-51 34.755250000000004 36.0 36.0 36.0 34.0 36.0 52-53 34.83625 36.0 36.0 36.0 36.0 36.0 54-55 34.6465 36.0 36.0 36.0 32.0 36.0 56-57 34.647999999999996 36.0 36.0 36.0 32.0 36.0 58-59 34.681124999999994 36.0 36.0 36.0 32.0 36.0 60-61 34.542 36.0 36.0 36.0 32.0 36.0 62-63 34.548762190547635 36.0 36.0 36.0 32.0 36.0 64-65 34.44886221555389 36.0 36.0 36.0 32.0 36.0 66-67 34.434983745936485 36.0 36.0 36.0 32.0 36.0 68-69 34.38997249312328 36.0 36.0 36.0 32.0 36.0 70-71 34.35646411602901 36.0 36.0 36.0 32.0 36.0 72-73 34.33684160849326 36.0 36.0 36.0 32.0 36.0 74-75 34.3509391325351 36.0 36.0 36.0 32.0 36.0 76 33.450094876660344 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 7.0 25 9.0 26 17.0 27 35.0 28 49.0 29 78.0 30 93.0 31 108.0 32 147.0 33 236.0 34 532.0 35 2687.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.15 14.249999999999998 9.950000000000001 37.65 2 22.0 16.1 39.1 22.8 3 18.8 22.425 25.8 32.975 4 22.425 29.75 22.325 25.5 5 22.45 35.175 23.025000000000002 19.35 6 18.435046847303116 35.80653329956951 24.841732084071914 20.916687769055457 7 15.65 23.825 42.1 18.425 8 17.4 22.900000000000002 32.75 26.950000000000003 9 18.675 22.675 32.824999999999996 25.825 10-11 20.8 32.45 23.325000000000003 23.425 12-13 20.4375 26.2625 27.737499999999997 25.5625 14-15 20.775 26.1625 28.225 24.837500000000002 16-17 21.45 27.237499999999997 27.5625 23.75 18-19 21.275 27.6625 27.037499999999998 24.025 20-21 20.9 28.0875 27.5625 23.45 22-23 21.6625 28.037499999999998 27.1625 23.1375 24-25 21.7375 27.950000000000003 26.35 23.962500000000002 26-27 20.9375 27.875 26.8625 24.325 28-29 21.512500000000003 27.400000000000002 26.775 24.3125 30-31 20.9375 27.6875 26.7125 24.6625 32-33 20.65 26.974999999999998 27.487499999999997 24.887500000000003 34-35 21.025 26.7125 27.750000000000004 24.5125 36-37 20.5 28.025 26.237500000000004 25.2375 38-39 21.8 27.425 26.05 24.725 40-41 20.6125 28.025 26.4625 24.9 42-43 19.975 28.4375 27.0875 24.5 44-45 20.875 27.237499999999997 27.375 24.5125 46-47 20.5125 28.0625 27.6625 23.7625 48-49 20.8875 27.700000000000003 27.224999999999998 24.1875 50-51 20.45 27.5125 27.0625 24.975 52-53 21.425 27.6875 26.937499999999996 23.95 54-55 21.0625 27.875 26.8 24.2625 56-57 20.225 28.1125 27.3125 24.349999999999998 58-59 21.512500000000003 28.287499999999998 26.4125 23.7875 60-61 21.3875 27.9375 26.487500000000004 24.1875 62-63 20.742685671417853 27.181795448862218 27.981995498874717 24.093523380845213 64-65 21.567891972993248 27.46936734183546 26.569142285571395 24.3935983995999 66-67 20.69267316829207 26.456614153538382 27.66941735433858 25.18129532383096 68-69 20.91772943235809 26.84421105276319 26.831707926981746 25.406351587896975 70-71 21.36784196049012 27.644411102775695 26.981745436359088 24.006001500375092 72-73 20.569421798570175 27.6558384547849 26.48940173084159 25.285338015803337 74-75 20.687376074025117 24.282881692002643 29.649702577660275 25.380039656311965 76 21.631878557874764 0.0 40.94876660341556 37.41935483870968 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.5 19 0.5 20 0.5 21 0.5 22 2.0 23 3.5 24 4.0 25 5.5 26 9.5 27 11.0 28 12.0 29 20.0 30 31.5 31 39.5 32 46.0 33 55.0 34 68.5 35 90.0 36 124.0 37 150.5 38 172.5 39 192.0 40 201.0 41 223.0 42 254.0 43 275.0 44 284.0 45 286.5 46 291.5 47 297.5 48 291.0 49 274.5 50 247.0 51 222.5 52 205.0 53 175.5 54 154.0 55 131.5 56 104.0 57 84.5 58 69.5 59 59.0 60 44.0 61 28.5 62 18.0 63 15.0 64 11.5 65 7.0 66 4.0 67 3.0 68 4.5 69 4.0 70 1.5 71 1.0 72 2.5 73 2.