Starting /dee2/code/volunteer_pipeline.sh SRR9668921 current disk space = 3052026675200 free memory = 1412915976 SRR9668921 SRAfilesize e393e191c10304264305a28960cbf4c8 SRR9668921.sra SRR9668921.sra file validated SRR9668921 is paired end SRR9668921 is conventional basespace SRR9668921 read1 length is 53-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668921_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 53-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.451 32.0 32.0 32.0 32.0 32.0 2 31.52 32.0 32.0 32.0 32.0 32.0 3 31.53525 32.0 32.0 32.0 32.0 32.0 4 31.53475 32.0 32.0 32.0 32.0 32.0 5 31.6075 32.0 32.0 32.0 32.0 32.0 6 34.6145 36.0 36.0 36.0 36.0 36.0 7 35.18825 36.0 36.0 36.0 36.0 36.0 8 35.03975 36.0 36.0 36.0 36.0 36.0 9 35.09325 36.0 36.0 36.0 36.0 36.0 10-11 35.069 36.0 36.0 36.0 36.0 36.0 12-13 35.074125 36.0 36.0 36.0 36.0 36.0 14-15 35.028625000000005 36.0 36.0 36.0 36.0 36.0 16-17 35.0905 36.0 36.0 36.0 36.0 36.0 18-19 35.163 36.0 36.0 36.0 36.0 36.0 20-21 35.076375 36.0 36.0 36.0 36.0 36.0 22-23 34.965875 36.0 36.0 36.0 36.0 36.0 24-25 34.953 36.0 36.0 36.0 36.0 36.0 26-27 34.8195 36.0 36.0 36.0 34.0 36.0 28-29 34.939125000000004 36.0 36.0 36.0 36.0 36.0 30-31 34.894125 36.0 36.0 36.0 36.0 36.0 32-33 34.784125 36.0 36.0 36.0 32.0 36.0 34-35 34.788375 36.0 36.0 36.0 32.0 36.0 36-37 34.814499999999995 36.0 36.0 36.0 36.0 36.0 38-39 34.8455 36.0 36.0 36.0 36.0 36.0 40-41 34.86575 36.0 36.0 36.0 36.0 36.0 42-43 34.693875 36.0 36.0 36.0 34.0 36.0 44-45 34.73775 36.0 36.0 36.0 36.0 36.0 46-47 34.747875 36.0 36.0 36.0 34.0 36.0 48-49 34.752125 36.0 36.0 36.0 36.0 36.0 50-51 34.644125 36.0 36.0 36.0 32.0 36.0 52-53 34.577375 36.0 36.0 36.0 32.0 36.0 54-55 34.55613903475869 36.0 36.0 36.0 32.0 36.0 56-57 34.52413103275819 36.0 36.0 36.0 32.0 36.0 58-59 34.6072768192048 36.0 36.0 36.0 32.0 36.0 60-61 34.53725931482871 36.0 36.0 36.0 32.0 36.0 62-63 34.297773886943475 36.0 36.0 36.0 32.0 36.0 64-65 34.3511755877939 36.0 36.0 36.0 32.0 36.0 66-67 34.29264632316158 36.0 36.0 36.0 32.0 36.0 68-69 34.30561439378347 36.0 36.0 36.0 32.0 36.0 70-71 34.36486486486487 36.0 36.0 36.0 32.0 36.0 72-73 34.18241199022731 36.0 36.0 36.0 32.0 36.0 74-75 34.19356800025517 36.0 36.0 36.0 32.0 36.0 76 33.39804731505821 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 4.0 23 5.0 24 6.0 25 12.0 26 16.0 27 38.0 28 57.0 29 84.0 30 90.0 31 123.0 32 164.0 33 253.0 34 539.0 35 2609.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.45 13.600000000000001 9.775 38.175 2 21.6 15.825 37.325 25.25 3 18.3 20.7 25.6 35.4 4 21.55 30.5 22.075 25.874999999999996 5 23.225 34.425 23.075000000000003 19.275000000000002 6 19.02228976697062 34.11854103343465 25.937183383991897 20.921985815602838 7 15.575 23.5 41.725 19.2 8 18.55 23.75 31.825 25.874999999999996 9 18.675 22.5 33.4 25.424999999999997 10-11 21.75 31.025000000000002 22.875 24.349999999999998 12-13 21.337500000000002 25.3 27.6625 25.7 14-15 20.3 26.674999999999997 28.050000000000004 24.975 16-17 21.075 27.0875 27.8375 24.0 18-19 20.45 27.5625 26.9125 25.074999999999996 