Starting /dee2/code/volunteer_pipeline.sh SRR9668924 current disk space = 3051949690880 free memory = 1057367012 SRR9668924 SRAfilesize 064d1809830f76aaffb3237d1d721288 SRR9668924.sra SRR9668924.sra file validated SRR9668924 is paired end SRR9668924 is conventional basespace SRR9668924 read1 length is 61-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668924_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 61-76 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.42775 32.0 32.0 32.0 32.0 32.0 2 31.48975 32.0 32.0 32.0 32.0 32.0 3 31.57175 32.0 32.0 32.0 32.0 32.0 4 31.557 32.0 32.0 32.0 32.0 32.0 5 31.637 32.0 32.0 32.0 32.0 32.0 6 34.825 36.0 36.0 36.0 36.0 36.0 7 35.20575 36.0 36.0 36.0 36.0 36.0 8 35.2065 36.0 36.0 36.0 36.0 36.0 9 35.22625 36.0 36.0 36.0 36.0 36.0 10-11 35.15625 36.0 36.0 36.0 36.0 36.0 12-13 35.12575 36.0 36.0 36.0 36.0 36.0 14-15 35.22175 36.0 36.0 36.0 36.0 36.0 16-17 35.172625 36.0 36.0 36.0 36.0 36.0 18-19 35.204 36.0 36.0 36.0 36.0 36.0 20-21 35.16925 36.0 36.0 36.0 36.0 36.0 22-23 35.096374999999995 36.0 36.0 36.0 36.0 36.0 24-25 35.134 36.0 36.0 36.0 36.0 36.0 26-27 35.01375 36.0 36.0 36.0 36.0 36.0 28-29 35.041875000000005 36.0 36.0 36.0 36.0 36.0 30-31 35.043375 36.0 36.0 36.0 36.0 36.0 32-33 34.990875 36.0 36.0 36.0 36.0 36.0 34-35 34.98425 36.0 36.0 36.0 36.0 36.0 36-37 34.88825 36.0 36.0 36.0 36.0 36.0 38-39 34.969125 36.0 36.0 36.0 36.0 36.0 40-41 34.945125000000004 36.0 36.0 36.0 36.0 36.0 42-43 34.84375 36.0 36.0 36.0 36.0 36.0 44-45 34.899625 36.0 36.0 36.0 36.0 36.0 46-47 34.8145 36.0 36.0 36.0 34.0 36.0 48-49 34.843 36.0 36.0 36.0 36.0 36.0 50-51 34.783500000000004 36.0 36.0 36.0 34.0 36.0 52-53 34.765 36.0 36.0 36.0 34.0 36.0 54-55 34.73775 36.0 36.0 36.0 32.0 36.0 56-57 34.639624999999995 36.0 36.0 36.0 32.0 36.0 58-59 34.688500000000005 36.0 36.0 36.0 32.0 36.0 60-61 34.70375 36.0 36.0 36.0 32.0 36.0 62-63 34.58239559889972 36.0 36.0 36.0 32.0 36.0 64-65 34.41660415103776 36.0 36.0 36.0 32.0 36.0 66-67 34.45366481690458 36.0 36.0 36.0 32.0 36.0 68-69 34.451975987994 36.0 36.0 36.0 32.0 36.0 70-71 34.42883941970985 36.0 36.0 36.0 32.0 36.0 72-73 34.43767385377241 36.0 36.0 36.0 32.0 36.0 74-75 34.32589477222501 36.0 36.0 36.0 32.0 36.0 76 33.623311462755694 36.0 32.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 5.0 24 5.0 25 9.0 26 19.0 27 30.0 28 46.0 29 59.0 30 89.0 31 102.0 32 139.0 33 234.0 34 565.0 35 2697.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.5 13.075000000000001 10.65 43.775 2 20.4 17.575 37.55 24.474999999999998 3 18.8 20.525 24.575 36.1 4 23.95 29.15 21.125 25.775 5 21.5 33.6 25.75 19.15 6 19.224924012158056 33.94123606889564 25.962512664640325 20.871327254305978 7 14.424999999999999 24.099999999999998 42.199999999999996 19.275000000000002 8 16.475 23.9 34.275 25.35 9 17.724999999999998 24.25 33.300000000000004 24.725 10-11 21.2 32.775 23.0125 23.0125 12-13 19.8375 25.087500000000002 28.4 26.674999999999997 14-15 20.0125 26.924999999999997 29.225 23.8375 16-17 20.3875 27.5125 27.150000000000002 24.95 18-19 20.3875 26.887499999999996 28.375 24.349999999999998 20-21 20.925 27.325 27.400000000000002 24.349999999999998 22-23 20.45 27.487499999999997 27.725 24.337500000000002 24-25 20.4625 27.925 27.3625 24.25 26-27 20.7875 28.012500000000003 26.737499999999997 24.462500000000002 28-29 20.837500000000002 27.5125 27.200000000000003 