Starting /dee2/code/volunteer_pipeline.sh SRR9668922 current disk space = 3051810951168 free memory = 1580744116 SRR9668922 SRAfilesize 5fb1e561d5ebd9c14401afc9d11b145c SRR9668922.sra SRR9668922.sra file validated SRR9668922 is paired end SRR9668922 is conventional basespace SRR9668922 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668922_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.46175 32.0 32.0 32.0 32.0 32.0 2 31.49325 32.0 32.0 32.0 32.0 32.0 3 31.54525 32.0 32.0 32.0 32.0 32.0 4 31.59275 32.0 32.0 32.0 32.0 32.0 5 31.55075 32.0 32.0 32.0 32.0 32.0 6 34.62425 36.0 36.0 36.0 36.0 36.0 7 35.13375 36.0 36.0 36.0 36.0 36.0 8 35.21225 36.0 36.0 36.0 36.0 36.0 9 35.2735 36.0 36.0 36.0 36.0 36.0 10-11 35.12675 36.0 36.0 36.0 36.0 36.0 12-13 35.160375 36.0 36.0 36.0 36.0 36.0 14-15 35.109125 36.0 36.0 36.0 36.0 36.0 16-17 35.187124999999995 36.0 36.0 36.0 36.0 36.0 18-19 35.13825 36.0 36.0 36.0 36.0 36.0 20-21 35.1635 36.0 36.0 36.0 36.0 36.0 22-23 35.016625 36.0 36.0 36.0 36.0 36.0 24-25 35.027875 36.0 36.0 36.0 36.0 36.0 26-27 35.0185 36.0 36.0 36.0 36.0 36.0 28-29 35.02375000000001 36.0 36.0 36.0 36.0 36.0 30-31 35.006 36.0 36.0 36.0 36.0 36.0 32-33 34.929 36.0 36.0 36.0 36.0 36.0 34-35 34.946124999999995 36.0 36.0 36.0 36.0 36.0 36-37 34.927606901725426 36.0 36.0 36.0 36.0 36.0 38-39 34.92948237059265 36.0 36.0 36.0 36.0 36.0 40-41 34.90510127531883 36.0 36.0 36.0 36.0 36.0 42-43 34.80332583145787 36.0 36.0 36.0 36.0 36.0 44-45 34.82733183295824 36.0 36.0 36.0 36.0 36.0 46-47 34.792323080770196 36.0 36.0 36.0 32.0 36.0 48-49 34.87271817954489 36.0 36.0 36.0 36.0 36.0 50-51 34.736559139784944 36.0 36.0 36.0 34.0 36.0 52-53 34.7966991747937 36.0 36.0 36.0 34.0 36.0 54-55 34.64282141070535 36.0 36.0 36.0 32.0 36.0 56-57 34.61993496748374 36.0 36.0 36.0 32.0 36.0 58-59 34.69159579789895 36.0 36.0 36.0 32.0 36.0 60-61 34.572411205602805 36.0 36.0 36.0 32.0 36.0 62-63 34.53776888444222 36.0 36.0 36.0 32.0 36.0 64-65 34.45459094320741 36.0 36.0 36.0 32.0 36.0 66-67 34.391043282461844 36.0 36.0 36.0 32.0 36.0 68-69 34.3725341607573 36.0 36.0 36.0 32.0 36.0 70-71 34.41815881951732 36.0 36.0 36.0 32.0 36.0 72-73 34.347292508360304 36.0 36.0 36.0 32.0 36.0 74-75 34.31563026726811 36.0 36.0 36.0 32.0 36.0 76 33.53052550231839 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 2.0 23 4.0 24 5.0 25 13.0 26 20.0 27 25.0 28 44.0 29 64.0 30 94.0 31 135.0 32 156.0 33 189.0 34 555.0 35 2693.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.73393348337085 13.928482120530134 9.602400600150037 40.735183795948984 2 21.580395098774694 16.15403850962741 38.38459614903726 23.88097024256064 3 19.004751187796952 19.70492623155789 27.231807951987996 34.058514628657164 4 22.230557639409852 28.882220555138783 22.980745186296573 25.906476619154787 5 22.605651412853213 35.00875218804701 22.230557639409852 20.155038759689923 6 18.645357686453575 36.07305936073059 24.200913242009133 21.080669710806696 7 14.95373843460865 23.80595148787197 43.03575893973493 18.204551137784446 8 18.404601150287572 23.95598899724931 31.50787696924231 26.131532883220803 9 17.27931982995749 23.905976494123532 33.28332083020755 25.531382845711427 10-11 21.305326331582897 33.00825206301575 23.0432608152038 22.643160790197552 12-13 20.955238809702426 26.344086021505376 27.806951737934483 24.893723430857715 14-15 20.117529382345587 26.344086021505376 28.59464866216554 24.943735933983497 16-17 21.092773193298324 26.469117279319832 27.969492373093274 24.468617154288573 18-19 20.455113778444613 28.382095523880967 27.431857964491122 23.730932733183295 20-21 20.492623155788948 27.181795448862218 27.91947986996749 24.406101525381345 