20-21 21.2875 27.6 26.4625 24.65 22-23 20.775 27.762500000000003 27.325 24.1375 24-25 21.0625 27.5125 26.5875 24.837500000000002 26-27 21.3875 26.724999999999998 26.85 25.0375 28-29 20.962500000000002 27.487499999999997 26.625 24.925 30-31 19.9875 27.6 27.037499999999998 25.374999999999996 32-33 21.2625 27.9125 27.0125 23.8125 34-35 21.8875 27.3125 26.35 24.45 36-37 21.0375 27.787499999999998 25.924999999999997 25.25 38-39 21.087500000000002 27.0625 26.4125 25.4375 40-41 20.575 27.8625 26.85 24.712500000000002 42-43 21.3625 28.0875 26.075 24.474999999999998 44-45 21.512500000000003 27.275 27.925 23.2875 46-47 21.4125 27.1625 26.85 24.575 48-49 21.349999999999998 27.025 26.887499999999996 24.7375 50-51 21.8 27.800000000000004 26.7625 23.6375 52-53 22.2125 26.987499999999997 26.5125 24.2875 54-55 21.59289822455614 26.51912978244561 26.556639159789945 25.331332833208304 56-57 21.042760690172543 27.369342335583895 27.719429857464366 23.868467116779193 58-59 20.855213803450862 28.032008002000502 26.79419854963741 24.318579644911228 60-61 21.530382595648913 27.11927981995499 26.831707926981746 24.518629657414355 62-63 21.5607803901951 26.28814407203602 27.5887943971986 24.562281140570285 64-65 21.398199099549775 26.80090045022511 26.8384192096048 24.96248124062031 66-67 21.210605302651324 26.80090045022511 26.88844422211106 25.100050025012504 68-69 21.215911933950462 26.407305479109333 26.932699524643482 25.444083062296723 70-71 21.033533533533532 27.314814814814813 27.84034034034034 23.81131131131131 72-73 20.93695051494599 26.77719166038684 26.990705852800804 25.295151971866364 74-75 21.252973830293417 23.486650806238433 29.28892413428496 25.97145122918319 76 22.944048066090875 0.0 40.030041306796846 37.02591062711228 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 2.5 23 4.0 24 3.5 25 2.5 26 5.5 27 10.5 28 13.0 29 17.5 30 28.5 31 37.0 32 48.5 33 60.0 34 76.5 35 101.0 36 121.0 37 129.5 38 123.0 39 158.0 40 203.0 41 226.5 42 245.5 43 258.5 44 283.0 45 280.0 46 267.0 47 284.5 48 296.5 49 283.5 50 272.0 51 233.0 52 188.5 53 165.0 54 142.0 55 132.0 56 117.0 57 104.0 58 94.5 59 76.5 60 55.0 61 36.0 62 26.5 63 19.5 64 11.5 65 8.5 66 6.0 67 3.5 68 2.0 69 2.0 70 2.0 71 1.0 72 4.0 73 5.0 74 1.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.3 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 2.0 69 0.0 70 0.0 71 4.0 72 22.0 73 67.0 74 240.0 75 1000.0 76 2663.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.16185856522848 96.125 2 1.6339034975746747 3.2 3 0.15317845289762574 0.44999999999999996 4 0.025529742149604292 0.1 5 0.025529742149604292 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668921 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668921_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.11425 32.0 32.0 32.0 32.0 32.0 2 30.97125 32.0 32.0 32.0 32.0 32.0 3 30.94725 32.0 32.0 32.0 32.0 32.0 4 30.94725 32.0 32.0 32.0 32.0 32.0 5 30.885 32.0 32.0 32.0 32.0 32.0 6 34.33175 36.0 36.0 36.0 32.0 36.0 7 34.5705 36.0 36.0 36.0 32.0 36.0 8 34.45625 36.0 36.0 36.0 32.0 36.0 9 