24.45 30-31 20.2125 28.6375 26.674999999999997 24.474999999999998 32-33 19.3125 28.275 27.375 25.0375 34-35 21.4875 27.712500000000002 27.1625 23.6375 36-37 20.7875 28.1375 27.0 24.075 38-39 20.4375 27.987499999999997 26.5375 25.0375 40-41 21.2 27.775 26.825 24.2 42-43 21.6 27.025 27.0625 24.3125 44-45 20.825 27.775 27.462500000000002 23.9375 46-47 21.15 28.237499999999997 27.6125 23.0 48-49 21.075 27.925 26.6625 24.337500000000002 50-51 21.099999999999998 28.0625 27.1 23.7375 52-53 21.837500000000002 27.474999999999998 26.474999999999998 24.212500000000002 54-55 21.25 27.725 27.8625 23.1625 56-57 21.2375 27.6 27.075 24.087500000000002 58-59 21.125 27.8625 27.125 23.8875 60-61 21.5375 27.025 26.8 24.637500000000003 62-63 21.080270067516878 26.9567391847962 27.219304826206553 24.74368592148037 64-65 21.180295073768445 28.119529882470616 26.944236059014752 23.755938984746187 66-67 20.270101287982996 27.98549456046017 27.072652244591723 24.671751906965113 68-69 21.48574287143572 27.863931965982992 27.201100550275136 23.449224612306153 70-71 20.947973986993496 27.101050525262632 27.651325662831418 24.299649824912457 72-73 20.908634538152608 26.957831325301207 27.19628514056225 24.937248995983936 74-75 20.77384923282188 24.549699799866577 28.752501667778517 25.92394929953302 76 21.883442686221535 0.0 41.33539174064068 36.781165573137784 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 1.5 20 1.0 21 1.0 22 1.0 23 3.0 24 6.0 25 7.5 26 6.5 27 11.0 28 18.0 29 21.5 30 28.0 31 39.5 32 54.5 33 60.5 34 73.5 35 96.0 36 112.5 37 130.0 38 147.5 39 169.5 40 198.5 41 237.5 42 266.0 43 288.5 44 316.5 45 312.5 46 298.5 47 306.0 48 310.0 49 281.0 50 246.0 51 220.5 52 188.5 53 159.5 54 144.0 55 125.5 56 99.0 57 72.0 58 53.5 59 50.0 60 42.0 61 28.0 62 19.5 63 12.0 64 5.0 65 8.5 66 6.5 67 1.0 68 2.0 69 1.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.3 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 61 1.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 5.0 72 18.0 73 87.0 74 281.0 75 1016.0 76 2591.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.70558375634518 97.225 2 1.116751269035533 2.1999999999999997 3 0.15228426395939085 0.44999999999999996 4 0.0 0.0 5 0.025380710659898477 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9668924 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9668924_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.1705 32.0 32.0 32.0 32.0 32.0 2 31.0295 32.0 32.0 32.0 32.0 32.0 3 30.99625 32.0 32.0 32.0 32.0 32.0 4 30.87025 32.0 32.0 32.0 32.0 32.0 5 30.95125 32.0 32.0 32.0 32.0 32.0 6 34.28825 36.0 36.0 36.0 32.0 36.0 7 34.58625 36.0 36.0 36.0 32.0 36.0 8 34.37375 36.0 36.0 36.0 32.0 36.0 9 34.5685 36.0 36.0 36.0 32.0 36.0 10-11 34.33225 36.0 36.0 36.0 32.0 36.0 12-13 34.427375 36.0 36.0 36.0 32.0 36.0 14-15 34.360625 36.0 36.0 36.0 32.0 36.0 16-17 34.3515 36.0 36.0 36.0 32.0 36.0 18-19 34.412375 36.0 36.0 36.0 32.0 36.0 20-21 34.293625 36.0 36.0 36.0 32.0 36.0 22-23 34.354375 36.0 36.0 36.0 32.0 36.0 24-25 34.2305 36.0 36.0 36.0 32.0 36.0 26-27 34.234875 36.0 36.0 36.0 32.0 36.0 28-29 34.245875 36.0 36.0 36.0 32.0 36.0 30-31 34.144000000000005 36.0 36.0 36.0 32.0 36.0 32-33 34.097625 36.0 36.0 36.0 32.0 36.0 34-35 34.108999999999995 36.0 36.0 36.0 32.0 36.0 36-37 34.14296463506396 36.0 36.0 36.0 32.0 36.0 38-39 34.252194632555806 36.0 36.0 36.0 32.0 36.0 