22-23 20.84271067766942 27.106776694173547 27.44436109027257 24.60615153788447 24-25 20.320120045016882 27.58534450418907 27.64786795048143 24.446667500312618 26-27 21.580395098774694 27.46936734183546 27.206801700425103 23.74343585896474 28-29 21.392848212053014 28.33208302075519 25.818954738684667 24.456114028507127 30-31 20.355088772193046 27.769442360590148 27.219304826206553 24.656164041010253 32-33 20.580145036259065 27.33183295823956 27.819454863715933 24.268567141785446 34-35 20.91772943235809 27.156789197299325 27.00675168792198 24.918729682420604 36-37 20.955238809702426 27.19429857464366 27.019254813703427 24.831207801950487 38-39 20.21755438859715 27.569392348087025 26.944236059014752 25.268817204301076 40-41 20.930232558139537 28.219554888722183 25.993998499624904 24.85621405351338 42-43 20.05501375343836 27.806951737934483 26.894223555888974 25.243810952738183 44-45 21.342835708927232 26.344086021505376 27.981995498874717 24.33108277069267 46-47 20.43010752688172 28.294573643410853 26.79419854963741 24.48112028007002 48-49 21.10527631907977 26.756689172293076 26.806701675418854 25.331332833208304 50-51 20.767691922980745 28.19454863715929 26.556639159789945 24.48112028007002 52-53 21.842960740185045 26.944236059014752 26.86921730432608 24.343585896474117 54-55 21.11055527763882 27.41370685342671 27.113556778389196 24.362181090545274 56-57 21.14807403701851 27.52626313156578 26.750875437718857 24.574787393696848 58-59 21.61080540270135 27.43871935967984 26.550775387693847 24.399699849924964 60-61 21.72336168084042 26.650825412706354 26.688344172086044 24.937468734367183 62-63 20.96048024012006 26.675837918959477 27.75137568784392 24.61230615307654 64-65 21.165874405804352 27.970978233675257 26.782586940205157 24.080560420315237 66-67 20.41531148361271 27.220415311483613 27.395546659994995 24.96872654490868 68-69 20.891225434973087 27.17486543997997 27.012141694830394 24.921767430216548 70-71 20.95178459611772 27.276142767689414 27.41390106449593 24.358171571696932 72-73 20.39994969186266 27.32989561061502 26.952584580555904 25.31757011696642 74-75 21.086985480218463 23.151725056613827 28.733182363127746 27.02810710003996 76 22.179289026275114 0.0 39.64451313755796 38.17619783616693 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 2.0 22 2.5 23 2.5 24 3.0 25 3.5 26 7.0 27 13.0 28 16.5 29 18.0 30 23.5 31 39.5 32 53.0 33 49.0 34 60.0 35 87.0 36 114.0 37 135.0 38 148.0 39 178.0 40 210.5 41 245.0 42 271.0 43 272.5 44 275.5 45 290.5 46 305.0 47 315.5 48 314.0 49 283.0 50 261.0 51 231.0 52 186.5 53 168.0 54 159.5 55 133.5 56 102.0 57 84.0 58 67.0 59 54.5 60 40.0 61 24.0 62 17.5 63 15.5 64 11.5 65 9.0 66 5.0 67 1.0 68 2.0 69 1.5 70 1.0 71 2.0 72 3.5 73 4.5 74 3.0 75 1.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 1.4500000000000002 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.0375 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 1.0 64 0.0 65 0.0 66 0.0 67 1.0 68 3.0 69 0.0 70 1.0 71 4.0 72 25.0 73 83.0 74 253.0 75 1039.0 76 2588.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.4505969011938 96.89999999999999 2 1.4986029972059944 2.9499999999999997 3 0.05080010160020319 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668922 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668922_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.16 32.0 32.0 32.0 32.0 32.0 2 30.95 32.0 32.0 32.0 32.0 32.0 3 30.997 32.0 32.0 32.0 32.0 32.0 4 30.87725 32.0 32.0 32.0 32.0 32.0 5 30.971 32.0 32.0 32.0 32.0 32.0 6 34.45725 36.0 36.0 36.0 32.0 36.0 7 34.533 36.0 36.0 36.0 32.0 36.0 8 34.43425 36.0 36.0 36.0 32.0 36.0 9 34.4685 36.0 36.0 36.0 32.0 36.0 10-11 