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.275 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 61 1.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 6.0 72 13.0 73 73.0 74 249.0 75 1023.0 76 2635.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.45 #Duplication Level Percentage of deduplicated Percentage of total 1 98.65413915693246 97.125 2 1.1934992381919756 2.35 3 0.10157440325038089 0.3 4 0.025393600812595223 0.1 5 0.025393600812595223 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGAACTTCTTCAATCCAGTTGGAGGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGGAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668920 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668920_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.11275 32.0 32.0 32.0 32.0 32.0 2 30.9065 32.0 32.0 32.0 32.0 32.0 3 30.9415 32.0 32.0 32.0 32.0 32.0 4 30.91525 32.0 32.0 32.0 32.0 32.0 5 30.95525 32.0 32.0 32.0 32.0 32.0 6 34.33575 36.0 36.0 36.0 32.0 36.0 7 34.57025 36.0 36.0 36.0 32.0 36.0 8 34.37025 36.0 36.0 36.0 32.0 36.0 9 34.407 36.0 36.0 36.0 32.0 36.0 10-11 34.279250000000005 36.0 36.0 36.0 32.0 36.0 12-13 34.383375 36.0 36.0 36.0 32.0 36.0 14-15 34.373 36.0 36.0 36.0 32.0 36.0 16-17 34.346374999999995 36.0 36.0 36.0 32.0 36.0 18-19 34.16875 36.0 36.0 36.0 32.0 36.0 20-21 34.1405 36.0 36.0 36.0 32.0 36.0 22-23 34.145375 36.0 36.0 36.0 32.0 36.0 24-25 34.202375 36.0 36.0 36.0 32.0 36.0 26-27 34.221375 36.0 36.0 36.0 32.0 36.0 28-29 34.008624999999995 36.0 36.0 36.0 32.0 36.0 30-31 34.071749999999994 36.0 36.0 36.0 32.0 36.0 32-33 34.08925 36.0 36.0 36.0 32.0 36.0 34-35 34.090999999999994 36.0 36.0 36.0 32.0 36.0 36-37 34.058506639939864 36.0 36.0 36.0 32.0 36.0 38-39 33.96141697892941 36.0 36.0 36.0 32.0 36.0 40-41 33.91892230576441 36.0 36.0 36.0 32.0 36.0 42-43 33.682080200501254 36.0 36.0 36.0 27.0 36.0 44-45 33.84441573655537 36.0 36.0 36.0 29.5 36.0 46-47 33.89205115346038 36.0 36.0 36.0 32.0 36.0 48-49 33.8265178123432 36.0 36.0 36.0 27.0 36.0 50-51 33.7744606121425 36.0 36.0 36.0 27.0 36.0 52-53 33.69138159845532 36.0 36.0 36.0 27.0 36.0 54-55 33.6168130489335 36.0 36.0 36.0 27.0 36.0 56-57 33.709410288582184 36.0 36.0 36.0 29.5 36.0 58-59 33.52120451693852 36.0 36.0 36.0 27.0 36.0 60-61 33.615934755332496 36.0 36.0 36.0 27.0 36.0 62-63 33.527359437751 36.0 36.0 36.0 27.0 36.0 64-65 33.407630522088354 36.0 36.0 36.0 27.0 36.0 66-67 33.30722891566265 36.0 36.0 36.0 27.0 36.0 68-69 33.433232931726906 36.0 36.0 36.0 27.0 36.0 70-71 33.46133567662566 36.0 36.0 36.0 27.0 36.0 72-73 33.395051842719454 36.0 36.0 36.0 27.0 36.0 74-75 33.461237550672145 36.0 36.0 36.0 27.0 36.0 76 32.439780306002355 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 3.0 15 7.0 16 12.0 17 9.0 18 8.0 19 8.0 20 9.0 21 18.0 22 14.0 23 25.0 24 22.0 25 33.0 26 57.0 27 47.0 28 70.0 29 103.0 30 104.0 31 126.0 32 198.0 33 335.0 34 632.0 35 2151.