34.47325 36.0 36.0 36.0 32.0 36.0 10-11 34.45075 36.0 36.0 36.0 32.0 36.0 12-13 34.417249999999996 36.0 36.0 36.0 32.0 36.0 14-15 34.211375000000004 36.0 36.0 36.0 32.0 36.0 16-17 34.284625000000005 36.0 36.0 36.0 32.0 36.0 18-19 34.253 36.0 36.0 36.0 32.0 36.0 20-21 34.21275 36.0 36.0 36.0 32.0 36.0 22-23 34.083124999999995 36.0 36.0 36.0 32.0 36.0 24-25 34.21875 36.0 36.0 36.0 32.0 36.0 26-27 34.19562500000001 36.0 36.0 36.0 32.0 36.0 28-29 34.135625000000005 36.0 36.0 36.0 32.0 36.0 30-31 33.987875 36.0 36.0 36.0 32.0 36.0 32-33 34.10925 36.0 36.0 36.0 32.0 36.0 34-35 34.027 36.0 36.0 36.0 32.0 36.0 36-37 34.16599799398195 36.0 36.0 36.0 32.0 36.0 38-39 34.02683049147443 36.0 36.0 36.0 32.0 36.0 40-41 33.983575727181545 36.0 36.0 36.0 32.0 36.0 42-43 33.83546912998841 36.0 36.0 36.0 29.5 36.0 44-45 33.781907523443834 36.0 36.0 36.0 27.0 36.0 46-47 33.797439759036145 36.0 36.0 36.0 29.5 36.0 48-49 34.053127354935945 36.0 36.0 36.0 32.0 36.0 50-51 33.76362722933936 36.0 36.0 36.0 27.0 36.0 52-53 33.803441346395374 36.0 36.0 36.0 29.5 36.0 54-55 33.68015075376884 36.0 36.0 36.0 27.0 36.0 56-57 33.78253768844221 36.0 36.0 36.0 32.0 36.0 58-59 33.61494974874372 36.0 36.0 36.0 27.0 36.0 60-61 33.64246231155779 36.0 36.0 36.0 27.0 36.0 62-63 33.65606936416185 36.0 36.0 36.0 27.0 36.0 64-65 33.46494093993466 36.0 36.0 36.0 27.0 36.0 66-67 33.37936667504398 36.0 36.0 36.0 27.0 36.0 68-69 33.454226711108575 36.0 36.0 36.0 27.0 36.0 70-71 33.50326961770624 36.0 36.0 36.0 27.0 36.0 72-73 33.44072301613391 36.0 36.0 36.0 27.0 36.0 74-75 33.483415867053324 36.0 36.0 36.0 27.0 36.0 76 32.37350789372353 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 2.0 15 5.0 16 9.0 17 12.0 18 6.0 19 9.0 20 10.0 21 14.0 22 15.0 23 18.0 24 23.0 25 37.0 26 46.0 27 57.0 28 86.0 29 96.0 30 101.0 31 140.0 32 190.0 33 269.0 34 630.0 35 2212.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.26149208741522 21.878924893242903 12.207987942727957 26.651595076613916 2 29.18444165621079 25.99749058971142 30.58971141781681 14.228356336260978 3 22.993981945837515 26.68004012036108 28.93681043129388 21.389167502507522 4 25.47642928786359 34.87963891675025 20.46138415245737 19.182547642928785 5 25.526579739217652 37.31193580742227 20.46138415245737 16.700100300902708 6 21.890672016048143 36.2086258776329 21.690070210631895 20.21063189568706 7 21.213640922768302 18.58074222668004 38.866599799398195 21.339017051153462 8 21.865596790371114 23.19458375125376 27.50752256770311 27.432296890672013 9 23.846539618856568 23.294884653961887 28.986960882647946 23.8716148445336 10-11 25.36359077231695 30.930290872617856 21.50200601805416 22.204112337011033 12-13 24.899699097291876 24.072216649949848 26.441825476429287 24.586258776328986 14-15 24.423269809428287 27.244232698094283 27.0937813440321 21.238716148445334 16-17 25.731140956445337 26.772938370779464 25.768796284674284 21.727124388100915 18-19 25.050150451354064 27.73319959879639 26.2913741223671 20.925275827482448 20-21 24.200225818592397 27.135867519759127 25.944047170994857 22.71985949065362 22-23 