34.397125 36.0 36.0 36.0 32.0 36.0 12-13 34.393625 36.0 36.0 36.0 32.0 36.0 14-15 34.302625000000006 36.0 36.0 36.0 32.0 36.0 16-17 34.30775 36.0 36.0 36.0 32.0 36.0 18-19 34.361000000000004 36.0 36.0 36.0 32.0 36.0 20-21 34.27075 36.0 36.0 36.0 32.0 36.0 22-23 34.2705 36.0 36.0 36.0 32.0 36.0 24-25 34.316875 36.0 36.0 36.0 32.0 36.0 26-27 34.197 36.0 36.0 36.0 32.0 36.0 28-29 34.164375 36.0 36.0 36.0 32.0 36.0 30-31 34.13125 36.0 36.0 36.0 32.0 36.0 32-33 34.207499999999996 36.0 36.0 36.0 32.0 36.0 34-35 34.079125000000005 36.0 36.0 36.0 32.0 36.0 36-37 34.0944931163955 36.0 36.0 36.0 32.0 36.0 38-39 33.94278736628096 36.0 36.0 36.0 32.0 36.0 40-41 33.89321482223335 36.0 36.0 36.0 32.0 36.0 42-43 33.78301179542918 36.0 36.0 36.0 29.5 36.0 44-45 33.72054193884095 36.0 36.0 36.0 27.0 36.0 46-47 33.782276259714216 36.0 36.0 36.0 29.5 36.0 48-49 33.89744232698094 36.0 36.0 36.0 29.5 36.0 50-51 33.839769307923774 36.0 36.0 36.0 29.5 36.0 52-53 33.75175526579739 36.0 36.0 36.0 29.5 36.0 54-55 33.62891898670679 36.0 36.0 36.0 27.0 36.0 56-57 33.608602959618764 36.0 36.0 36.0 27.0 36.0 58-59 33.556433408577874 36.0 36.0 36.0 27.0 36.0 60-61 33.629644707498166 36.0 36.0 36.0 27.0 36.0 62-63 33.47100903614458 36.0 36.0 36.0 27.0 36.0 64-65 33.4185287471755 36.0 36.0 36.0 27.0 36.0 66-67 33.33668089379864 36.0 36.0 36.0 27.0 36.0 68-69 33.521667870905134 36.0 36.0 36.0 27.0 36.0 70-71 33.44240109111243 36.0 36.0 36.0 27.0 36.0 72-73 33.507468910309306 36.0 36.0 36.0 27.0 36.0 74-75 33.4853667795645 36.0 36.0 36.0 27.0 36.0 76 32.513439813011296 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 4.0 15 3.0 16 4.0 17 11.0 18 9.0 19 6.0 20 11.0 21 18.0 22 23.0 23 19.0 24 24.0 25 36.0 26 46.0 27 53.0 28 71.0 29 109.0 30 100.0 31 140.0 32 201.0 33 299.0 34 621.0 35 2186.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.45636910732197 20.712136409227682 12.938816449348046 30.892678034102307 2 28.98296593186373 25.726452905811627 31.087174348697395 14.203406813627254 3 22.909364046069104 25.98898347521282 28.96845267901853 22.13319979969955 4 23.90488110137672 32.94117647058823 22.22778473091364 20.926157697121404 5 26.357947434292868 35.96996245306634 21.551939924906133 16.12015018773467 6 21.476846057571965 37.196495619524406 21.60200250312891 19.72465581977472 7 21.201501877346686 20.275344180225282 38.17271589486859 20.35043804755945 8 21.67709637046308 23.404255319148938 27.083854818523157 27.83479349186483 9 22.703379224030037 24.20525657071339 28.961201501877348 24.130162703379224 10-11 25.53191489361702 31.6270337922403 21.78973717146433 21.051314142678347 12-13 24.780976220275345 25.344180225281605 26.9837296620776 22.891113892365457 14-15 25.134560020027536 26.486418825885593 26.761797471523348 21.617223682563523 16-17 24.110721442885772 28.1187374749499 25.80160320641283 21.968937875751504 18-19 24.58072590738423 27.672090112640802 25.982478097622025 21.764705882352942 20-21 23.5728592889334 27.766649974962444 27.02804206309464 21.632448673009513 22-23 24.85585359739283 26.67335171722236 25.620456254700425 22.850338430684385 24-25 24.336504757135703 27.391086629944915 26.43965948923385 21.832749123685527 26-27 24.69336670838548 27.271589486858574 26.195244055068834 21.83979974968711 28-29 24.07314629258517 28.181362725450903 25.851703406813627 21.8937875751503 30-31 23.83939774153074 27.1267252195734 26.57465495608532 22.45922208281054 32-33 24.242424242424242 27.923866766841975 25.93288254445279 21.90082644628099 34-35 25.626566416040102 26.14035087719298 26.39097744360902 21.842105263157897 36-37 24.500816275273138 27.64033655657416 26.434760768554565 21.424086399598142 38-39 