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.15365302535777 22.043685664072306 12.176751192568416 29.625910118001507 2 28.309929789368105 27.28184553660983 30.466399197592782 13.941825476429287 3 22.776246554748184 27.38661989476322 27.48684540215485 22.350288148333753 4 25.457278877474316 33.675770483588074 21.147582059634175 19.719368579303435 5 27.161112503132046 35.379604109245804 20.821849160611375 16.637434227010775 6 20.972187421698823 37.53445251816587 21.072412929090454 20.42094713104485 7 21.623653219744423 18.140816837885243 38.88749686795289 21.348033074417437 8 22.876472062139815 25.35705337008269 25.60761713856176 26.158857429215736 9 24.229516411926834 24.204460035078927 28.16336757704836 23.402655975945876 10-11 25.457278877474316 31.257830117764975 21.799047857679778 21.48584314708093 12-13 24.893510398396394 25.00626409421198 26.058631921824105 24.04159358556753 14-15 23.86619894763217 26.547231270358306 27.875219243297416 21.7113505387121 16-17 25.64874012786762 25.98721323805942 26.739375705152312 21.624670928920647 18-19 25.36958155850664 26.196441994487596 26.55975945878226 21.874216988223502 20-21 24.326356686301544 27.810502569244267 25.71750845970673 22.145632284747464 22-23 24.57988462503135 27.840481565086534 25.595685979433156 21.98394783044896 24-25 24.802606842962778 27.62250908635167 26.319087604963027 21.255796465722522 26-27 24.229516411926834 28.276121272863946 25.833124530192936 21.661237785016286 28-29 24.319919769336842 27.61689858342735 25.899460950231916 22.163720697003885 30-31 25.05017561465128 26.166583040642248 26.85649774209734 21.92674360260913 32-33 24.2728184553661 27.971414242728184 26.04062186559679 21.715145436308926 34-35 24.63949843260188 26.9717868338558 26.106583072100314 22.282131661442005 36-37 24.569993722536097 27.58317639673572 25.98870056497175 21.858129315756432 38-39 24.955996982650237 27.420165954236865 26.074930852401305 21.54890621071159 40-41 25.012581781580273 26.811776547559134 26.509813789632613 21.66582788122798 42-43 24.427384847722124 26.22703246916688 27.359677825320915 21.985904857790082 44-45 25.928724342022413 27.062082861100617 25.450195189522727 21.55899760735424 46-47 24.984266834487098 28.00503461296413 25.92825676526117 21.082441787287603 48-49 24.92462311557789 27.66331658291457 26.319095477386934 21.092964824120603 50-51 24.78331867855797 27.5216681321442 26.328350709709834 21.36666247958799 52-53 25.01885843600704 27.093286396781497 26.640683932612525 21.247171234598945 54-55 24.471565173628587 27.6295923502768 26.925012581781584 20.973829894313035 56-57 23.88022143935581 27.264720684448918 26.71112229491696 22.14393558127831 58-59 25.128979489115387 26.63898326412483 26.63898326412483 21.593053982634956 60-61 25.156995729716154 26.588796784727453 26.927907560914342 21.32629992464205 62-63 24.73280523073054 26.266817553124604 27.03382371432164 21.96655350182321 64-65 25.119557009816262 26.390636798389128 25.83689906871382 22.652907123080794 66-67 24.61306153265383 26.601233169749587 26.827733736001008 21.95797156159557 68-69 25.018848957024375 27.180196029153052 26.011560693641616 21.78939432018095 70-71 25.028255682531707 26.045460253673237 26.371970362928543 22.55431370086651 72-73 24.719384537772733 27.468785471055618 26.964308235590867 20.847521755580782 74-75 24.150892737280174 24.13746811652571 28.07088199758357 23.640757148610554 76 25.69635151039623 0.0 42.64417418595527 31.659474303648487 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 9.0 1 4.