40-41 34.05668422372712 36.0 36.0 36.0 32.0 36.0 42-43 33.976423375971905 36.0 36.0 36.0 32.0 36.0 44-45 33.88219328644231 36.0 36.0 36.0 29.5 36.0 46-47 33.953191784209395 36.0 36.0 36.0 32.0 36.0 48-49 34.1417629331994 36.0 36.0 36.0 32.0 36.0 50-51 33.967604218985436 36.0 36.0 36.0 32.0 36.0 52-53 33.81818181818181 36.0 36.0 36.0 32.0 36.0 54-55 33.78540934203917 36.0 36.0 36.0 29.5 36.0 56-57 33.77172275238574 36.0 36.0 36.0 29.5 36.0 58-59 33.76418884982421 36.0 36.0 36.0 29.5 36.0 60-61 33.71848317428427 36.0 36.0 36.0 27.0 36.0 62-63 33.72770660638031 36.0 36.0 36.0 27.0 36.0 64-65 33.64091936699322 36.0 36.0 36.0 27.0 36.0 66-67 33.662984319992326 36.0 36.0 36.0 27.0 36.0 68-69 33.526130653266335 36.0 36.0 36.0 27.0 36.0 70-71 33.565764516222735 36.0 36.0 36.0 27.0 36.0 72-73 33.604778921432 36.0 36.0 36.0 27.0 36.0 74-75 33.73484166550638 36.0 36.0 36.0 27.0 36.0 76 32.680883472962684 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 3.0 16 7.0 17 7.0 18 11.0 19 3.0 20 12.0 21 10.0 22 14.0 23 20.0 24 24.0 25 37.0 26 37.0 27 54.0 28 73.0 29 75.0 30 117.0 31 157.0 32 188.0 33 261.0 34 629.0 35 2246.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.84744910781603 21.261623523498365 14.878110077909025 31.012817290776578 2 28.237951807228917 26.179718875502004 31.60140562248996 13.980923694779115 3 22.67368949084525 27.06295460245799 27.389014296463504 22.87434161023326 4 23.225482819162277 36.09229997491848 21.670428893905193 19.011788312014048 5 25.357411587659897 36.14246300476549 21.494858289440682 17.005267118133936 6 21.871081013293203 36.19262603461249 22.54828191622774 19.38801103586657 7 20.792575871582645 18.108853774767997 39.82944569852019 21.269124655129172 8 23.401053423626784 23.6267870579383 26.987710057687487 25.984449460747427 9 22.89942312515676 25.056433408577877 28.016052169551042 24.028091296714322 10-11 24.617506897416604 31.8660647103085 22.297466766992727 21.21896162528217 12-13 25.332330072736394 25.733634311512414 26.297968397291193 22.636067218459996 14-15 24.028091296714322 28.041133684474538 27.376473539001754 20.554301479809382 16-17 24.642409033877037 26.913425345043912 26.838143036386448 21.606022584692596 18-19 25.043892651116128 26.699272636067217 25.984449460747427 22.272385252069224 20-21 22.9177119919719 27.634219769192175 27.22027094831912 22.22779729051681 22-23 24.146586345381525 27.622991967871485 26.543674698795183 21.686746987951807 24-25 23.845960863020572 27.333166081284492 26.8314099347717 21.98946312092323 26-27 24.655129169801857 28.041133684474538 25.608226736894906 21.695510408828696 28-29 23.902132998745294 27.176913425345045 27.038895859473023 21.882057716436638 30-31 23.578154425612052 28.085373509102325 26.591337099811675 21.745134965473948 32-33 24.40401505646173 28.268506900878293 25.294855708908408 22.03262233375157 34-35 23.770080321285143 26.93273092369478 27.259036144578314 22.038152610441767 36-37 23.564878784072352 28.287903529707325 26.529330486119836 21.61788720010049 38-39 23.905935613682093 28.495975855130784 26.735412474849095 20.862676056338028 40-41 23.550132092087058 27.412253113599196 27.072587746886402 21.96502704742735 42-43 23.413897280966765 27.656092648539776 26.825276938569992 22.104733131923464 44-45 24.691202419964707 27.07335518023696 25.283589614318124 22.951852785480213 46-47 24.511903262375615 27.42158962085905 