24.12534608608105 26.931789579662723 26.17669267556003 22.766171658696198 40-41 24.93382074877096 28.072608092777006 25.677549476868776 21.316021681583262 42-43 24.350567465321564 27.704918032786885 25.75031525851198 22.194199243379572 44-45 24.441640378548897 27.11671924290221 26.53627760252366 21.905362776025235 46-47 24.43239152371342 26.866801210898082 26.47578203834511 22.22502522704339 48-49 24.405884571859676 25.927323022758706 27.058971457311703 22.60782094806991 50-51 24.971708789136173 27.44876147365774 26.669181440965673 20.910348296240414 52-53 24.310713836082083 27.634395064836966 26.690167443031598 21.36472365604935 54-55 24.48619341823225 27.436641028874035 25.684024713150926 22.39314083974278 56-57 24.785570131180627 27.661453077699292 25.93340060544904 21.61957618567104 58-59 24.92749968478124 27.360988526037072 26.49098474341193 21.220527045769764 60-61 24.57264957264957 26.97335344394168 26.030668677727505 22.42332830568125 62-63 24.782882315921963 27.287602265575835 25.865324103209563 22.064191315292636 64-65 24.924318869828458 27.320887991927346 26.236125126135217 21.51866801210898 66-67 24.268415741675074 27.40918264379415 26.210898082744706 22.111503531786074 68-69 24.66943709860219 27.23838307517945 26.35688200478529 21.73529782143307 70-71 24.86173956762192 26.84766214177979 26.910507792860734 21.380090497737555 72-73 24.879838097647355 26.600050594485204 27.017455097394382 21.50265621047306 74-75 24.670610379134175 24.294165098144664 27.816617370260822 23.21860715246034 76 26.81215900233827 0.0 40.33515198752923 32.8526890101325 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 1.0 16 1.0 17 1.0 18 1.0 19 0.5 20 1.0 21 3.5 22 4.0 23 4.0 24 6.5 25 6.5 26 5.5 27 6.0 28 9.5 29 14.5 30 16.5 31 27.5 32 38.0 33 34.0 34 46.5 35 74.0 36 91.0 37 108.5 38 134.5 39 174.0 40 203.0 41 239.5 42 274.0 43 292.5 44 325.5 45 329.0 46 317.5 47 318.0 48 301.0 49 280.5 50 265.5 51 224.5 52 184.5 53 148.0 54 119.5 55 124.0 56 108.0 57 74.5 58 65.5 59 58.0 60 41.5 61 39.0 62 40.5 63 26.5 64 12.5 65 11.5 66 8.0 67 3.0 68 5.5 69 5.0 70 3.0 71 3.5 72 5.0 73 6.0 74 4.0 75 3.0 76 1.5 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 9.5 100 19.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.2 3 0.15 4 0.125 5 0.125 6 0.125 7 0.125 8 0.125 9 0.125 10-11 0.125 12-13 0.125 14-15 0.13749999999999998 16-17 0.2 18-19 0.125 20-21 0.15 22-23 0.27499999999999997 24-25 0.15 26-27 0.125 28-29 0.2 30-31 0.375 32-33 0.17500000000000002 34-35 0.25 36-37 0.3379224030037547 38-39 0.5382400801101515 40-41 0.6885327991987983 42-43 0.7136596970076374 44-45 0.6892230576441103 46-47 0.6267234895963901 48-49 0.2883650952858576 50-51 0.2883650952858576 52-53 0.41374122367101307 54-55 0.5392525708552797 56-57 0.5768748432405317 58-59 0.5392525708552797 60-61 0.18818216033120058 62-63 0.28865461847389556 64-65 0.4770273663068039 66-67 0.4770273663068039 68-69 0.2762777847544895 70-71 0.06280618012812461 72-73 0.17676767676767677 74-75 0.040317161671818307 76 0.038955979742890535 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 5.0 36 0.0 37 0.0 38 1.0 39 0.0 40 0.0 41 0.0 42 1.0 43 2.0 44 2.0 45 0.0 46 0.0 47 1.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 3.0 61 0.0 62 0.0 63 1.0 64 0.0 65 0.0 66 0.0 67 1.0 68 1.0 69 0.0 70 1.0 71 6.0 72 28.0 73 92.0 74 267.0 75 1020.0 76 2567.