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 1.5 21 2.0 22 1.5 23 3.0 24 5.0 25 5.0 26 7.0 27 7.5 28 7.5 29 11.0 30 16.5 31 28.0 32 36.5 33 43.0 34 54.5 35 67.0 36 92.0 37 117.5 38 151.5 39 175.0 40 197.0 41 241.5 42 265.0 43 291.0 44 314.5 45 305.5 46 292.0 47 316.5 48 314.5 49 271.5 50 252.5 51 222.0 52 189.0 53 158.0 54 121.5 55 107.0 56 98.0 57 85.0 58 78.5 59 66.0 60 51.5 61 36.5 62 24.0 63 23.5 64 15.5 65 8.5 66 7.0 67 4.0 68 4.5 69 4.5 70 3.5 71 3.5 72 3.0 73 2.0 74 4.0 75 4.5 76 2.5 77 2.0 78 1.0 79 0.0 80 1.0 81 1.5 82 1.0 83 1.0 84 0.5 85 1.0 86 2.0 87 1.5 88 0.5 89 1.0 90 1.0 91 0.5 92 1.0 93 2.0 94 3.0 95 1.5 96 0.0 97 0.5 98 2.0 99 9.5 100 16.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.3 3 0.22499999999999998 4 0.22499999999999998 5 0.22499999999999998 6 0.22499999999999998 7 0.22499999999999998 8 0.22499999999999998 9 0.22499999999999998 10-11 0.22499999999999998 12-13 0.22499999999999998 14-15 0.22499999999999998 16-17 0.2875 18-19 0.22499999999999998 20-21 0.2625 22-23 0.325 24-25 0.2625 26-27 0.22499999999999998 28-29 0.2875 30-31 0.35000000000000003 32-33 0.3 34-35 0.3125 36-37 0.21297920320721622 38-39 0.33830347074301464 40-41 0.40100250626566414 42-43 0.4260651629072682 44-45 0.45129748025573524 46-47 0.38866599799398194 48-49 0.15052684395383845 50-51 0.13798294029101857 52-53 0.21327311504202737 54-55 0.27603513174404015 56-57 0.27603513174404015 58-59 0.28858218318695106 60-61 0.10037641154328732 62-63 0.18825301204819278 64-65 0.2761044176706827 66-67 0.2635542168674699 68-69 0.12550200803212852 70-71 0.03766005523474768 72-73 0.1511144692104269 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 9.0 36 0.0 37 0.0 38 1.0 39 0.0 40 0.0 41 0.0 42 0.0 43 1.0 44 1.0 45 0.0 46 0.0 47 2.0 48 0.0 49 0.0 50 0.0 51 0.0 52 1.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 1.0 70 0.0 71 4.0 72 17.0 73 84.0 74 307.0 75 1022.0 76 2549.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.975 #Duplication Level Percentage of deduplicated Percentage of total 1 98.7496810410819 96.75 2 1.0206685378923195 2.0 3 0.10206685378923194 0.3 4 0.07655014034192395 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025516713447307986 0.22499999999999998 >10 0.025516713447307986 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 17 0.42500000000000004 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1797785 spots for SRR9668920.sra Written 1797785 spots for SRR9668920.sra Read 1797785 spots for SRR9668920.sra Written 1797785 spots for SRR9668920.sra Read 1797795 spots for SRR9668920.sra Written 1797795 spots for SRR9668920.sra Read 1797785 spots for SRR9668920.sra Written 1797785 spots for SRR9668920.sra Read 1797785 spots for SRR9668920.sra Written 1797785 spots for SRR9668920.sra Read 1797785 spots for SRR9668920.sra Written 1797785 spots for SRR9668920.sra Read 1797785 spots for SRR9668920.sra Written 1797785 spots for SRR9668920.sra Read 1797785 spots for SRR9668920.sra Written 1797785 spots for SRR9668920.sra