26.224965360876684 21.841541755888652 48-49 23.83764765016336 27.180196029153052 27.34355365669766 21.638602663985925 50-51 24.42824830359387 26.72782106056798 27.444081427494343 21.399849208343806 52-53 24.974849094567407 26.76056338028169 26.697686116700204 21.566901408450704 54-55 23.50276799194766 27.41570206341218 27.113739305485655 21.967790639154504 56-57 24.29506545820745 27.05186304128902 26.586102719033235 22.06696878147029 58-59 23.634533098414295 27.485527309338032 26.956959476466146 21.922980115781527 60-61 24.384422110552766 26.80904522613065 26.030150753768844 22.776381909547737 62-63 24.726587052168448 27.353865493400377 26.021370207416716 21.898177247014456 64-65 24.087591240875913 26.22703246916688 28.20286936823559 21.48250692172162 66-67 24.666498867354644 27.22124339290209 26.62975081802165 21.48250692172162 68-69 24.427672955974845 27.257861635220127 26.91823899371069 21.39622641509434 70-71 24.594696493653387 27.598341083322858 26.10280256378032 21.704159859243433 72-73 24.611693395630763 27.086753377951762 27.38982194721556 20.91173127920192 74-75 24.308724832214764 24.550335570469798 27.932885906040266 23.20805369127517 76 24.409748667174412 0.0 40.251332825590254 35.33891850723534 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 13.0 1 6.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.5 12 2.0 13 1.0 14 0.0 15 0.5 16 1.5 17 1.5 18 0.5 19 0.5 20 1.5 21 1.5 22 2.0 23 4.0 24 4.0 25 3.5 26 2.5 27 3.0 28 6.5 29 9.0 30 17.0 31 26.0 32 37.0 33 47.5 34 54.5 35 83.5 36 119.5 37 134.5 38 144.5 39 169.5 40 211.0 41 245.5 42 258.0 43 297.0 44 336.0 45 332.5 46 333.0 47 335.0 48 316.5 49 273.0 50 240.5 51 213.5 52 173.0 53 135.5 54 112.0 55 109.5 56 108.0 57 86.0 58 65.0 59 52.5 60 35.0 61 24.5 62 21.0 63 16.0 64 10.0 65 7.0 66 2.5 67 1.5 68 3.0 69 3.5 70 1.5 71 0.0 72 0.5 73 1.0 74 1.0 75 1.0 76 0.5 77 0.5 78 0.5 79 1.0 80 2.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.5 91 1.0 92 1.0 93 1.0 94 1.0 95 1.0 96 1.0 97 2.0 98 1.5 99 9.0 100 18.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.4 3 0.325 4 0.325 5 0.325 6 0.325 7 0.325 8 0.325 9 0.325 10-11 0.325 12-13 0.325 14-15 0.325 16-17 0.375 18-19 0.325 20-21 0.35000000000000003 22-23 0.4 24-25 0.35000000000000003 26-27 0.325 28-29 0.375 30-31 0.43750000000000006 32-33 0.375 34-35 0.4 36-37 0.16302984700275897 38-39 0.27589666415851516 40-41 0.3135189365437672 42-43 0.3762227238525207 44-45 0.451693851944793 46-47 0.35144973013681435 48-49 0.07533902561526871 50-51 0.07533902561526871 52-53 0.15067805123053743 54-55 0.20090406830738325 56-57 0.25113008538422904 58-59 0.22601707684580613 60-61 0.05022601707684581 62-63 0.08791760864104496 64-65 0.20095453403667418 66-67 0.18841854038437383 68-69 0.12562814070351758 70-71 0.025128785023244126 72-73 0.03786922494319616 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 13.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 1.0 44 2.0 45 0.0 46 1.0 47 1.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 0.0 68 0.0 69 0.0 70 1.0 71 6.0 72 24.0 73 78.0 74 292.0 75 953.0 76 2626.