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.15 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85379521141111 97.02499999999999 2 0.9169638308711157 1.7999999999999998 3 0.10188487009679062 0.3 4 0.07641365257259297 0.3 5 0.025471217524197655 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025471217524197655 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 18 0.44999999999999996 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1838308 spots for SRR9668922.sra Written 1838308 spots for SRR9668922.sra Read 1838308 spots for SRR9668922.sra Written 1838308 spots for SRR9668922.sra Read 1838308 spots for SRR9668922.sra Written 1838308 spots for SRR9668922.sra Read 1838308 spots for SRR9668922.sra Written 1838308 spots for SRR9668922.sra Read 1838308 spots for SRR9668922.sra Written 1838308 spots for SRR9668922.sra Read 1838308 spots for SRR9668922.sra Written 1838308 spots for SRR9668922.sra Read 1838308 spots for SRR9668922.sra Written 1838308 spots for SRR9668922.sra Read 1838308 spots for SRR9668922.sra Written 1838308 spots for SRR9668922.sra Read 1838308 spots for SRR9668922.sra Written 1838308 spots for SRR9668922.sra Read 1838308 spots for SRR9668922.sra Written 1838308 spots for SRR9668922.sra Read 1838308 spots for SRR9668922.sra Written 1838308 spots for SRR9668922.sra Read 1838308 spots for SRR9668922.sra Written 1838308 spots for SRR9668922.sra Read 1838308 spots for SRR9668922.sra Written 1838308 spots for SRR9668922.sra Read 1838308 spots for SRR9668922.sra Written 1838308 spots for SRR9668922.sra Read 1838308 spots for SRR9668922.sra Written 1838308 spots for SRR9668922.sra Read 1838308 spots for SRR9668922.sra Written 1838308 spots for SRR9668922.sra Read 1838308 spots for SRR9668922.sra Written 1838308 spots for SRR9668922.sra Read 1838322 spots for SRR9668922.sra Written 1838322 spots for SRR9668922.sra Read 1838308 spots for SRR9668922.sra Written 1838308 spots for SRR9668922.sra Read 1838308 spots for SRR9668922.sra Written 1838308 spots for SRR9668922.sra SRR ids: ['SRR9668922.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4io8ivyi SRR9668922.sra spots: 36766174 blocks: [[1, 1838308], [1838309, 3676616], [3676617, 5514924], [5514925, 7353232], [7353233, 9191540], [9191541, 11029848], [11029849, 12868156], [12868157, 14706464], [14706465, 16544772], [16544773, 18383080], [18383081, 20221388], [20221389, 22059696], [22059697, 23898004], [23898005, 25736312], [25736313, 27574620], [27574621, 29412928], [29412929, 31251236], [31251237, 33089544], [33089545, 34927852], [34927853, 36766174]] SRR9668922 file size 6979903 SRR9668922 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668922 SRR9668922_1.fastq SRR9668922_2.fastq Input file: SRR9668922_1.fastq Paired file: SRR9668922_2.fastq trimmed: SRR9668922-trimmed-pair1.fastq, SRR9668922-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:28:51 2025 >> started Wed Feb 12 17:29:22 2025 >> done (31.221s) 36766174 read pairs processed; of these: 19 ( 0.00%) short read pairs filtered out after trimming by size control 11158 ( 0.03%) empty read pairs filtered out after trimming by size control 36754997 (99.97%) read pairs available; of these: 7251 ( 0.02%) trimmed read pairs available after processing 36747746 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 2 0.00% 21 8 0.00% 22 5 0.00% 23 9 0.00% 24 14 0.00% 25 19 0.00% 26 24 0.00% 27 34 0.00% 28 35 0.00% 29 40 0.00% 30 42 0.00% 31 36 0.00% 32 52 0.00% 33 66 0.00% 34 67 0.00% 35 183 0.00% 36 217 0.00% 37 238 0.00% 38 239 0.00% 39 267 0.00% 40 283 0.00% 41 303 0.00% 42 357 0.00% 43 357 0.00% 44 424 0.00% 45 391 0.00% 46 367 0.00% 47 491 0.00% 48 630 0.00% 49 653 0.00% 50 840 0.00% 51 925 0.00% 52 1016 0.00% 53 997 0.00% 54 1097 0.00% 55 1426 0.00% 56 1643 0.00% 57 1531 0.00% 58 1805 0.00% 59 1890 0.01% 60 2218 0.01% 61 2127 0.01% 62 2475 0.01% 63 2698 0.01% 64 2818 0.01% 65 3046 0.01% 66 3227 0.01% 67 3733 0.01% 68 3706 0.01% 69 4298 0.01% 70 5464 