24.50389349409696 27.60612911328812 25.646822406430548 22.243154986184376 24-25 25.191318529670053 26.947685359427926 26.25768410488019 21.60331200602183 26-27 25.075225677031092 27.45737211634905 26.55466399197593 20.91273821464393 28-29 24.71444709426384 27.19969875737417 26.120246014811094 21.965608133550898 30-31 24.532093958045472 27.082024871247327 25.888707448812966 22.497173721894235 32-33 25.37032387647502 27.403966859151392 26.16118503640472 21.064524227968867 34-35 24.924660974384732 27.32295328980412 25.86639879457559 21.88598694123556 36-37 25.282734355365672 27.142498115104296 25.998994722292036 21.575772807238 38-39 24.871117817175907 27.197284043757076 26.00276625172891 21.928831887338113 40-41 24.345417925478348 27.467270896273916 26.14551863041289 22.04179254783484 42-43 24.316492377472596 27.604888496913194 26.521355675948094 21.55726344966612 44-45 24.605877159793163 27.216546853323244 26.056249211754317 22.121326775129273 46-47 24.46433072851021 27.300226871691454 26.077640534408875 22.157801865389462 48-49 25.229415461973602 26.98931489629164 26.26021370207417 21.52105593966059 50-51 25.270168384016085 26.97914048755969 25.97386277959286 21.776828348831366 52-53 24.707657487740477 27.297875015717338 26.455425625550106 21.53904187099208 54-55 24.839481304293088 26.400604305677955 26.904192370640818 21.85572201938814 56-57 24.483366935483872 26.915322580645164 26.44909274193548 22.152217741935484 58-59 25.261433791104952 26.483558019402796 27.05052286758221 21.20448532191004 60-61 25.01571338780641 27.265870521684477 25.7950974230044 21.923318667504716 62-63 25.358490566037734 27.92452830188679 25.82389937106918 20.89308176100629 64-65 25.626495403601563 26.772446795113964 26.722075305377157 20.878982495907316 66-67 26.06724593879864 26.016874449061834 26.58355370860093 21.332325903538596 68-69 25.490936555891235 26.372104733131923 26.649043303121857 21.487915407854985 70-71 24.742138364779876 27.559748427672957 25.559748427672957 22.138364779874216 72-73 24.93057308760414 26.6220651350669 26.521080535218378 21.92628124211058 74-75 25.733118105999463 23.13693839117568 27.21280602636535 23.91713747645951 76 27.11864406779661 0.0 39.21417565485362 33.667180277349765 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 12.0 1 6.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.5 21 5.0 22 4.5 23 2.5 24 2.0 25 5.0 26 6.0 27 6.0 28 5.0 29 3.0 30 11.0 31 26.5 32 38.5 33 46.0 34 53.0 35 68.0 36 85.5 37 96.0 38 134.0 39 181.0 40 227.5 41 250.5 42 240.0 43 259.5 44 281.5 45 297.5 46 300.0 47 324.5 48 331.5 49 268.0 50 225.5 51 210.5 52 193.0 53 157.0 54 131.0 55 121.5 56 105.5 57 86.5 58 73.5 59 68.0 60 60.5 61 43.5 62 29.0 63 24.0 64 12.0 65 8.5 66 9.5 67 6.5 68 6.5 69 6.0 70 5.0 71 4.0 72 2.5 73 4.0 74 3.5 75 1.0 76 1.5 77 3.5 78 4.5 79 3.5 80 2.0 81 1.0 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.5 91 1.0 92 1.0 93 0.5 94 0.5 95 0.5 96 0.0 97 0.5 98 1.0 99 9.5 100 18.