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.64588656106285 96.525 2 1.200817577925396 2.35 3 0.07664793050587634 0.22499999999999998 4 0.02554931016862545 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0510986203372509 0.8 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 19 0.475 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 13 0.325 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1752462 spots for SRR9668924.sra Written 1752462 spots for SRR9668924.sra Read 1752462 spots for SRR9668924.sra Written 1752462 spots for SRR9668924.sra Read 1752462 spots for SRR9668924.sra Written 1752462 spots for SRR9668924.sra Read 1752476 spots for SRR9668924.sra Written 1752476 spots for SRR9668924.sra Read 1752462 spots for SRR9668924.sra Written 1752462 spots for SRR9668924.sra Read 1752462 spots for SRR9668924.sra Written 1752462 spots for SRR9668924.sra Read 1752462 spots for SRR9668924.sra Written 1752462 spots for SRR9668924.sra Read 1752462 spots for SRR9668924.sra Written 1752462 spots for SRR9668924.sra Read 1752462 spots for SRR9668924.sra Written 1752462 spots for SRR9668924.sra Read 1752462 spots for SRR9668924.sra Written 1752462 spots for SRR9668924.sra Read 1752462 spots for SRR9668924.sra Written 1752462 spots for SRR9668924.sra Read 1752462 spots for SRR9668924.sra Written 1752462 spots for SRR9668924.sra Read 1752462 spots for SRR9668924.sra Written 1752462 spots for SRR9668924.sra Read 1752462 spots for SRR9668924.sra Written 1752462 spots for SRR9668924.sra Read 1752462 spots for SRR9668924.sra Written 1752462 spots for SRR9668924.sra Read 1752462 spots for SRR9668924.sra Written 1752462 spots for SRR9668924.sra Read 1752462 spots for SRR9668924.sra Written 1752462 spots for SRR9668924.sra Read 1752462 spots for SRR9668924.sra Written 1752462 spots for SRR9668924.sra Read 1752462 spots for SRR9668924.sra Written 1752462 spots for SRR9668924.sra Read 1752462 spots for SRR9668924.sra Written 1752462 spots for SRR9668924.sra SRR ids: ['SRR9668924.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0dln8_k9 SRR9668924.sra spots: 35049254 blocks: [[1, 1752462], [1752463, 3504924], [3504925, 5257386], [5257387, 7009848], [7009849, 8762310], [8762311, 10514772], [10514773, 12267234], [12267235, 14019696], [14019697, 15772158], [15772159, 17524620], [17524621, 19277082], [19277083, 21029544], [21029545, 22782006], [22782007, 24534468], [24534469, 26286930], [26286931, 28039392], [28039393, 29791854], [29791855, 31544316], [31544317, 33296778], [33296779, 35049254]] SRR9668924 file size 6653210 SRR9668924 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9668924 SRR9668924_1.fastq SRR9668924_2.fastq Input file: SRR9668924_1.fastq Paired file: SRR9668924_2.fastq trimmed: SRR9668924-trimmed-pair1.fastq, SRR9668924-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:47:56 2025 >> started Wed Feb 12 16:48:32 2025 >> done (35.826s) 35049254 read pairs processed; of these: 25 ( 0.00%) short read pairs filtered out after trimming by size control 4236 ( 0.01%) empty read pairs filtered out after trimming by size control 35044993 (99.99%) read pairs available; of these: 6547 ( 0.02%) trimmed read pairs available after processing 35038446 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 2 0.00% 21 6 0.00% 22 14 0.00% 23 10 0.00% 24 16 0.00% 25 19 0.00% 26 25 0.00% 27 29 0.00% 28 33 0.00% 29 50 0.00% 30 45 0.00% 31 53 0.00% 32 44 0.00% 33 43 0.00% 34 43 0.00% 35 198 0.00% 36 212 0.00% 37 218 0.00% 38 260 0.00% 39 274 0.00% 40 234 0.00% 41 299 0.00% 42 282 0.00% 43 326 0.00% 44 411 0.00% 45 322 0.00% 46 292 0.00% 47 363 0.00% 48 353 0.00% 49 467 0.00% 50 523 0.00% 51 622 