0.01% 71 7836 0.02% 72 26795 0.07% 73 320612 0.87% 74 3022882 8.22% 75 17777022 48.37% 76 15545014 42.29% 36754997 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=22 prefix-density=0.54 prefix-fanout=2.2 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=47.25 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.3 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCATAAGGGAAGGACATGAGGCCCTTAATTCCACCACAGGCGCTGTGTCCAATGACCACAATGTATT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=26 prefix-density=0.42 prefix-fanout=1.9 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=28.88 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.0 sequence=TGCAGATCTTGGTGGTAGTAGCAAATATTCAAATGAGAACTTTGAAGGCCGAAGAGGGGAAAGGTTCCATGTGAACGGCACTTGCACATGGGTTAGTCGATCCTAAGAGACGGGGGAAGCCCGTCCGACAGCGCGTTCGCGCGCGAGCTTCGAAAGGGAATCGGGTTAAAATTCCTGAACCGGGACGTGGCGGCTGACGGCAACGTTAGGGAGTCCGGAGACGTCGGCGGGGGCCTCGGGAAGAGTTATCTTTTCTGTTTAACAGCCCGCCCACCCTGGAAACGACTTAGTCGGAGGTAGGGTCCAGCGGCTGGAAGAGCACCGCACGTCGCGTGGTGTCCGGTGCGCCCCCGGCGGCCCTTGAAAATCCGGAGGACCGAGTGCCTCCCACGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAACAGCCTCTGGTCGATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTCGGGAAAAGGATTGGCTCT SRR9668922 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:29:49 Started mapping on | Feb 12 17:29:49 Finished on | Feb 12 17:31:45 Mapping speed, Million of reads per hour | 1140.67 Number of input reads | 36754997 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 31940898 Uniquely mapped reads % | 86.90% Average mapped length | 150.39 Number of splices: Total | 14041097 Number of splices: Annotated (sjdb) | 13881637 Number of splices: GT/AG | 13791456 Number of splices: GC/AG | 211698 Number of splices: AT/AC | 9722 Number of splices: Non-canonical | 28221 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.02% Deletion average length | 2.19 Insertion rate per base | 0.01% Insertion average length | 1.96 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1431175 % of reads mapped to multiple loci | 3.89% Number of reads mapped to too many loci | 2080229 % of reads mapped to too many loci | 5.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.28% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3382966 3382966 3382966 N_multimapping 1431175 1431175 1431175 N_noFeature 859903 31538428 982140 N_ambiguous 467531 1764 185945 UnstrandedReadsAssigned:30613464 PositiveStrandReadsAssigned:400706 NegativeStrandReadsAssigned:30772813 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668922 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668922-trimmed-pair1.fastq SRR9668922-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,754,997 reads, 33,013,925 reads pseudoaligned [quant] estimated average fragment length: 208.592 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,066 rounds 52401 SRR9668922.ke.tsv 34699 SRR9668922.se.tsv 87100 total ==> SRR9668922.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1810.41 735 10.0978 Potri.005G024800.1.v4.1 1035 827.408 239 7.18447 Potri.004G059700.1.v4.1 961 753.408 96 3.16926 Potri.007G009000.2.v4.1 1416 1208.41 0 0 Potri.003G141000.2.v4.1 2943 2735.41 694.131 6.31155 Potri.016G087400.1.v4.1 270 83.9539 2496.47 739.609 Potri.015G069301.1.v4.1 564 356.689 0 0 Potri.010G195200.1.v4.1 1773 1565.41 24 0.38133 Potri.012G127500.1.v4.1 977 769.408 12843 415.171 ==> SRR9668922.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 79 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 603 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 167 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 37 SRR9668922 completed mapping pipeline successfully