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.375 3 0.3 4 0.3 5 0.3 6 0.3 7 0.3 8 0.3 9 0.3 10-11 0.3 12-13 0.3 14-15 0.3 16-17 0.41250000000000003 18-19 0.3 20-21 0.36250000000000004 22-23 0.475 24-25 0.36250000000000004 26-27 0.3 28-29 0.41250000000000003 30-31 0.4875 32-33 0.42500000000000004 34-35 0.44999999999999996 36-37 0.22567703109327986 38-39 0.2883650952858576 40-41 0.4012036108324975 42-43 0.4764890282131662 44-45 0.5019450370184465 46-47 0.426706827309237 48-49 0.08791760864104496 50-51 0.050238633509168545 52-53 0.11303692539562923 54-55 0.2135678391959799 56-57 0.3015075376884422 58-59 0.2889447236180904 60-61 0.06281407035175879 62-63 0.10052777079668257 64-65 0.21362151294295048 66-67 0.21362151294295048 68-69 0.13827781269641734 70-71 0.025150905432595575 72-73 0.0630755645263025 74-75 0.026896180742334585 76 0.03850596842510589 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 12.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 1.0 43 2.0 44 1.0 45 0.0 46 0.0 47 3.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 3.0 69 0.0 70 0.0 71 5.0 72 15.0 73 86.0 74 304.0 75 969.0 76 2597.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.975 #Duplication Level Percentage of deduplicated Percentage of total 1 98.09229182779066 95.125 2 1.5210105697344676 2.9499999999999997 3 0.2577984016499098 0.75 4 0.051559680329981955 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025779840164990978 0.2 9 0.0 0.0 >10 0.051559680329981955 0.775 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 19 0.475 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 12 0.3 No Hit GTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTCG 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1895270 spots for SRR9668921.sra Written 1895270 spots for SRR9668921.sra Read 1895270 spots for SRR9668921.sra Written 1895270 spots for SRR9668921.sra Read 1895270 spots for SRR9668921.sra Written 1895270 spots for SRR9668921.sra Read 1895270 spots for SRR9668921.sra Written 1895270 spots for SRR9668921.sra Read 1895270 spots for SRR9668921.sra Written 1895270 spots for SRR9668921.sra Read 1895270 spots for SRR9668921.sra Written 1895270 spots for SRR9668921.sra Read 1895270 spots for SRR9668921.sra Written 1895270 spots for SRR9668921.sra Read 1895270 spots for SRR9668921.sra Written 1895270 spots for SRR9668921.sra Read 1895270 spots for SRR9668921.sra Written 1895270 spots for SRR9668921.sra Read 1895270 spots for SRR9668921.sra Written 1895270 spots for SRR9668921.sra Read 1895270 spots for SRR9668921.sra Written 1895270 spots for SRR9668921.sra Read 1895270 spots for SRR9668921.sra Written 1895270 spots for SRR9668921.sra Read 1895270 spots for SRR9668921.sra Written 1895270 spots for SRR9668921.sra Read 1895279 spots for SRR9668921.sra Written 1895279 spots for SRR9668921.sra Read 1895270 spots for SRR9668921.sra Written 1895270 spots for SRR9668921.sra Read 1895270 spots for SRR9668921.sra Written 1895270 spots for SRR9668921.sra Read 1895270 spots for SRR9668921.sra Written 1895270 spots for SRR9668921.sra Read 1895270 spots for SRR9668921.sra Written 1895270 spots for SRR9668921.sra Read 1895270 spots for SRR9668921.sra Written 1895270 spots for SRR9668921.sra Read 1895270 spots for SRR9668921.sra Written 1895270 spots for SRR9668921.sra SRR ids: ['SRR9668921.