Read 1797785 spots for SRR9668920.sra Written 1797785 spots for SRR9668920.sra Read 1797785 spots for SRR9668920.sra Written 1797785 spots for SRR9668920.sra Read 1797785 spots for SRR9668920.sra Written 1797785 spots for SRR9668920.sra Read 1797785 spots for SRR9668920.sra Written 1797785 spots for SRR9668920.sra Read 1797785 spots for SRR9668920.sra Written 1797785 spots for SRR9668920.sra Read 1797785 spots for SRR9668920.sra Written 1797785 spots for SRR9668920.sra Read 1797785 spots for SRR9668920.sra Written 1797785 spots for SRR9668920.sra Read 1797785 spots for SRR9668920.sra Written 1797785 spots for SRR9668920.sra Read 1797785 spots for SRR9668920.sra Written 1797785 spots for SRR9668920.sra Read 1797785 spots for SRR9668920.sra Written 1797785 spots for SRR9668920.sra Read 1797785 spots for SRR9668920.sra Written 1797785 spots for SRR9668920.sra Read 1797785 spots for SRR9668920.sra Written 1797785 spots for SRR9668920.sra SRR ids: ['SRR9668920.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gn4dsed6 SRR9668920.sra spots: 35955710 blocks: [[1, 1797785], [1797786, 3595570], [3595571, 5393355], [5393356, 7191140], [7191141, 8988925], [8988926, 10786710], [10786711, 12584495], [12584496, 14382280], [14382281, 16180065], [16180066, 17977850], [17977851, 19775635], [19775636, 21573420], [21573421, 23371205], [23371206, 25168990], [25168991, 26966775], [26966776, 28764560], [28764561, 30562345], [30562346, 32360130], [32360131, 34157915], [34157916, 35955710]] SRR9668920 file size 6825888 SRR9668920 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668920 SRR9668920_1.fastq SRR9668920_2.fastq Input file: SRR9668920_1.fastq Paired file: SRR9668920_2.fastq trimmed: SRR9668920-trimmed-pair1.fastq, SRR9668920-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:52:33 2025 >> started Wed Feb 12 16:53:03 2025 >> done (30.134s) 35955710 read pairs processed; of these: 27 ( 0.00%) short read pairs filtered out after trimming by size control 4565 ( 0.01%) empty read pairs filtered out after trimming by size control 35951118 (99.99%) read pairs available; of these: 6479 ( 0.02%) trimmed read pairs available after processing 35944639 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 21 3 0.00% 22 5 0.00% 23 5 0.00% 24 12 0.00% 25 12 0.00% 26 14 0.00% 27 13 0.00% 28 20 0.00% 29 25 0.00% 30 24 0.00% 31 27 0.00% 32 32 0.00% 33 25 0.00% 34 29 0.00% 35 123 0.00% 36 161 0.00% 37 184 0.00% 38 197 0.00% 39 181 0.00% 40 245 0.00% 41 217 0.00% 42 260 0.00% 43 307 0.00% 44 306 0.00% 45 326 0.00% 46 273 0.00% 47 333 0.00% 48 414 0.00% 49 510 0.00% 50 530 0.00% 51 718 0.00% 52 639 0.00% 53 629 0.00% 54 724 0.00% 55 1076 0.00% 56 1165 0.00% 57 1136 0.00% 58 1315 0.00% 59 1352 0.00% 60 1566 0.00% 61 1498 0.00% 62 1772 0.00% 63 2033 0.01% 64 2109 0.01% 65 2299 0.01% 66 2551 0.01% 67 2956 0.01% 68 2899 0.01% 69 3460 0.01% 70 4921 0.01% 71 7426 0.02% 72 25650 0.07% 73 312098 0.87% 74 2959193 8.23% 75 17421269 48.46% 76 15183851 42.23% 35951118 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=20 prefix-density=0.62 prefix-fanout=2.2 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=20.59 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=4.8 