0.00% 52 549 0.00% 53 570 0.00% 54 621 0.00% 55 977 0.00% 56 967 0.00% 57 1003 0.00% 58 1141 0.00% 59 1128 0.00% 60 1260 0.00% 61 1121 0.00% 62 1301 0.00% 63 1422 0.00% 64 1531 0.00% 65 1762 0.01% 66 1791 0.01% 67 2000 0.01% 68 2035 0.01% 69 2393 0.01% 70 3513 0.01% 71 5317 0.02% 72 24461 0.07% 73 311278 0.89% 74 2920536 8.33% 75 17049490 48.65% 76 14700738 41.95% 35044993 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=24 prefix-density=0.59 prefix-fanout=2.2 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=40.21 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.4 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCA criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=24 prefix-density=0.42 prefix-fanout=2.1 sequence=CCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=15.90 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.4 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR9668924 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:49:03 Started mapping on | Feb 12 16:49:03 Finished on | Feb 12 16:50:40 Mapping speed, Million of reads per hour | 1300.64 Number of input reads | 35044993 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 31786842 Uniquely mapped reads % | 90.70% Average mapped length | 150.44 Number of splices: Total | 14414502 Number of splices: Annotated (sjdb) | 14258606 Number of splices: GT/AG | 14157524 Number of splices: GC/AG | 220016 Number of splices: AT/AC | 9085 Number of splices: Non-canonical | 27877 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.02% Deletion average length | 2.18 Insertion rate per base | 0.01% Insertion average length | 1.92 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1367516 % of reads mapped to multiple loci | 3.90% Number of reads mapped to too many loci | 699775 % of reads mapped to too many loci | 2.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.30% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1890678 1890678 1890678 N_multimapping 1367516 1367516 1367516 N_noFeature 593709 31438732 691153 N_ambiguous 428221 1058 176836 UnstrandedReadsAssigned:30764912 PositiveStrandReadsAssigned:347052 NegativeStrandReadsAssigned:30918853 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR9668924 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR9668924-trimmed-pair1.fastq SRR9668924-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,044,993 reads, 32,237,921 reads pseudoaligned [quant] estimated average fragment length: 211.496 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52401 SRR9668924.ke.tsv 34699 SRR9668924.se.tsv 87100 total ==> SRR9668924.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1807.5 641.482 9.32109 Potri.005G024800.1.v4.1 1035 824.504 194 6.17974 Potri.004G059700.1.v4.1 961 750.504 60 2.09971 Potri.007G009000.2.v4.1 1416 1205.5 0 0 Potri.003G141000.2.v4.1 2943 2732.5 547.446 5.26189 Potri.016G087400.1.v4.1 270 82.1114 2513.89 804.091 Potri.015G069301.1.v4.1 564 353.806 0 0 Potri.010G195200.1.v4.1 1773 1562.5 16 0.268943 Potri.012G127500.1.v4.1 977 766.504 10326 353.817 ==> SRR9668924.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 50 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 559 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 216 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 33 SRR9668924 completed mapping pipeline successfully