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kuiwufq6 SRR9668921.sra spots: 37905409 blocks: [[1, 1895270], [1895271, 3790540], [3790541, 5685810], [5685811, 7581080], [7581081, 9476350], [9476351, 11371620], [11371621, 13266890], [13266891, 15162160], [15162161, 17057430], [17057431, 18952700], [18952701, 20847970], [20847971, 22743240], [22743241, 24638510], [24638511, 26533780], [26533781, 28429050], [28429051, 30324320], [30324321, 32219590], [32219591, 34114860], [34114861, 36010130], [36010131, 37905409]] SRR9668921 file size 7197006 SRR9668921 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668921 SRR9668921_1.fastq SRR9668921_2.fastq Input file: SRR9668921_1.fastq Paired file: SRR9668921_2.fastq trimmed: SRR9668921-trimmed-pair1.fastq, SRR9668921-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:28:32 2025 >> started Wed Feb 12 16:29:23 2025 >> done (50.888s) 37905409 read pairs processed; of these: 27 ( 0.00%) short read pairs filtered out after trimming by size control 5722 ( 0.02%) empty read pairs filtered out after trimming by size control 37899660 (99.98%) read pairs available; of these: 6994 ( 0.02%) trimmed read pairs available after processing 37892666 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 2 0.00% 21 1 0.00% 22 7 0.00% 23 7 0.00% 24 17 0.00% 25 14 0.00% 26 18 0.00% 27 17 0.00% 28 22 0.00% 29 26 0.00% 30 22 0.00% 31 30 0.00% 32 21 0.00% 33 28 0.00% 34 34 0.00% 35 169 0.00% 36 203 0.00% 37 213 0.00% 38 247 0.00% 39 256 0.00% 40 248 0.00% 41 272 0.00% 42 284 0.00% 43 354 0.00% 44 390 0.00% 45 390 0.00% 46 388 0.00% 47 486 0.00% 48 548 0.00% 49 640 0.00% 50 772 0.00% 51 958 0.00% 52 930 0.00% 53 961 0.00% 54 1114 0.00% 55 1500 0.00% 56 1630 0.00% 57 1655 0.00% 58 1817 0.00% 59 1980 0.01% 60 2282 0.01% 61 2326 0.01% 62 2663 0.01% 63 2946 0.01% 64 3284 0.01% 65 3449 0.01% 66 3814 0.01% 67 4370 0.01% 68 4497 0.01% 69 5157 0.01% 70 6873 0.02% 71 10047 0.03% 72 29632 0.08% 73 323438 0.85% 74 3081864 8.13% 75 18298289 48.28% 76 16096056 42.47% 37899660 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=16 prefix-density=0.60 prefix-fanout=2.2 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=14.99 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=3.5 sequence=CCATCTTTCGGCTAACCTAGCCTCCTCCGTCCCTCGGGACCAACAAGGGGTAGTACAGGAATATTCGCCTGTTGTCCATCGACTACGCCTTTCGGCCTGATCTTAGGCCCTGACTCACCCTCCGTGGACGAACCTTGCGGAGGAACCCTTAGGTTTTCGGGGCATTGGATTCTCACCAATGTTTGCGTTACTCAAGCCGACATTCTCGCTTCCGCTTCGTCCACCCCCGCTCGCGCGGGTGCTTCCCTCTAAGCGGAACGCTCCCCTACCGATGCATTTTTACATCCCACAGCTTCGGCAGATCGCTTAGCCCCGTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTATTACGCACTCTTTCAAGGGTGGCTGCTTCTAGGCAAACCTCCTGGCTGTCTCTGCACCCCTACCTCCTTTATCACTGAGCGGTCATTTAGGGGCCTTAGCTGGTGATCCGGGCTGTTTCCCTCTCGACGATGAAGCTTATCCCCCACCGTCTCACTGGC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=28 prefix-density=0.38 prefix-fanout=2.0 