sequence=CCATCTTTCGGCTAACCTAGCCTCCTCCGTCCCTCGGGACCAACAAGGGGTAGTACAGGAATATTCGCCTGTTGTCCATCGACTACGCCTTTCGGCCTGATCTTAGGCCCTGACTCACCCTCCGTGGACGAACCTTGCGGAGGAACCCTTAGGTTTTCGGGGCATTGGATTCTCACCAATGTTTGCGTTACTCAAGCCGACATTCTCGCTTCCGCTTCGTCCACCCCCGCTCGCGCGGGTGCTTCCCTCTAAGCGGAACGCTCCCCTACCGATGCATTTTTACATCCCACAGCTTCGGCAGATCGCTTAGCCCCGTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTATTACGCACTCTTTCAAGGGTGGCTGCTTCTAGGCAAACCTCCTGGCTGTCTCTGCACCCCTACCTCCTTTATCACTGAGCGGTCATTTAGGGGCCTTAGCTGGTGATCCGGGCTGTTTCCCTCTCGACGATGAAGCTTATCCCCCACCGTCTCACTGGC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=26 prefix-density=0.49 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=19.39 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=2.8 sequence=CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR9668920 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:53:32 Started mapping on | Feb 12 16:53:33 Finished on | Feb 12 16:55:23 Mapping speed, Million of reads per hour | 1176.58 Number of input reads | 35951118 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 31239932 Uniquely mapped reads % | 86.90% Average mapped length | 150.41 Number of splices: Total | 13716629 Number of splices: Annotated (sjdb) | 13565473 Number of splices: GT/AG | 13461220 Number of splices: GC/AG | 220160 Number of splices: AT/AC | 9104 Number of splices: Non-canonical | 26145 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.02% Deletion average length | 2.17 Insertion rate per base | 0.01% Insertion average length | 2.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1438384 % of reads mapped to multiple loci | 4.00% Number of reads mapped to too many loci | 1849935 % of reads mapped to too many loci | 5.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.71% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3272851 3272851 3272851 N_multimapping 1438384 1438384 1438384 N_noFeature 1076883 30826351 1201785 N_ambiguous 465881 1815 175742 UnstrandedReadsAssigned:29697168 PositiveStrandReadsAssigned:411766 NegativeStrandReadsAssigned:29862405 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668920 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668920-trimmed-pair1.fastq SRR9668920-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,951,118 reads, 31,964,893 reads pseudoaligned [quant] estimated average fragment length: 197.675 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,277 rounds 52401 SRR9668920.ke.tsv 34699 SRR9668920.se.tsv 87100 total ==> SRR9668920.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1821.33 587 8.60461 Potri.005G024800.1.v4.1 1035 838.325 146 4.64966 Potri.004G059700.1.v4.1 961 764.325 49 1.71159 Potri.007G009000.2.v4.1 1416 1219.33 0 0 Potri.003G141000.2.v4.1 2943 2746.33 509.23 4.95043 Potri.016G087400.1.v4.1 270 91.0771 1950.45 571.751 Potri.015G069301.1.v4.1 564 367.539 0 0 Potri.010G195200.1.v4.1 1773 1576.33 3 0.0508108 Potri.012G127500.1.v4.1 977 780.325 5745 196.56 ==> SRR9668920.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 25 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 483 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 118 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 13 SRR9668920 completed mapping pipeline successfully