sequence=CCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=31.46 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.5 sequence=TGCAGATCTTGGTGGTAGTAGCAAATATTCAAATGAGAACTTTGAAGGCCGAAGAGGGGAAAGGTTCCATGTGAACGGCACTTGCACATGGGTTAGTCGATCCTAAGAGACGGGGGAAGCCCGTCCGACAGCGCGTTCGCGCGCGAGCTTCGAAAGGGAATCGGGTTAAAATTCCTGAACCGGGACGTGGCGGCTGACGGCAACGTTAGGGAGTCCGGAGACGTCGGCGGGGGCCTCGGGAAGAGTTATCTTTTCTGTTTAACAGCCCGCCCACCCTGGAAACGACTTAGTCGGAGGTAGGGTCCAGCGGCTGGAAGAGCACCGCACGTCGCGTGGTGTCCGGTGCGCCCCCGGCGGCCCTTGAAAATCCGGAGGACCGAGTGCCTCCCACGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAACAGCCTCTGGTCGATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTCGGGAAAAGGATTGGCTCT SRR9668921 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:29:59 Started mapping on | Feb 12 16:30:00 Finished on | Feb 12 16:33:23 Mapping speed, Million of reads per hour | 672.11 Number of input reads | 37899660 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 31402649 Uniquely mapped reads % | 82.86% Average mapped length | 150.37 Number of splices: Total | 13481562 Number of splices: Annotated (sjdb) | 13332461 Number of splices: GT/AG | 13234898 Number of splices: GC/AG | 210688 Number of splices: AT/AC | 9061 Number of splices: Non-canonical | 26915 Mismatch rate per base, % | 0.49% Deletion rate per base | 0.02% Deletion average length | 2.17 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1536381 % of reads mapped to multiple loci | 4.05% Number of reads mapped to too many loci | 3161209 % of reads mapped to too many loci | 8.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.35% % of reads unmapped: other | 0.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4960698 4960698 4960698 N_multimapping 1536381 1536381 1536381 N_noFeature 1403654 30955807 1531048 N_ambiguous 498889 1981 177862 UnstrandedReadsAssigned:29500106 PositiveStrandReadsAssigned:444861 NegativeStrandReadsAssigned:29693739 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668921 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668921-trimmed-pair1.fastq SRR9668921-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,899,660 reads, 32,653,784 reads pseudoaligned [quant] estimated average fragment length: 196.003 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,189 rounds 52401 SRR9668921.ke.tsv 34699 SRR9668921.se.tsv 87100 total ==> SRR9668921.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1823 599 8.22851 Potri.005G024800.1.v4.1 1035 839.997 202.023 6.02286 Potri.004G059700.1.v4.1 961 765.997 72 2.35389 Potri.007G009000.2.v4.1 1416 1221 0 0 Potri.003G141000.2.v4.1 2943 2748 539.243 4.91415 Potri.016G087400.1.v4.1 270 93.0406 2162.46 582.043 Potri.015G069301.1.v4.1 564 369.288 0 0 Potri.010G195200.1.v4.1 1773 1578 7 0.111089 Potri.012G127500.1.v4.1 977 781.997 9230 295.581 ==> SRR9668921.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 34 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 522 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 145 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 25 SRR9668921 completed mapping pipeline successfully